ID: 977761332

View in Genome Browser
Species Human (GRCh38)
Location 4:100740567-100740589
Sequence CCAAAGTTCTATGCTGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977761332_977761340 20 Left 977761332 4:100740567-100740589 CCCTTTGCAGCATAGAACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 977761340 4:100740610-100740632 GGCCTTATAAGGAATGAGAAAGG 0: 1
1: 0
2: 0
3: 20
4: 230
977761332_977761338 9 Left 977761332 4:100740567-100740589 CCCTTTGCAGCATAGAACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 977761338 4:100740599-100740621 TTTTCCATGGTGGCCTTATAAGG 0: 1
1: 0
2: 0
3: 12
4: 140
977761332_977761343 28 Left 977761332 4:100740567-100740589 CCCTTTGCAGCATAGAACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 977761343 4:100740618-100740640 AAGGAATGAGAAAGGGAAGCCGG 0: 1
1: 2
2: 16
3: 207
4: 2098
977761332_977761336 -4 Left 977761332 4:100740567-100740589 CCCTTTGCAGCATAGAACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 977761336 4:100740586-100740608 TTGGACAAAAGGCTTTTCCATGG 0: 1
1: 0
2: 1
3: 14
4: 183
977761332_977761337 -1 Left 977761332 4:100740567-100740589 CCCTTTGCAGCATAGAACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 977761337 4:100740589-100740611 GACAAAAGGCTTTTCCATGGTGG 0: 1
1: 0
2: 0
3: 14
4: 245
977761332_977761341 21 Left 977761332 4:100740567-100740589 CCCTTTGCAGCATAGAACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 977761341 4:100740611-100740633 GCCTTATAAGGAATGAGAAAGGG 0: 1
1: 0
2: 2
3: 52
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977761332 Original CRISPR CCAAAGTTCTATGCTGCAAA GGG (reversed) Intronic
902726362 1:18338746-18338768 CCAAGGGTGTATGCTGCACACGG + Intronic
903749327 1:25610979-25611001 CCAAATATCAATGGTGCAAAGGG - Intergenic
909648547 1:77945989-77946011 CAAAAGTTATATGCTGAAGAAGG - Intronic
911371891 1:97003787-97003809 CCAATGTTCTCTGCTACAAATGG - Intergenic
914784029 1:150812013-150812035 CAATAGTTCTATTCTGAAAAGGG + Exonic
919275530 1:195410715-195410737 CCAAAGGTCTATGGTTCAATAGG - Intergenic
919660154 1:200236348-200236370 CCAAAGTACTCTGATGCATATGG + Intergenic
1063551064 10:7033700-7033722 CCAAAGTACTATGTTTAAAATGG - Intergenic
1063843649 10:10101505-10101527 CCAAAGTTATTTTCTTCAAAGGG + Intergenic
1073331589 10:102673502-102673524 TCAATGTCCTCTGCTGCAAAGGG + Intergenic
1073687776 10:105775019-105775041 CCAAAATTCTATAGAGCAAATGG + Intergenic
1073979529 10:109138905-109138927 CCAAAGTTCAAAATTGCAAATGG - Intergenic
1075113659 10:119608305-119608327 CCAAAGGTCACTGCTGCACAGGG + Intergenic
1077905557 11:6530180-6530202 CCAAAGTTCTATGTGGAAAGTGG + Intronic
1078088294 11:8247822-8247844 CCAAAGTTCTATGAGGCCCAGGG + Intronic
1083513115 11:63229966-63229988 CCAAAGTTCAATGCTGCTATTGG - Intronic
1087012260 11:93525167-93525189 CCACTGTGCTATGCAGCAAAAGG + Intronic
1087537201 11:99464179-99464201 CCAAAGTTACATGCTGAATATGG - Intronic
1089782242 11:120881873-120881895 CCAGAGTTCTCAGCTGCACAGGG - Intronic
1089819800 11:121214007-121214029 CGAAAGATCTATCATGCAAATGG + Intergenic
1096272355 12:50175411-50175433 CCAAATGTCTCTGCTGAAAATGG - Intergenic
1101752415 12:107593317-107593339 CCAAAATTTTTTTCTGCAAAGGG - Intronic
1102731148 12:115111294-115111316 TCAAAGTTTTATGCAGCAATTGG + Intergenic
1102855360 12:116288766-116288788 CCTAAGTTCTATTCTCCACATGG + Intergenic
1107013124 13:35687211-35687233 CCAAAGTTCTAAGGAGAAAACGG + Intergenic
1108155575 13:47581032-47581054 AGAAAATTCTATGATGCAAATGG + Intergenic
1111013964 13:82352180-82352202 ACAAATTTCTCTGCTGCACATGG - Intergenic
1111040227 13:82738656-82738678 AGAAAGTTCTATCATGCAAATGG - Intergenic
1113704469 13:112418301-112418323 CCAAATTTCTATGTTTCATAAGG - Intronic
1113793995 13:113046231-113046253 CCAAATTTCATTGCTGCCAAAGG + Intronic
1117572999 14:57067748-57067770 CCATATTTATTTGCTGCAAATGG - Intergenic
1118058127 14:62104197-62104219 ACTAAGTCCTCTGCTGCAAAAGG - Exonic
1118365763 14:65094462-65094484 CCAAGGTGCTATCCTGCCAAGGG + Intronic
1120157048 14:81104957-81104979 CTAAATATCTATGCTGGAAAGGG - Intronic
1122766424 14:104074365-104074387 ACAAAGTGCTAAGCTGCAGATGG + Intergenic
1126734188 15:51715170-51715192 CCAGAGTTCTATGCTTCACCAGG - Intronic
1128373377 15:67057581-67057603 CCAAAGTGCTATAATCCAAAGGG + Intergenic
1133775736 16:8893931-8893953 CCAAAGTTCTAGGCTGTTAAGGG + Exonic
1134318891 16:13144693-13144715 CTAAAGTTTTATGCTGAAACTGG + Intronic
1137556093 16:49471310-49471332 CAAAAGCTCTAAGGTGCAAATGG - Intergenic
1138005070 16:53326704-53326726 CAAAAGTGCAATACTGCAAAGGG - Exonic
1138094597 16:54202062-54202084 CCAAAGTGCTAGGCTCAAAAAGG - Intergenic
1139191870 16:64873531-64873553 CCAACGTTTTATGCTGAGAAGGG + Intergenic
1141048762 16:80742012-80742034 GCACAGTTCTATGCTTCAAATGG + Intronic
1142539273 17:645534-645556 CCAAAGTCCTAGGCAACAAAAGG - Intronic
1145823700 17:27860411-27860433 GCAAAGCTCTATGGTGGAAAGGG - Intronic
1152143987 17:78556562-78556584 TCAAAGTTGTATGGTACAAATGG + Intronic
1156193189 18:34743648-34743670 CAAAAATTCTATGTTGCAGAAGG - Intronic
1158200434 18:54932944-54932966 CCCTAGTTCTATGCTACACATGG + Intronic
1161669723 19:5599520-5599542 CCAAATTTCAATGCTCCAGATGG + Intronic
1164921736 19:32093511-32093533 CCAGAGCTCTGTGCTGGAAATGG - Intergenic
928012564 2:27623822-27623844 CAAAAGTTCTAACCTGCAAGTGG - Intergenic
931018812 2:58018457-58018479 CTAAAATTCTCTGCTACAAATGG - Intronic
934211789 2:89986245-89986267 CCAAATTTGCAAGCTGCAAAGGG - Intergenic
935076341 2:99748182-99748204 CCAAAGTTCCTTTCTCCAAAGGG + Intronic
936058475 2:109279281-109279303 CCAAGGTTAACTGCTGCAAAGGG + Intronic
937160132 2:119752642-119752664 TCAAAGTGCCATGCTGTAAATGG + Intergenic
938962504 2:136355849-136355871 CCAGAATTGTATGCTTCAAAAGG + Intergenic
944020006 2:195091049-195091071 CCATAGGTCTATGCTGAAGAAGG + Intergenic
944821430 2:203436168-203436190 CCAAAGGCATATCCTGCAAAGGG - Exonic
944883081 2:204034886-204034908 CCAAAGTTCTTTCCTGCCTACGG - Intergenic
945334857 2:208580185-208580207 CCAGAGTTCTCTGCTACACATGG - Intronic
946097634 2:217289455-217289477 CCAAAGTGCTATCCTGCTAAGGG - Intronic
947866102 2:233398934-233398956 CCACAGCTCTAGGCTGCTAAGGG - Intronic
1170141071 20:13125344-13125366 CAATAGTTCTCTGCTGCCAAAGG + Intronic
1175185665 20:57178363-57178385 CCAAGGCTCAATGCTGCAAGGGG + Intronic
1177920980 21:27152300-27152322 GGAAAGTTCTTTACTGCAAATGG + Intergenic
1179333587 21:40428961-40428983 CAAAAGTGCCATGCTGCAAGGGG - Intronic
951464186 3:22984374-22984396 TCAAAGTTGTATTCTTCAAATGG + Intergenic
953439407 3:42905340-42905362 CCAAAGTTTTATCATGCAGATGG - Intronic
956384118 3:68698874-68698896 CCATAATTCTCTTCTGCAAAAGG - Intergenic
956786606 3:72648038-72648060 CCGAAGTTCAATGGAGCAAAGGG + Intergenic
960304860 3:116048984-116049006 CTGAATTTCAATGCTGCAAATGG + Intronic
960561026 3:119084376-119084398 CCAGAGGTCTATGGTGCAAGTGG - Intronic
961331271 3:126141183-126141205 ACAAAGTTTGATGCTGCAAGAGG + Intronic
963765889 3:149335668-149335690 ACAAAGTTAAATGCTGCCAAAGG + Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
966403937 3:179575648-179575670 CCACAGTTCTGTGCTGCAGATGG - Intronic
967520872 3:190431515-190431537 CCAAACTTATAAACTGCAAAGGG - Intronic
970661771 4:18293360-18293382 CCAGAGTTCTTTGCTGCTATGGG - Intergenic
972176200 4:36409508-36409530 CCAGAGTTCCATCCTGCAAGTGG + Intergenic
972660228 4:41109188-41109210 CAGAAGTTCTAGGCTGCAATGGG + Intronic
974112336 4:57539796-57539818 CCACAGTTCAAAGCTGTAAATGG + Intergenic
977353083 4:95913066-95913088 CCAAAGTTTTATTCTGGAACAGG - Intergenic
977721087 4:100241248-100241270 ACAAGGTTCTATGCTGACAAAGG + Intergenic
977761332 4:100740567-100740589 CCAAAGTTCTATGCTGCAAAGGG - Intronic
978693010 4:111538725-111538747 CCAGATTTCTATGGTGTAAATGG - Intergenic
980492011 4:133540625-133540647 CCAAAGTTTTATCATGCACATGG + Intergenic
988847658 5:35145160-35145182 CAAACGTTTTATGCTGGAAAAGG + Intronic
990399305 5:55421718-55421740 ACAAAGTCCTCTGCTGCACAGGG - Intronic
992857634 5:80878984-80879006 CCAAAAGTCTATGATTCAAATGG - Intergenic
996376615 5:122815588-122815610 GCAAAGTATTATGTTGCAAAGGG - Intronic
996896853 5:128494465-128494487 CCAAAAATTTATCCTGCAAAGGG + Intronic
1003450027 6:6222299-6222321 CAAATGTTCCATGCTGGAAAAGG + Intronic
1004822121 6:19378512-19378534 CCAAAGATCTTTACTGCATATGG + Intergenic
1008036412 6:46749664-46749686 CCAGAGTCACATGCTGCAAAGGG - Intronic
1008189850 6:48441226-48441248 CCAAAGTACTATTGAGCAAAAGG - Intergenic
1009502062 6:64426026-64426048 AGAAAGTTCTATGCTGGAACAGG + Intronic
1013800383 6:113935025-113935047 CCAAAGTTATATTCTTAAAAAGG - Exonic
1014527674 6:122520479-122520501 CCATAGGTCTATTCTGCAGATGG + Intronic
1021475130 7:21052082-21052104 CCAAAGTGTTATGCTCAAAAAGG + Intergenic
1021777521 7:24068105-24068127 CCAAAGATCATTGCTGCAGAAGG + Intergenic
1022161958 7:27719877-27719899 CCAATGTTCTATGTTTCTAAGGG + Intergenic
1022185749 7:27966672-27966694 CCAAATTTCTCTGGTGGAAAAGG + Intronic
1023261786 7:38365553-38365575 TCAAAGTTCAATTCTCCAAAAGG + Intergenic
1024133886 7:46387105-46387127 CCTCAGTTCTTTTCTGCAAATGG + Intergenic
1024829677 7:53435547-53435569 CCGAATTCCTATGCTGCAAAAGG + Intergenic
1027920231 7:84383648-84383670 CCAAATTTCTGTGGTGTAAAAGG + Intronic
1029144746 7:98437781-98437803 CGAAAGTTCTCACCTGCAAATGG - Intergenic
1029533004 7:101137791-101137813 CCGTAGTTCCATCCTGCAAAGGG - Exonic
1030744763 7:113151825-113151847 TCAAAGTTATTTGCTGCAAAGGG + Intergenic
1030954571 7:115836218-115836240 CCAAAGTTCTATTCAGCACCAGG - Intergenic
1032265991 7:130370383-130370405 CCAAAGTTTTCTGCTGCTAGTGG + Intergenic
1032819474 7:135510976-135510998 CCAGAGTTCTGGGATGCAAACGG - Intergenic
1033636159 7:143213152-143213174 CAAAAGTTTTGTGCTTCAAAGGG - Intergenic
1033796947 7:144856353-144856375 ACAAAAATTTATGCTGCAAAAGG + Intergenic
1040875282 8:52144831-52144853 TCAAAGTTTTATGCTGTAAATGG + Intronic
1043387632 8:79764198-79764220 CCACAGTTCCATGCACCAAAAGG + Exonic
1045563181 8:103285773-103285795 CCAGAGTTCCTTGCTGCCAAAGG - Intergenic
1045851544 8:106704708-106704730 CCAAAGTACCATATTGCAAATGG - Intronic
1046348644 8:112973594-112973616 CCAAATTTCTAAACTGGAAATGG - Intronic
1047791472 8:128208074-128208096 CAGAAGTTCTTTTCTGCAAAGGG + Intergenic
1048037437 8:130690861-130690883 GAAAAGATCTATGATGCAAATGG - Intergenic
1053176171 9:35926137-35926159 TCAAAGTTCTATTCTCAAAATGG + Intergenic
1054967239 9:71043559-71043581 CAAGAGGTCTATGCAGCAAATGG - Intronic
1055428120 9:76216677-76216699 CCAAAGTTCTATTCAGGAAATGG - Intronic
1058919773 9:109602337-109602359 CAAATATTCTATGTTGCAAATGG - Intergenic
1061225869 9:129280731-129280753 CCACTGCTCTAGGCTGCAAAGGG + Intergenic
1062037236 9:134387915-134387937 TCAGAGTTCTTTGCTGCAAGAGG - Intronic
1187869134 X:23749884-23749906 TCAAGGTTCTGTTCTGCAAAGGG - Intronic
1189119228 X:38376217-38376239 ACAAAGAGCTTTGCTGCAAAGGG + Intronic
1192560436 X:72124525-72124547 CCAAAGCTCTATGCTGCTCTAGG + Intergenic
1194104611 X:89753381-89753403 CCAAAGTTTTATTATGCAGAGGG + Intergenic
1195350581 X:103992264-103992286 CCAAAGTTGTATCCCCCAAAAGG - Intergenic
1196189215 X:112777433-112777455 CCAAAGTACTATGCTGCAGTCGG - Exonic
1196934521 X:120716266-120716288 CCAAAGATCAATCCTACAAATGG - Intergenic
1198009835 X:132540468-132540490 CCAAAGTTCTCTGCTTTTAAGGG + Intergenic
1200456566 Y:3401160-3401182 CCAAAGTTTTATTATGCAGATGG + Intergenic
1201677947 Y:16608598-16608620 CCATAGTTTTATGATTCAAAAGG + Intergenic