ID: 977763664

View in Genome Browser
Species Human (GRCh38)
Location 4:100771956-100771978
Sequence GCAATATGTAGATTTACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 394}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977763664_977763665 0 Left 977763664 4:100771956-100771978 CCAGAAGTAAATCTACATATTGC 0: 1
1: 0
2: 4
3: 58
4: 394
Right 977763665 4:100771979-100772001 AGTTAATTGACTCTTGACAAAGG 0: 1
1: 1
2: 12
3: 128
4: 789
977763664_977763668 26 Left 977763664 4:100771956-100771978 CCAGAAGTAAATCTACATATTGC 0: 1
1: 0
2: 4
3: 58
4: 394
Right 977763668 4:100772005-100772027 CAAGAACACACAATGAGGAAAGG 0: 14
1: 142
2: 488
3: 1638
4: 7484
977763664_977763666 21 Left 977763664 4:100771956-100771978 CCAGAAGTAAATCTACATATTGC 0: 1
1: 0
2: 4
3: 58
4: 394
Right 977763666 4:100772000-100772022 GGTGCCAAGAACACACAATGAGG 0: 63
1: 229
2: 809
3: 1420
4: 2138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977763664 Original CRISPR GCAATATGTAGATTTACTTC TGG (reversed) Intronic
900037490 1:428994-429016 ATAATATGTAGATTTATTTATGG + Intergenic
900059117 1:664735-664757 ATAATATGTAGATTTATTTATGG + Intergenic
905330605 1:37193116-37193138 GCAATAGGTGGATTTAACTCAGG - Intergenic
905973689 1:42159860-42159882 TAAATGTGTAGATTTATTTCTGG + Intergenic
906735850 1:48126687-48126709 TAAATGTGTAAATTTACTTCTGG - Intergenic
906910369 1:49942514-49942536 TAAATATGTGGATTTATTTCTGG - Intronic
909849362 1:80440914-80440936 GCAATACTTTGATTTTCTTCTGG + Intergenic
909857789 1:80561199-80561221 GTAAAATGTAGATTTACTGGGGG - Intergenic
910155971 1:84219758-84219780 GTAATATGTGGATTTATTTATGG + Intronic
911082585 1:93948205-93948227 TAAATATGTGGATTTACATCTGG + Intergenic
911975111 1:104483027-104483049 GCAATATTTATATCTACTTGAGG - Intergenic
913029359 1:114883502-114883524 GGAATATGCAAATTTTCTTCAGG - Intronic
913132448 1:115853565-115853587 TAAATATGTGGATTTATTTCTGG + Intergenic
913571886 1:120128761-120128783 TCAAGATGCAGATTTGCTTCTGG + Intergenic
914292805 1:146290384-146290406 TCAAGATGCAGATTTGCTTCTGG + Intergenic
914443667 1:147730163-147730185 AAAATATGTGGATTTACTTCTGG + Intergenic
914553849 1:148741167-148741189 TCAAGATGCAGATTTGCTTCTGG + Intergenic
914978012 1:152384211-152384233 TAAATATGTGGATTTATTTCTGG + Intergenic
915683996 1:157612465-157612487 TAAATGTGTAGATTTACTTCTGG - Intergenic
916393146 1:164355077-164355099 TAAATATGTGGATTTACTTCTGG - Intergenic
917383688 1:174443989-174444011 TAAATGTGTAGATTTATTTCTGG + Intronic
917446585 1:175110675-175110697 TAAATATGTGGATTTATTTCTGG + Intronic
917991449 1:180383852-180383874 TAAATACCTAGATTTACTTCTGG - Intronic
918651583 1:186970716-186970738 GCAATGGGTGGATTTATTTCTGG + Intronic
918774874 1:188614446-188614468 CAAATATGTGGATTTATTTCTGG - Intergenic
918788029 1:188789727-188789749 GCAGTGTGAAGCTTTACTTCTGG - Intergenic
918851876 1:189702170-189702192 GCAAGATGATGATTTATTTCTGG - Intergenic
919144700 1:193619204-193619226 TAAATGTGTAGATTTACTTCTGG - Intergenic
919606890 1:199694276-199694298 GCAATATTTTGAATGACTTCAGG + Intergenic
920602406 1:207341563-207341585 TAAATATGTGGATTTATTTCTGG + Intronic
921393785 1:214646554-214646576 GCATCATGCAGATTTACTTAAGG + Exonic
921518586 1:216129889-216129911 TAAATATGCAGATTTATTTCTGG - Intronic
924359545 1:243222958-243222980 GCAATTTTTAGATTTAATGCAGG - Intronic
924488151 1:244507791-244507813 TAAATATGTGGATTTATTTCTGG + Intronic
924537407 1:244948255-244948277 TAAATATGTGGATTTATTTCTGG - Intergenic
1063071255 10:2668186-2668208 GCAATTTGTATATTCCCTTCAGG - Intergenic
1064965158 10:21007849-21007871 GAAACATGTAGTGTTACTTCTGG - Intronic
1065994642 10:31046405-31046427 TAAATATGTAGATTTATTTCTGG + Intergenic
1066544453 10:36484269-36484291 AGAAAATGTAGATTTGCTTCAGG + Intergenic
1066762205 10:38766022-38766044 TCAATATGTATATTTATTTTAGG + Intergenic
1066959388 10:42206446-42206468 TCAATATGTATATTTATTTTAGG - Intergenic
1067216065 10:44304451-44304473 TAAATGTGTAGATTTATTTCTGG - Intergenic
1067294336 10:44966330-44966352 GCATGATTTACATTTACTTCCGG - Intronic
1067959359 10:50830941-50830963 TAAATGTGTGGATTTACTTCTGG - Intronic
1068185273 10:53577179-53577201 GCAATATGTAGAGGAACTTGTGG + Intergenic
1068190412 10:53644549-53644571 GAAATATGTACATTTAGTTAGGG + Intergenic
1069820513 10:71224752-71224774 GCAATTTGTGGATTTCCTTCTGG - Intronic
1074173540 10:110971362-110971384 TAAATATGTGGATTTATTTCTGG + Intronic
1074656431 10:115593424-115593446 TAAATGTGCAGATTTACTTCTGG - Intronic
1076964215 11:66917-66939 ATAATATGTAGATTTATTTATGG + Intergenic
1078071649 11:8116077-8116099 TAAATATGTGGATTTATTTCTGG - Intronic
1078194394 11:9123036-9123058 TAAATATGTAGCTTTATTTCTGG - Intronic
1078667402 11:13338265-13338287 GGAATTTGTAGAGTTATTTCTGG + Intronic
1080067289 11:28032549-28032571 TAAATATGTAGATTTATTTTGGG - Intronic
1081001963 11:37685410-37685432 TAAATATGCAGATTTATTTCTGG - Intergenic
1081324884 11:41731973-41731995 TAAATATGTAGATTTATTTCTGG + Intergenic
1081441303 11:43084541-43084563 TGAACATGTAGATTTACTTCTGG + Intergenic
1086488679 11:87336510-87336532 TCAATAGGAAGATTGACTTCTGG + Intergenic
1087313883 11:96583538-96583560 TAAATATGTGGGTTTACTTCTGG - Intergenic
1087466946 11:98520061-98520083 ACCGTATGTAGATTTACTTTGGG - Intergenic
1088347298 11:108841520-108841542 TGAATATTTAGATATACTTCGGG - Intronic
1090303160 11:125665085-125665107 TAAAAATGTAGATTTATTTCTGG + Intronic
1092031833 12:5292988-5293010 GCATTAAGTAGTTTTACTTAAGG + Intergenic
1093303639 12:17483909-17483931 TAAACATGTAGATTTATTTCTGG - Intergenic
1094436507 12:30426037-30426059 GCAATTTAGAAATTTACTTCAGG - Intergenic
1095667940 12:44824558-44824580 GAAATGTATAGATTTATTTCTGG + Intronic
1095853615 12:46837055-46837077 TAAATGTGTAGATTTATTTCTGG + Intergenic
1096295997 12:50384628-50384650 GAAATGTGTGGATTTATTTCTGG - Intronic
1096415975 12:51413729-51413751 TAAATATGTGGATTTATTTCTGG + Intronic
1096544197 12:52326331-52326353 GCAATATGTAGATAGACTAATGG + Intergenic
1096949481 12:55451478-55451500 GTTAAATGTAGATTTGCTTCTGG + Intergenic
1097554399 12:61119215-61119237 AAAATATGTAAATTTATTTCTGG + Intergenic
1098607936 12:72416686-72416708 TAAATATGTGGATTTATTTCTGG + Intronic
1098912862 12:76227809-76227831 CAAATATATGGATTTACTTCTGG + Intergenic
1099293650 12:80803436-80803458 TAAATATGTGGATTTATTTCTGG + Intronic
1099298069 12:80855735-80855757 ACAGTATGTACATTTACATCAGG - Intronic
1101545552 12:105708854-105708876 GTAATATCTAGATTCACTTCTGG + Intergenic
1106307471 13:28526298-28526320 GCAATATGTTGACTTCCTACTGG - Intergenic
1107322582 13:39205120-39205142 GCAATTTGTAAATTTAATCCTGG - Intergenic
1109070169 13:57755350-57755372 TAAATATGTGGATTTATTTCTGG + Intergenic
1109700088 13:66013057-66013079 TAAATATGTGGATTTATTTCTGG - Intergenic
1110152751 13:72274756-72274778 GCAATATGAAGATGCATTTCAGG + Intergenic
1110351689 13:74515934-74515956 GCAAGATTTAAATTTAATTCTGG - Intergenic
1110398379 13:75059997-75060019 TAAATATGTGGATTTATTTCTGG - Intergenic
1110622668 13:77615687-77615709 CAAATATGTAGATTTTTTTCAGG - Intronic
1110870100 13:80441520-80441542 TAAATATGTGGATTTATTTCTGG + Intergenic
1110965778 13:81694767-81694789 GCTGTATGTGGATTTACTTCTGG + Intergenic
1111000682 13:82176029-82176051 TAAAAACGTAGATTTACTTCTGG - Intergenic
1111376767 13:87389978-87390000 TAAATATGTAGATTTGTTTCTGG + Intergenic
1111722232 13:91960734-91960756 TACATATGTAGATTTATTTCTGG - Intronic
1114154334 14:20083562-20083584 GAAATGTGTGGATTTATTTCTGG - Intergenic
1114159377 14:20146468-20146490 GCAATATGTAGAAATATTTTTGG - Intergenic
1114274584 14:21131102-21131124 TAAATATGTGGATTTATTTCTGG - Intergenic
1115033359 14:28826667-28826689 GCAATATGTCTATTTTCCTCTGG + Intergenic
1115695513 14:35893699-35893721 TAAATATGTGGATTTATTTCTGG + Intronic
1116239104 14:42318480-42318502 CAAATATGTAGATTAATTTCCGG + Intergenic
1116714008 14:48405922-48405944 TAAATATGTGGATTTATTTCTGG + Intergenic
1116747354 14:48837551-48837573 TAAATATGTGGATTTATTTCTGG - Intergenic
1117306804 14:54485831-54485853 TAAATGTGTAGATTTACTTCTGG - Intronic
1117744617 14:58855746-58855768 TAAATATGTGGATTTATTTCTGG + Intergenic
1117891756 14:60429569-60429591 TAAATATGTGGATTTATTTCTGG + Intronic
1118665140 14:68060886-68060908 TAAATATGTGGATTTATTTCTGG + Intronic
1121479702 14:94255141-94255163 GAAAGATGAAGATTTAATTCTGG - Intronic
1121892773 14:97611541-97611563 TGAATATGTAGATTTATTTATGG + Intergenic
1202832238 14_GL000009v2_random:47856-47878 GAAATATGTGAATTTATTTCTGG + Intergenic
1202933539 14_KI270725v1_random:62280-62302 TCAATATGTATATTTATTTTAGG + Intergenic
1123685451 15:22793877-22793899 TAAATATGTAGATTTATTTCTGG + Intronic
1126236826 15:46395140-46395162 GTATTATCTAGATTTTCTTCTGG - Intergenic
1126331653 15:47538665-47538687 GCAATAAATAGGTTTATTTCAGG + Intronic
1126566306 15:50103913-50103935 TAAATATTTAGCTTTACTTCTGG - Intronic
1126998121 15:54468756-54468778 TAAATATGTGGATTTATTTCTGG + Intronic
1130166235 15:81461812-81461834 TAAATATGTGGATTTATTTCTGG + Intergenic
1130692731 15:86098622-86098644 CAAATATGTGGATTTATTTCTGG + Intergenic
1132334252 15:101034563-101034585 TAAATATGTGGATTTATTTCTGG + Intronic
1132444334 15:101898265-101898287 ATAATATGTAGATTTATTTATGG - Intergenic
1134743342 16:16568013-16568035 CATATGTGTAGATTTACTTCTGG - Intergenic
1134924217 16:18144449-18144471 CATATGTGTAGATTTACTTCTGG + Intergenic
1137528362 16:49258653-49258675 TAAATGTGTAGATTTATTTCTGG - Intergenic
1138253600 16:55530380-55530402 GCACTATCTAAATATACTTCAGG - Intronic
1138917135 16:61479201-61479223 TAAATATGTGGATTTATTTCTGG - Intergenic
1140884471 16:79230772-79230794 GCAATAAGTACATTTTGTTCAGG - Intergenic
1141147646 16:81542944-81542966 GCAGTATGTAGCTTGACTTGTGG + Intronic
1141273678 16:82565085-82565107 TTAATGTGTAGATTTATTTCTGG - Intergenic
1144420066 17:15088311-15088333 CCACTAAGTAGAGTTACTTCCGG - Intergenic
1145852341 17:28112706-28112728 ACAATATATAGATGTGCTTCAGG - Intronic
1146117908 17:30158771-30158793 TAAATATGTGGATTTATTTCTGG + Intronic
1147533415 17:41301403-41301425 CCTCTATGTAGATTTCCTTCAGG - Intergenic
1148399943 17:47349498-47349520 ACAATATGTAAATTTTTTTCTGG + Intronic
1150151639 17:62814101-62814123 TAAATATGTAGATTTATTTCTGG + Intergenic
1150305470 17:64081209-64081231 GGAATATGTAGAGCTACTCCAGG - Intronic
1150467797 17:65409275-65409297 CAAATATGTGGATTTATTTCTGG - Intergenic
1151264449 17:72943644-72943666 GCAAGAGGTGGATTTACTTTAGG - Intronic
1153862645 18:9229120-9229142 TAAATATGCAGATTTATTTCTGG + Intronic
1154074108 18:11182201-11182223 GGAATTTGTTGATTTTCTTCTGG + Intergenic
1154422132 18:14241242-14241264 GAAATATGTGGATTTATTTCTGG + Intergenic
1155106943 18:22676372-22676394 ACAATATGTAGATGAACTTTTGG + Intergenic
1155124659 18:22860601-22860623 TAAATATGTAGTTTTACTTCTGG - Intronic
1155708998 18:28852372-28852394 TCAATATGCAGCATTACTTCTGG - Intergenic
1156052643 18:32955358-32955380 GTAATGTGTAGATTTCTTTCAGG + Intronic
1156433727 18:37103337-37103359 TAAATACGTAGATTTATTTCTGG - Intronic
1156810136 18:41239296-41239318 TAAATGTGTAGATTTATTTCTGG + Intergenic
1158637236 18:59170858-59170880 TAAATATGTGGATTTATTTCTGG - Intergenic
1158913864 18:62099646-62099668 TAAATATGTGGATTTATTTCTGG - Intronic
1159169351 18:64744254-64744276 TAAATAGGTAGATTTATTTCTGG + Intergenic
1159399545 18:67913144-67913166 GCAATATGTAAAACCACTTCAGG - Intergenic
1159576547 18:70185054-70185076 ACTATATGTGGGTTTACTTCTGG - Intronic
1160303468 18:77707666-77707688 TAAATATGTGGATTTATTTCTGG - Intergenic
1160641018 19:136549-136571 ATAATATGTAGATTTATTTATGG + Intergenic
1164373660 19:27665298-27665320 GCAATATGTGGATTCATCTCAGG - Intergenic
1202640446 1_KI270706v1_random:79915-79937 GAAATATGTGGATTTATTTCTGG - Intergenic
925179013 2:1804613-1804635 GGAAGATTTTGATTTACTTCAGG + Intronic
925678399 2:6390835-6390857 TCAATATGTGGATTTATTTTTGG + Intergenic
927612180 2:24551957-24551979 ATAATATGTAGATTTATTTCTGG + Intronic
927614861 2:24582785-24582807 TAAATATGTAGATTTATTTCTGG - Intronic
928271826 2:29862945-29862967 GAAATGTGTGGATTTATTTCTGG - Intronic
928838061 2:35570856-35570878 TAAATATGTGGATTTACCTCTGG + Intergenic
929732197 2:44507779-44507801 GCAGTAAGTTGATTTAATTCTGG - Intronic
929734844 2:44536845-44536867 TAAATATGTGCATTTACTTCTGG - Intronic
929954453 2:46444778-46444800 ACAATATGCAGATTTTCTTTGGG - Intronic
930539290 2:52684533-52684555 TAAATATGTGGATTTACTTCTGG - Intergenic
930574762 2:53133144-53133166 GTAATATGCTGACTTACTTCCGG + Intergenic
930638739 2:53833846-53833868 GAAATATGTAGATTTATTTCTGG - Intergenic
930838527 2:55820908-55820930 ATAATGTGTAGATTTAGTTCTGG - Intergenic
932184368 2:69679815-69679837 GAAATAAGTGGATTTACTTCCGG + Intronic
933474837 2:82777195-82777217 TGAGTGTGTAGATTTACTTCTGG - Intergenic
934133104 2:88968742-88968764 ACAATATTTAGATTTTCTTCAGG - Intergenic
934140581 2:89043426-89043448 AAAATATTTAGATTTTCTTCAGG - Intergenic
934220670 2:90079401-90079423 AAAATATTTAGATTTTCTTCAGG + Intergenic
934228656 2:90157116-90157138 AAAATATTTAGATTTTCTTCAGG + Intergenic
934325518 2:92010641-92010663 TCAATATGTATATTTATTTTAGG + Intergenic
934463869 2:94241273-94241295 TCAATATGTATATTTATTTTAGG + Intergenic
935288215 2:101585086-101585108 TAAATATGTGGATTTATTTCTGG + Intergenic
936134934 2:109883011-109883033 GTAATATGTGGCTTTATTTCTGG + Intergenic
936209763 2:110488474-110488496 GTAATATGTGGCTTTATTTCTGG - Intergenic
936428953 2:112443724-112443746 GTAATATGTGGCTTTATTTCTGG - Intergenic
937731088 2:125230456-125230478 TAAATATGTGGATTTATTTCTGG + Intergenic
937760685 2:125599311-125599333 TAAATTTGTAGCTTTACTTCTGG + Intergenic
938629353 2:133149324-133149346 CCATTATGTAGCTTTACATCTGG - Intronic
938642163 2:133292456-133292478 GCATTTTGTAGATTTATTTGGGG - Intronic
939171070 2:138696304-138696326 GAAATATGTGGGTTTATTTCTGG - Intronic
939516092 2:143169936-143169958 GCATCATGAAGATTTACTTGAGG - Intronic
939710801 2:145517034-145517056 TAAATATGAAGATTTATTTCTGG - Intergenic
940000635 2:148963662-148963684 GCCATATGAAGTTTTATTTCGGG + Intronic
941308651 2:163902048-163902070 TAAATATGTAGCTTTATTTCTGG - Intergenic
941583343 2:167327066-167327088 TAAATATGTAGATTTATTTCTGG + Intergenic
941846186 2:170136002-170136024 TAAATATGTGGATTTATTTCTGG - Intergenic
941861156 2:170282412-170282434 TAAATATGTAGGTTTACTTTGGG + Intronic
942053287 2:172160966-172160988 GATATATGTGGATTTATTTCTGG + Intergenic
943291677 2:186080005-186080027 TGAATATGTAGATTTACAGCAGG - Intergenic
943714696 2:191137699-191137721 TAAATATGTGGATTTATTTCTGG - Intronic
944900147 2:204205662-204205684 ACAAAATGTAGATTAACTGCAGG + Intergenic
945218307 2:207458880-207458902 GCAAAATCTAGAAGTACTTCAGG + Intergenic
945353362 2:208808542-208808564 ACAATATGTAAATTTATTTTGGG + Intronic
945464705 2:210154809-210154831 GCAATGTGTAGCTTTAATTGGGG - Intronic
945475761 2:210280348-210280370 TAAATATGTGGATTTATTTCTGG + Intergenic
945789689 2:214289539-214289561 TAAATATATGGATTTACTTCTGG + Intronic
945970763 2:216228689-216228711 TAAATATGTGGATTTATTTCTGG + Intergenic
1170456125 20:16534804-16534826 AAAATATGTGGATTTATTTCTGG + Intronic
1172985035 20:38979001-38979023 TAAATGTGTGGATTTACTTCTGG + Intronic
1174889158 20:54370921-54370943 TAAATATGTGGATTTATTTCTGG + Intergenic
1176594936 21:8684438-8684460 TCAATATGTATATTTATTTTAGG + Intergenic
1176851353 21:13918713-13918735 GAAATATGTGGATTTATTTCTGG - Intergenic
1177934017 21:27319385-27319407 GCAAAATGTTGATTCTCTTCAGG - Intergenic
1178070042 21:28954614-28954636 CAAATATGTGGATTTATTTCTGG - Intronic
1178197281 21:30361198-30361220 ACAATATCTAAATTTGCTTCTGG - Intronic
1179118293 21:38516797-38516819 TGAATATGTGGATTTATTTCTGG - Intronic
1180361498 22:11901965-11901987 GAAATATGTGGATTTATTTCTGG + Intergenic
1180585023 22:16880428-16880450 TCAATATGTATATTTATTTTAGG + Intergenic
1181597284 22:23924342-23924364 GGATTTTGTTGATTTACTTCTGG + Intergenic
950986891 3:17381885-17381907 GCTATATGTGGATTTCCGTCTGG - Intronic
951314655 3:21174475-21174497 TAAATATGTGGATTTACTTCTGG + Intergenic
951382704 3:22004129-22004151 TAAATATGTGGATTTATTTCTGG - Intronic
952144039 3:30512206-30512228 GCATTATGAAGTTTTGCTTCAGG - Intergenic
952226785 3:31385558-31385580 GCACTATGTTGTTTTAATTCAGG - Intergenic
952243289 3:31557194-31557216 TAAATATGTGGATTTACTTTTGG + Intronic
952635484 3:35524216-35524238 TCAGTATGTAGATATACTTCAGG - Intergenic
953224447 3:41003676-41003698 TAAATGTGTAGATTTATTTCTGG + Intergenic
953592840 3:44276481-44276503 TAAATAGGTAAATTTACTTCTGG + Intronic
955031003 3:55218082-55218104 TAAATATGTAAATTTATTTCTGG + Intergenic
956734486 3:72227754-72227776 GCAGAGTGTAGAATTACTTCTGG + Intergenic
957492391 3:80945477-80945499 TAAATATGTGGATTTATTTCTGG + Intergenic
957618123 3:82558933-82558955 GCATTATGTCCATTTATTTCTGG + Intergenic
957687568 3:83522058-83522080 GAAATATATAGTTGTACTTCCGG - Intergenic
958005609 3:87806938-87806960 TAAATATGTAGATTTATTTCTGG + Intergenic
958703882 3:97628560-97628582 AAAAAATGTAGATATACTTCAGG + Intronic
958897993 3:99851516-99851538 GCAATAATTTTATTTACTTCAGG + Intronic
959147000 3:102559079-102559101 GAAATGTGTAGATTTATTTCTGG + Intergenic
959304900 3:104649943-104649965 TAAATATGTGGATTTACTTCTGG + Intergenic
959860789 3:111212618-111212640 GCAATATTTTGAGTTTCTTCTGG + Intronic
960415922 3:117384879-117384901 TAAATATGTGGATTTACTTCTGG - Intergenic
962554560 3:136534088-136534110 TAAATATGTGGATTTATTTCTGG - Intronic
962628741 3:137254145-137254167 GTAATATATATATTTATTTCTGG - Intergenic
963818451 3:149860451-149860473 TAAATATGTGAATTTACTTCTGG - Intronic
964705984 3:159619028-159619050 TATGTATGTAGATTTACTTCGGG + Intronic
964872387 3:161327445-161327467 TGAATACGTAGATTTATTTCTGG + Intergenic
964997152 3:162896280-162896302 TAAATATGTGGATTTACATCTGG - Intergenic
965477891 3:169180039-169180061 CCAATTTGTTGATTTACTTTCGG + Intronic
966083619 3:176038439-176038461 TAAATATGTGGATTTATTTCTGG + Intergenic
966173778 3:177113044-177113066 TAAATGTGTAGATTTACTTTTGG - Intronic
966286397 3:178301023-178301045 GCAATATGTATATATAATTTTGG + Intergenic
966591025 3:181683106-181683128 TAAATACGTAGATTTATTTCTGG + Intergenic
966964352 3:184974866-184974888 CAAATATGTGGATTTATTTCTGG + Intronic
967605987 3:191447494-191447516 TAAATGTGTGGATTTACTTCTGG + Intergenic
967830698 3:193917295-193917317 ACAATATGTGAACTTACTTCTGG - Intergenic
1202738108 3_GL000221v1_random:27486-27508 GAAATATGTGAATTTATTTCAGG + Intergenic
970130304 4:12862381-12862403 GGAAAATGTAGATATAATTCAGG - Intergenic
971023846 4:22568394-22568416 TAAATATGTAGATTTATTTCTGG + Intergenic
971906262 4:32730323-32730345 TAAATATGTGGATTTATTTCTGG + Intergenic
972837022 4:42883794-42883816 TAAATATGTGGATTTATTTCTGG + Intergenic
973141381 4:46772831-46772853 GAAATAGGTAGCTTTACTACTGG - Intronic
973224680 4:47769697-47769719 TCAATGTGTGGATTTATTTCTGG - Intronic
973383961 4:49490426-49490448 GAAATATGTGGATTTATTTCTGG - Intergenic
973658498 4:53076913-53076935 GCAATATGTAAAATGACTTCTGG - Intronic
974057052 4:56994235-56994257 GCAATATGGATATTGACTTTGGG + Intronic
974261054 4:59524247-59524269 TCAATATGTAGCTTTATTTCTGG + Intergenic
974633253 4:64523589-64523611 TGAATATGTGGATTTATTTCTGG + Intergenic
974755329 4:66198547-66198569 TCCAAATGTAGATTTACTTTTGG + Intergenic
974769237 4:66389214-66389236 TTAATATGTAGATTTACCTCTGG - Intergenic
974784501 4:66600799-66600821 TAAATATCTAGATTTATTTCTGG - Intergenic
974919226 4:68217419-68217441 AAAATATGTAGATTTACATACGG + Intergenic
975635877 4:76447511-76447533 CCAACATGTATATTTATTTCTGG - Intronic
976024285 4:80668610-80668632 TAAATATGTGGATTTATTTCTGG + Intronic
976280546 4:83322755-83322777 GCAATTTGTAGCTCTAATTCTGG + Intronic
976667303 4:87609991-87610013 GCAATATCTAGCATTGCTTCAGG - Intronic
977011007 4:91633330-91633352 TAAATATGTAGATTTATTTCTGG - Intergenic
977012312 4:91653288-91653310 TAAATAGGCAGATTTACTTCTGG + Intergenic
977063951 4:92289583-92289605 GAAATATGTAAATTTACTACTGG + Intergenic
977763664 4:100771956-100771978 GCAATATGTAGATTTACTTCTGG - Intronic
977855287 4:101883001-101883023 GCAATTTGGTGATTTACTTCTGG + Intronic
978280953 4:107013373-107013395 TAAATGTGTAGATTTATTTCTGG - Intronic
978894566 4:113871517-113871539 GAAATATTTTGATTTCCTTCAGG + Intergenic
979281543 4:118874025-118874047 TAAATATGTAGTTTTATTTCTGG + Intronic
979589158 4:122458544-122458566 GCAATATATGGCTATACTTCTGG + Intergenic
979907347 4:126312115-126312137 TAAATATGTGGATTTATTTCTGG - Intergenic
979980084 4:127244095-127244117 TAAATATGTAAATTTATTTCTGG - Intergenic
980797896 4:137709328-137709350 TAAATATGTGGATTTATTTCTGG + Intergenic
981181003 4:141744313-141744335 TAAATATGTGGATTTATTTCTGG + Intergenic
981251318 4:142605050-142605072 TAAATATGTGGATTTATTTCTGG - Intronic
981291010 4:143074634-143074656 TAAATGTGTAGATTTATTTCTGG + Intergenic
982789988 4:159579802-159579824 TCAATTTGTGGATTTACTTTTGG + Intergenic
983318344 4:166162564-166162586 GCAAGATGTAGATTTCCATGAGG - Intergenic
983889671 4:173017329-173017351 GAAGAATGTAGATTTTCTTCAGG - Intronic
984517944 4:180765221-180765243 GCATTATGTTTATTTTCTTCAGG + Intergenic
1202767811 4_GL000008v2_random:165759-165781 GAAATATGTGGATTTATTTCTGG - Intergenic
985751331 5:1678546-1678568 AAAATATGTGGATTTATTTCTGG + Intergenic
986108292 5:4682902-4682924 CAAATGTGTAGATTTATTTCTGG - Intergenic
986185448 5:5431792-5431814 GAAATTTCTAGATTTGCTTCTGG + Intronic
986552214 5:8969939-8969961 TAAATATGTGGATTTATTTCTGG + Intergenic
987791380 5:22572830-22572852 GCAACCTTTAGATCTACTTCTGG - Intronic
988148707 5:27347231-27347253 GCATTATCTAGCTTTCCTTCGGG - Intergenic
988890843 5:35615800-35615822 TAAATATGTGGATTTATTTCTGG - Intergenic
989533405 5:42535465-42535487 GTAATATTTGGATTTATTTCTGG + Intronic
990209823 5:53470542-53470564 GCAATATGAAGATTGACCACTGG + Intergenic
991187536 5:63827475-63827497 CCAATATGTTGACTTATTTCAGG - Intergenic
991438854 5:66624726-66624748 TAAATATGTAGGTTTATTTCTGG - Intronic
991948162 5:71921236-71921258 GAAATATGTGGATTTATTTCTGG - Intergenic
992135846 5:73743960-73743982 GAAAGATGTAGATTTATTTCTGG + Intronic
992525299 5:77603883-77603905 TAAATATGTGGATTTATTTCTGG + Intronic
992785030 5:80162020-80162042 TAAATATGTGGCTTTACTTCTGG + Intronic
993348072 5:86810030-86810052 TCAATATGTAGATTTCCTTTTGG - Intergenic
993914525 5:93726619-93726641 CCCAGATGTAGATCTACTTCTGG - Intronic
993941950 5:94069121-94069143 TAAATATGTGGATTTATTTCTGG - Intronic
994341065 5:98628341-98628363 TAAATATGTGGATTTACTTCTGG - Intergenic
994948014 5:106421689-106421711 TAAATATGTGGATTTACTTCTGG + Intergenic
995280203 5:110326372-110326394 GTTATATGTGGATTTTCTTCTGG + Intronic
995810522 5:116102365-116102387 TAAATATGTAGCTTTATTTCTGG + Intronic
996361007 5:122646465-122646487 TAAATATGTAGATTTATTTCTGG - Intergenic
996507264 5:124281694-124281716 GCAATATGTTGATTAAAGTCAGG + Intergenic
998010651 5:138692843-138692865 TAAATATGTGGATTTATTTCTGG + Intronic
998793537 5:145792546-145792568 GCCTTAAGTAGCTTTACTTCTGG - Intronic
1000354683 5:160382777-160382799 TAAATGTGTAGATTTATTTCTGG - Intergenic
1000448242 5:161351380-161351402 TAAATATGTGGATTTATTTCTGG - Intronic
1000498344 5:162014754-162014776 TAAATATGTGGATTTATTTCTGG - Intergenic
1000572518 5:162932846-162932868 GTAATATATGGATTTATTTCTGG + Intergenic
1000766177 5:165293340-165293362 TAAATATGTAGACATACTTCTGG - Intergenic
1000834764 5:166140857-166140879 TAAATATGTACATTTATTTCTGG - Intergenic
1001602113 5:172935562-172935584 ACCATATGGAGATTTGCTTCAGG - Intronic
1002736331 5:181389872-181389894 ATAATATGTAGATTTATTTATGG - Intergenic
1002748365 6:84952-84974 ATAATATGTAGATTTATTTATGG + Intergenic
1002893617 6:1360414-1360436 GCAATGTGTTGTTTTGCTTCAGG + Intergenic
1002975817 6:2074953-2074975 TAAGTATGTAGATTTATTTCTGG + Intronic
1003711247 6:8593024-8593046 TAAATGTGTAGATTTATTTCTGG - Intergenic
1003960261 6:11202571-11202593 GCAACATGTGGCTTTTCTTCTGG - Intronic
1004819375 6:19350432-19350454 GGAATATGTAAAATAACTTCAGG - Intergenic
1005558884 6:27017539-27017561 TAAATGTGTAGATTTATTTCTGG - Intergenic
1006054040 6:31367426-31367448 GCAATATGCAGGTCTACTCCTGG - Intergenic
1006279757 6:33041347-33041369 TAAATATGTGGATTTATTTCTGG + Intergenic
1006691145 6:35887202-35887224 ACAGTATGTTGATTTACTTTTGG + Intronic
1006757316 6:36427626-36427648 ACAATATTTAGATTTATTTGGGG - Intronic
1007120218 6:39374058-39374080 TAAATATGTAGGTTTATTTCTGG - Intronic
1007190664 6:40014839-40014861 TAAATATGTAGCTTTATTTCGGG + Intergenic
1009670719 6:66746022-66746044 TAAATATGTGGATTTATTTCTGG + Intergenic
1009875850 6:69504438-69504460 TAAATATGTAGATTTATTACTGG - Intergenic
1010306525 6:74329942-74329964 TAAATATGTAGCTTTATTTCTGG + Intergenic
1010484667 6:76395461-76395483 TAAACATGTAGATTTATTTCTGG + Intergenic
1010555911 6:77279160-77279182 GAATTCTGTAGATTTCCTTCAGG - Intergenic
1010675233 6:78735811-78735833 TAAATATGTGGATTTATTTCTGG + Intergenic
1011116804 6:83902329-83902351 TAAATATGTGGATTTATTTCTGG + Intronic
1011152941 6:84294934-84294956 TAAATGTGTAGATTTATTTCTGG + Intergenic
1011159752 6:84375821-84375843 TAAATATGTAGATTCATTTCTGG + Intergenic
1011332097 6:86220365-86220387 TATATATGTAGATTTATTTCTGG + Intergenic
1012601625 6:101105500-101105522 GCAACATGAAGCTTTACTTAAGG + Intergenic
1013861988 6:114646887-114646909 GCAAGATGTAGCCTTACTTGTGG + Intergenic
1014339325 6:120183272-120183294 GAAATGTGTGGATTTATTTCTGG + Intergenic
1015105791 6:129534848-129534870 GTAATATGTATATTAACTACTGG + Intergenic
1016095826 6:140035742-140035764 TCAATATTTAGGTTTACATCAGG - Intergenic
1016103542 6:140133175-140133197 AAAATATGTGGTTTTACTTCTGG - Intergenic
1016294169 6:142556309-142556331 TAAATATGTGGATTTATTTCTGG - Intergenic
1017638740 6:156469582-156469604 TAAATATGTAGATTTACTTCTGG - Intergenic
1017927031 6:158919538-158919560 GCCATATTTAGCTTTAATTCAGG + Intergenic
1018562157 6:165111695-165111717 TAAATATGTGGATTCACTTCCGG + Intergenic
1019241429 6:170665401-170665423 ATAATATGTAGATTTATTTATGG - Intergenic
1021081056 7:16365527-16365549 GCTTTATGTAGATTTATTTCTGG - Intronic
1021739819 7:23675386-23675408 TAAATATGTAGGTTTGCTTCTGG + Intergenic
1022293586 7:29028126-29028148 TAAATATGTGGATTTATTTCTGG - Intronic
1023102181 7:36729328-36729350 CAAATATGTATATTTATTTCTGG + Intergenic
1023232187 7:38045484-38045506 TAAATATGTGGATTTATTTCTGG + Intergenic
1023409568 7:39876288-39876310 TAAATATGTAGATTTATTTCTGG + Intergenic
1024995858 7:55272743-55272765 GCAATATTTGGTTGTACTTCTGG - Intergenic
1025043366 7:55667738-55667760 TAAATATGTAGATTTATTTCTGG - Intergenic
1025136285 7:56416261-56416283 TAAATATGTAGATTTATTTCTGG - Intergenic
1026615837 7:71903384-71903406 TAAATATGTGGATTTATTTCTGG - Intronic
1027518912 7:79179606-79179628 TCAATATGTAGATTTATTCCTGG - Intronic
1027732346 7:81890655-81890677 TAAATGTGTAGATTTATTTCTGG - Intergenic
1027958350 7:84911463-84911485 GCAAAATATGGATTTAATTCAGG + Intergenic
1028249085 7:88518971-88518993 GCAACATGTCGGTTTTCTTCTGG + Intergenic
1031189002 7:118522376-118522398 TAAATGTGTAGATTTATTTCTGG - Intergenic
1031569017 7:123335079-123335101 TAAATATGTGGATTTATTTCTGG - Intergenic
1031651194 7:124291851-124291873 TAAATGTGTAGATTTATTTCTGG + Intergenic
1031747329 7:125517341-125517363 CCAATTTGGAGATATACTTCAGG - Intergenic
1032930886 7:136668807-136668829 TAAATATGTGGATTTATTTCTGG + Intergenic
1034155222 7:148950565-148950587 GCAAGATCTAGGTTGACTTCAGG + Intergenic
1034518060 7:151597107-151597129 GTAATGTGTGGATTTATTTCTGG - Intronic
1034842076 7:154407799-154407821 CCAATATGGAGATTGAGTTCTGG + Intronic
1034910765 7:154996645-154996667 GCTATATGTAGAGTCACTGCCGG - Intronic
1035506687 8:142695-142717 ATAATATGTAGATTTATTTATGG + Intergenic
1035976418 8:4316778-4316800 GCACAATATAGATTTACTTCTGG - Intronic
1036894220 8:12619043-12619065 GAAATATGTGGATTCATTTCTGG - Intergenic
1037114652 8:15209830-15209852 GAACAATGTATATTTACTTCCGG - Intronic
1037147364 8:15588864-15588886 TGAATATGTGGATTTATTTCTGG + Intronic
1038195142 8:25360377-25360399 GCAATATGTAGATGTGCCTGTGG + Intronic
1039805984 8:40998941-40998963 GAAATTTGTTCATTTACTTCTGG + Intergenic
1040100876 8:43502684-43502706 TAAATATGTGGATTTATTTCTGG + Intergenic
1041078978 8:54196839-54196861 TAAATATGTGGATTTATTTCTGG + Intergenic
1042818105 8:72900178-72900200 TAAGTATGTAGCTTTACTTCTGG - Intronic
1043047862 8:75350725-75350747 GTAATATTTAGCTTTATTTCTGG - Intergenic
1043116456 8:76260213-76260235 TAAATATGTGGATTTATTTCTGG - Intergenic
1043194333 8:77272412-77272434 GCAATAAGTATTTTTAATTCAGG - Intergenic
1043630181 8:82321382-82321404 GTAATATGTAGATTGAATTTGGG + Intergenic
1043715268 8:83476280-83476302 TAAACATGTGGATTTACTTCTGG - Intergenic
1043794051 8:84512836-84512858 TAAATATGTTGATTTATTTCTGG + Intronic
1044393986 8:91687803-91687825 TCTATGTTTAGATTTACTTCTGG - Intergenic
1046120938 8:109846106-109846128 TAAATATGTGGATTTATTTCTGG + Intergenic
1047888108 8:129275606-129275628 TAAATATGTGAATTTACTTCTGG + Intergenic
1047972913 8:130101089-130101111 TAAATATGTGGATTTATTTCTGG + Intronic
1050047903 9:1567596-1567618 TAAATATATACATTTACTTCTGG + Intergenic
1051044710 9:12858754-12858776 GCATGAGGTAGATTTATTTCAGG - Intergenic
1051864240 9:21661551-21661573 GAAATATATATATTTCCTTCTGG + Intergenic
1052327939 9:27236939-27236961 CAAATGTGTAGATTTATTTCTGG - Intergenic
1052591247 9:30498336-30498358 TAAATATGTATATTTATTTCTGG - Intergenic
1052600649 9:30625515-30625537 GCAATTTGAAGATCTATTTCTGG + Intergenic
1052694782 9:31863611-31863633 GAAGTATGCAGATTTATTTCTGG + Intergenic
1053661137 9:40280498-40280520 TAAATATGTGGATTTATTTCTGG + Intronic
1053693962 9:40618075-40618097 TCAATATGTATATTTATTTTAGG + Intergenic
1053911511 9:42909835-42909857 TAAATATGTGGATTTATTTCTGG + Intergenic
1053940953 9:43248498-43248520 TCAATATGTATATTTATTTTAGG + Intergenic
1054270873 9:63022047-63022069 TCAATATGTATATTTATTTTAGG - Intergenic
1054305207 9:63417299-63417321 TCAATATGTATATTTATTTTAGG + Intergenic
1054362123 9:64133397-64133419 GATATATGTGGATTTATTTCTGG + Intergenic
1054373254 9:64426713-64426735 TAAATATGTGGATTTATTTCTGG + Intergenic
1054403954 9:64741293-64741315 TCAATATGTATATTTATTTTAGG + Intergenic
1054437575 9:65226793-65226815 TCAATATGTATATTTATTTTAGG + Intergenic
1054492828 9:65795174-65795196 TCAATATGTATATTTATTTTAGG - Intergenic
1054523473 9:66095786-66095808 TAAATATGTGGATTTATTTCTGG - Intergenic
1054680887 9:67916491-67916513 TAAATATGTGGATTTATTTCTGG + Intergenic
1055392705 9:75840362-75840384 ACAGTATGTAGAATTGCTTCAGG + Intergenic
1057536645 9:95916019-95916041 TGAACATGTATATTTACTTCAGG - Intronic
1057679372 9:97163722-97163744 TAAATATGTGGATTTATTTCTGG - Intergenic
1057798307 9:98173641-98173663 GCAATAGGTGGATTTTGTTCCGG - Intronic
1058351590 9:104031240-104031262 CCACTATGTAGCTTTTCTTCAGG - Intergenic
1203692222 Un_GL000214v1:54680-54702 GAAATATGTGGATTTATTTCTGG - Intergenic
1203706837 Un_KI270742v1:57930-57952 GAAATATGTGAATTTATTTCTGG + Intergenic
1203556410 Un_KI270744v1:1572-1594 GAAATATGTGGATTTATTTCTGG - Intergenic
1203601621 Un_KI270748v1:14635-14657 ATAATATGTAGATTTATTTATGG - Intergenic
1203644073 Un_KI270751v1:49511-49533 GAAATATGTGGATTTATTTCTGG + Intergenic
1186941486 X:14513098-14513120 GCTATATTTAGCTTTATTTCTGG - Intergenic
1187614459 X:20977936-20977958 GAAATATGTAGATTTAATTGTGG - Intergenic
1188074046 X:25753930-25753952 CCAATATGTCAATTTATTTCAGG - Intergenic
1188393449 X:29650451-29650473 TAAATGTGTAGATTTATTTCTGG - Intronic
1188925820 X:36042740-36042762 GAAATATGTAAATTTATTTGTGG - Intronic
1190585649 X:51937980-51938002 TAAATGTATAGATTTACTTCTGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1192716984 X:73653374-73653396 AAAATATGTGGATTTACTTCAGG + Intronic
1192979274 X:76321604-76321626 TCAAGTTATAGATTTACTTCTGG - Intergenic
1193375391 X:80753831-80753853 TAAATATGTAGATTTATTTCTGG + Intronic
1193883529 X:86956860-86956882 CAAATATGTGGATTTATTTCTGG + Intergenic
1194168062 X:90546637-90546659 ATATTATGTAGATATACTTCTGG - Intergenic
1194176622 X:90657507-90657529 TATATATGTAGATTTATTTCTGG + Intergenic
1194472570 X:94315460-94315482 TAAATATGTGGATTTATTTCTGG + Intergenic
1194689085 X:96959926-96959948 TAAATATATGGATTTACTTCTGG + Intronic
1194837881 X:98703665-98703687 TTAATATGTGGATTTATTTCTGG + Intergenic
1195027423 X:100891520-100891542 TAAATGTGTAGATTTATTTCTGG - Intergenic
1196008447 X:110860407-110860429 GCTGTGTGTAGATTTATTTCTGG - Intergenic
1196169131 X:112567924-112567946 TAAATATGTAGATTTACTTCTGG + Intergenic
1197166824 X:123386767-123386789 TAAATATGTGGATTTATTTCTGG + Intronic
1197375568 X:125678236-125678258 TAAATATGCAGATTTATTTCTGG + Intergenic
1198123055 X:133613199-133613221 TAAATACTTAGATTTACTTCTGG - Intronic
1198192657 X:134325264-134325286 TAAATATGTGGATTTACTTATGG + Intergenic
1198813426 X:140560385-140560407 TAAATATGTGGATTTATTTCTGG + Intergenic
1199232928 X:145460312-145460334 GAAATACTTAGATTTCCTTCAGG - Intergenic
1199244720 X:145590018-145590040 TAAATATGTAGATTTGTTTCTGG - Intergenic
1199431422 X:147764662-147764684 AGAAGATGTAGATTTATTTCAGG - Intergenic
1199832177 X:151558093-151558115 TCAATATGTGGATTTACTTTTGG - Intergenic
1200326330 X:155243772-155243794 GTAATGTGTAGATTTACTTCTGG + Intergenic
1200514314 Y:4124419-4124441 ATATTATGTAGATATACTTCTGG - Intergenic
1201191733 Y:11449620-11449642 TCAATATGTATATTTATTTTAGG + Intergenic