ID: 977767184

View in Genome Browser
Species Human (GRCh38)
Location 4:100812906-100812928
Sequence CTCTGGTTAAATAGTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977767182_977767184 -10 Left 977767182 4:100812893-100812915 CCATTGTCGTTAACTCTGGTTAA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 977767184 4:100812906-100812928 CTCTGGTTAAATAGTCATGGAGG 0: 1
1: 0
2: 0
3: 11
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977767184 Original CRISPR CTCTGGTTAAATAGTCATGG AGG Intronic
903140846 1:21338346-21338368 GTTTGATTAAATGGTCATGGTGG - Intronic
904955780 1:34282849-34282871 CTCTGTTTAGATAGTCATGTTGG - Intergenic
908225449 1:62051679-62051701 CTGTGCTTAATTAGTCCTGGAGG + Intronic
915127563 1:153676782-153676804 CTCTGGTTAATTGCTCATGGAGG + Intergenic
918866610 1:189908071-189908093 TTCTGGTTACAGAGTCAGGGTGG + Intergenic
921496384 1:215847169-215847191 CTCTTGTTAAAGAATCATTGTGG - Intronic
1063545966 10:6981878-6981900 CCCTGCTTAAATAGTCAAGAGGG + Intergenic
1064194820 10:13236021-13236043 CTTTTTTTAAATAGACATGGGGG - Intergenic
1065258823 10:23903395-23903417 CTTTGGTTAAATAGGTATGATGG - Intronic
1065754397 10:28917838-28917860 CTCTGCCTCCATAGTCATGGGGG + Intergenic
1073833769 10:107417026-107417048 CTCTGGTGAAAAACTTATGGCGG - Intergenic
1074318373 10:112379094-112379116 CTCTGTTTAAATAGAAATGAGGG + Intronic
1074323145 10:112422052-112422074 CTGTGGTCAGACAGTCATGGTGG + Intronic
1079379979 11:19929575-19929597 CCCTGGTTATTAAGTCATGGGGG - Intronic
1084328669 11:68416740-68416762 CGTTGTTTAAGTAGTCATGGTGG + Intronic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1092145266 12:6210372-6210394 CACTGGTCATATAGTCAGGGTGG - Intronic
1093385449 12:18548050-18548072 CTCGGGTTAAACAGTCAGAGGGG - Intronic
1093590938 12:20901834-20901856 CTCTGGTTATATGGTAATTGAGG + Intronic
1093604799 12:21076932-21076954 CTCTGGTTATATGGTCATTGAGG + Intronic
1096427022 12:51512567-51512589 CTGTGGTGAAAGAGTCAAGGTGG + Exonic
1096766021 12:53890533-53890555 ATTTGTATAAATAGTCATGGAGG + Intergenic
1098593550 12:72242927-72242949 CTCTGGTTAAAGAGATATGAAGG + Intronic
1100870196 12:98902779-98902801 CTCTGGTTGAATAATTATTGTGG - Intronic
1104125412 12:125841359-125841381 GTCTGGTTAGACAGTCATGATGG + Intergenic
1108404946 13:50091596-50091618 GTGTGGTTTTATAGTCATGGTGG + Intronic
1108716908 13:53089402-53089424 CTCTGCTTACATAGTCATATAGG - Intergenic
1109522039 13:63526146-63526168 CTTTGGATAGATTGTCATGGAGG - Intergenic
1109795072 13:67300370-67300392 CTCTGGTAAAATTGTGATGGAGG + Intergenic
1121768128 14:96505077-96505099 GTCTGATTTAAGAGTCATGGTGG + Intronic
1127918696 15:63476273-63476295 CTCTAGGAAAATAGTCATTGAGG - Intergenic
1128445785 15:67759036-67759058 CTCTGTTTAATTTGGCATGGAGG + Intronic
1130058510 15:80551560-80551582 CTCTGGGGAAACAGTCAAGGGGG - Intronic
1133124920 16:3640591-3640613 CTCTGTTTATATACTCATGTAGG - Intronic
1137606623 16:49791011-49791033 CCATGGTTACATAGTCAAGGGGG - Intronic
1138536095 16:57661017-57661039 CACTGGTCTAAGAGTCATGGAGG + Intronic
1139221599 16:65187999-65188021 CTCTGGATCAATATTGATGGAGG - Intergenic
1139501843 16:67372916-67372938 GTCTGGTAAAATAGGCATAGGGG - Intronic
1142008894 16:87703864-87703886 CTCTCGTGAAAGAGTAATGGAGG + Intronic
1144697281 17:17313582-17313604 TGCTGGATAAATAGTCATGAGGG - Intronic
1148039425 17:44694915-44694937 TTCTTTTTAAATAGTGATGGTGG - Intergenic
1148527130 17:48350150-48350172 CTCTGGTAAAATTGTCATTATGG - Intronic
1152192781 17:78898689-78898711 CTCTGATTCAATAGTCTGGGTGG + Intronic
1152429925 17:80243139-80243161 CTCTCGTGAAATTGTCAGGGTGG - Intronic
1156224113 18:35085545-35085567 CTCTGGTGGAATATTCCTGGGGG - Intronic
1157001651 18:43533853-43533875 TTTTGTTTAAATAGTCTTGGGGG - Intergenic
1158465343 18:57685182-57685204 CTTTGCTTATATAGTGATGGTGG + Intronic
1166166769 19:40995674-40995696 CTCTTGTAAAATAGTAATAGAGG - Intronic
925140020 2:1543888-1543910 CTCTGGAAACACAGTCATGGTGG + Intergenic
933208653 2:79539406-79539428 CTCTGGATATAAAGTCATGAAGG + Intronic
934489419 2:94749866-94749888 CTATGGTTAATTGGTCAGGGAGG - Intergenic
938580907 2:132645786-132645808 CTCCGGTTACACAGACATGGGGG + Exonic
942190781 2:173467733-173467755 CTGTGATTAAATATTCTTGGAGG + Intergenic
944259310 2:197658585-197658607 CTCTGTTTAAAAAGTAATAGGGG - Intronic
944873383 2:203936472-203936494 CTCTGAATCAATAGTTATGGGGG - Intergenic
947000244 2:225446911-225446933 CTCTGGTTGAATTGTCCTGTGGG - Intronic
948237981 2:236404553-236404575 TGCTGGTTTAATGGTCATGGTGG + Intronic
1168871960 20:1136984-1137006 GTCTTGTTAGATACTCATGGAGG - Intronic
1169575407 20:6954681-6954703 CTCTGGTTAAAGCGTGATGAAGG - Intergenic
1170173719 20:13443722-13443744 CTCTGTTTTAATATTCATTGTGG - Intronic
1170357520 20:15508323-15508345 TTTTGTTTAAATAGGCATGGAGG + Intronic
1170949012 20:20917938-20917960 TTCTCATTAAAAAGTCATGGAGG + Intergenic
1174545815 20:51324396-51324418 CTCAGCTCAAATAGTGATGGTGG - Intergenic
1183169574 22:36176858-36176880 CTCCTGCTAAATATTCATGGAGG - Intergenic
1184349329 22:43933319-43933341 CTGTGGTTATATAGTCAGGGGGG + Intronic
951624418 3:24644285-24644307 ATCTGGTTAAATAGTTTTGGTGG + Intergenic
954116156 3:48467952-48467974 CTCTGGTGAAACAGTAATAGAGG + Exonic
960071266 3:113433884-113433906 CTCTAGGTAAATTGTCATTGTGG + Intronic
964184776 3:153929845-153929867 CTCTTCTTAAATAGTCAATGGGG + Intergenic
966317780 3:178667958-178667980 CTCTGCTTAAAAACTCATGGGGG - Intronic
967152723 3:186664551-186664573 TTCTGATTAAATTGTCCTGGAGG + Intronic
969186460 4:5478250-5478272 CTCTGGTTTCTGAGTCATGGGGG - Intronic
970718475 4:18957082-18957104 ATCTGGTTACTTAGTCATGCTGG - Intergenic
977767184 4:100812906-100812928 CTCTGGTTAAATAGTCATGGAGG + Intronic
978255948 4:106693093-106693115 CTAAGGTAAAATAGTGATGGTGG - Intergenic
979485582 4:121266389-121266411 CTCTGGAAGAAAAGTCATGGTGG + Intergenic
980892487 4:138830368-138830390 CTCTGGTGAAATAGAAAAGGTGG - Intergenic
984907262 4:184640191-184640213 CTGTGGTTAAATTGAGATGGTGG - Intronic
990245352 5:53858715-53858737 CTCTGCTTACTCAGTCATGGAGG - Intergenic
990909676 5:60841399-60841421 ACCTGGTTAAATATTCATTGTGG + Intronic
993417765 5:87656819-87656841 CTATGGTTTAATAGTCATATAGG - Intergenic
994313876 5:98309503-98309525 CTTTAGTTAAATAGATATGGAGG - Intergenic
996538620 5:124605650-124605672 CTCTGCTTACATAGTAATGCTGG + Intergenic
997752628 5:136362223-136362245 CTATGATTAAATAGTCATTCAGG - Intronic
998453037 5:142249540-142249562 CTCTGGTAAAATGGTCCTTGTGG + Intergenic
1003269421 6:4594020-4594042 ATCTGGTGACATAGTCAAGGTGG - Intergenic
1004475834 6:15970264-15970286 CTCTGGTTAAATAGAGGTAGGGG - Intergenic
1005071945 6:21870055-21870077 CTCTGGCTAAAAAGTCCTGGGGG + Intergenic
1006021206 6:31118631-31118653 CGCAGGTGAAAGAGTCATGGAGG - Intronic
1012022681 6:93945033-93945055 CTCTGATTAAATCATCATTGAGG + Intergenic
1012300808 6:97585622-97585644 TTCTGATTAAATTGTTATGGTGG + Intergenic
1012658739 6:101859042-101859064 TTTTTGTTATATAGTCATGGTGG + Intronic
1013748564 6:113374475-113374497 CTTTGGGACAATAGTCATGGAGG + Intergenic
1016545549 6:145219296-145219318 CTTTGGTGAAATAGTGATGTAGG + Intergenic
1030326549 7:108225558-108225580 ATAAGGTTAAATAGTCATGGAGG + Intronic
1032846801 7:135758244-135758266 CTCAGGAGAAATAGTCAGGGAGG + Intergenic
1045290385 8:100827759-100827781 CTCTGGTTAACTTGTCATCAGGG - Intergenic
1046342072 8:112871866-112871888 TTGTGGTTAAATTGTTATGGAGG - Intronic
1047506159 8:125482350-125482372 ATCCTGTGAAATAGTCATGGAGG - Intergenic
1048610845 8:136021469-136021491 CTCTGGATAATGAGTCATGTGGG - Intergenic
1056912882 9:90719236-90719258 GGCTGATGAAATAGTCATGGTGG - Intergenic
1057565807 9:96164977-96164999 CTGAGGTTAAATAGGCATGGAGG - Intergenic
1058898316 9:109419176-109419198 CTCTGGTTAAATAATCCCTGTGG - Intronic
1186343316 X:8665798-8665820 CTTTGCTAAAATAATCATGGTGG - Intronic
1187986733 X:24821515-24821537 CTCTGGATAAATTCTCAAGGAGG + Exonic
1189851931 X:45186385-45186407 CTCTGGCTGAATGGTCTTGGAGG - Intronic
1190133538 X:47772972-47772994 CTCTGGGTAAATAATCCTTGTGG + Intergenic
1197698890 X:129581571-129581593 CTTTGATTAAATACTGATGGAGG - Intronic
1198686775 X:139235809-139235831 CTAGGGTCACATAGTCATGGTGG - Intergenic
1200817322 Y:7547188-7547210 CTCTGTTTGAATAGTCATGCAGG - Intergenic