ID: 977766321

View in Genome Browser
Species Human (GRCh38)
Location 4:100802397-100802419
Sequence GAGAAGGATTTTTGGAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977766318_977766321 -8 Left 977766318 4:100802382-100802404 CCTGAGGGGCAACCTGAGAAGGA No data
Right 977766321 4:100802397-100802419 GAGAAGGATTTTTGGAGCAATGG 0: 1
1: 0
2: 2
3: 27
4: 352
977766312_977766321 22 Left 977766312 4:100802352-100802374 CCAGGACTCAGGAGTTAAGTGTG 0: 1
1: 0
2: 1
3: 8
4: 129
Right 977766321 4:100802397-100802419 GAGAAGGATTTTTGGAGCAATGG 0: 1
1: 0
2: 2
3: 27
4: 352
977766316_977766321 -7 Left 977766316 4:100802381-100802403 CCCTGAGGGGCAACCTGAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 192
Right 977766321 4:100802397-100802419 GAGAAGGATTTTTGGAGCAATGG 0: 1
1: 0
2: 2
3: 27
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977766321 Original CRISPR GAGAAGGATTTTTGGAGCAA TGG Intronic