ID: 977766322

View in Genome Browser
Species Human (GRCh38)
Location 4:100802415-100802437
Sequence AATGGAACTATTCTGTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 2, 1: 0, 2: 9, 3: 38, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977766320_977766322 -2 Left 977766320 4:100802394-100802416 CCTGAGAAGGATTTTTGGAGCAA 0: 1
1: 0
2: 1
3: 27
4: 210
Right 977766322 4:100802415-100802437 AATGGAACTATTCTGTATCTTGG 0: 2
1: 0
2: 9
3: 38
4: 323
977766316_977766322 11 Left 977766316 4:100802381-100802403 CCCTGAGGGGCAACCTGAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 192
Right 977766322 4:100802415-100802437 AATGGAACTATTCTGTATCTTGG 0: 2
1: 0
2: 9
3: 38
4: 323
977766318_977766322 10 Left 977766318 4:100802382-100802404 CCTGAGGGGCAACCTGAGAAGGA No data
Right 977766322 4:100802415-100802437 AATGGAACTATTCTGTATCTTGG 0: 2
1: 0
2: 9
3: 38
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977766322 Original CRISPR AATGGAACTATTCTGTATCT TGG Intronic