ID: 977766318

View in Genome Browser
Species Human (GRCh38)
Location 4:100802382-100802404
Sequence TCCTTCTCAGGTTGCCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977766318_977766322 10 Left 977766318 4:100802382-100802404 CCTGAGGGGCAACCTGAGAAGGA No data
Right 977766322 4:100802415-100802437 AATGGAACTATTCTGTATCTTGG 0: 2
1: 0
2: 9
3: 38
4: 323
977766318_977766321 -8 Left 977766318 4:100802382-100802404 CCTGAGGGGCAACCTGAGAAGGA No data
Right 977766321 4:100802397-100802419 GAGAAGGATTTTTGGAGCAATGG 0: 1
1: 0
2: 2
3: 27
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977766318 Original CRISPR TCCTTCTCAGGTTGCCCCTC AGG (reversed) Intronic