ID: 977770640

View in Genome Browser
Species Human (GRCh38)
Location 4:100854108-100854130
Sequence CAAAGCAACCAGTTTAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977770640_977770643 27 Left 977770640 4:100854108-100854130 CCAAATTTAAACTGGTTGCTTTG 0: 1
1: 0
2: 2
3: 21
4: 234
Right 977770643 4:100854158-100854180 GCAGTATGAATATTCAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977770640 Original CRISPR CAAAGCAACCAGTTTAAATT TGG (reversed) Intronic
902185957 1:14725694-14725716 GAAAGCAACCAGGAAAAATTGGG - Intronic
902249564 1:15145274-15145296 CTAAGCAACCATTATTAATTGGG + Intergenic
906009325 1:42509030-42509052 GAAACCAACCAGCCTAAATTAGG + Intronic
908928444 1:69286057-69286079 GTAAGCAACCAGTATACATTAGG + Intergenic
909928253 1:81463898-81463920 CTAAGAAACAAGTTTAAAGTAGG - Intronic
910557862 1:88556372-88556394 GAAAGCAACTAGTATAAATTTGG - Intergenic
911512223 1:98820817-98820839 CAAAGGAACCACATCAAATTAGG + Intergenic
912368244 1:109152295-109152317 CAAGGCATCCAGTCTAAAGTTGG + Intronic
913559156 1:120000602-120000624 CAAAGGAAGAAGTTTTAATTTGG + Intronic
914279750 1:146160045-146160067 CAAAGGAAGAAGTTTTAATTTGG + Intronic
914540788 1:148610963-148610985 CAAAGGAAGAAGTTTTAATTTGG + Intronic
914924138 1:151869309-151869331 CAAAGAACCCAGTTTAAAAATGG - Intergenic
916837376 1:168561002-168561024 CAAAGCCCCTAGTTTACATTAGG - Intergenic
916962662 1:169904926-169904948 CAAAGGCATCAGTTTTAATTTGG - Intergenic
918722525 1:187871551-187871573 TAAAGGAACCATTTCAAATTTGG - Intergenic
918802383 1:188987575-188987597 CAAAGCAACCACTTGAATTTTGG + Intergenic
918994279 1:191736099-191736121 CAAATAAACCAATTAAAATTTGG - Intergenic
918999276 1:191808290-191808312 CTAAGAAACTAGTATAAATTGGG - Intergenic
919109162 1:193195832-193195854 CAAACCAGCCAATTTAAATATGG - Intronic
919677232 1:200395521-200395543 CAAAGCCAAGATTTTAAATTAGG + Intergenic
921059389 1:211570393-211570415 CATGACAACTAGTTTAAATTTGG - Intergenic
921770419 1:219031441-219031463 CAAATAATCCAGTTTAAAATGGG + Intergenic
922858603 1:228796109-228796131 CATAGAAACCAGTTTGCATTAGG - Intergenic
1069100202 10:64310574-64310596 CAAAGCAAATAGTTTATATTTGG + Intergenic
1069336259 10:67354824-67354846 TAAAGCAAACATTTTAAATTTGG + Intronic
1069350305 10:67518065-67518087 CAAAGCAAGCTATTTAAGTTAGG + Intronic
1070181859 10:74021899-74021921 CAAAGCAACCAGTCTGGATTAGG + Intronic
1071716298 10:88099703-88099725 CAAAGTGCCCAGTATAAATTTGG + Intergenic
1071953491 10:90731033-90731055 TAAGGCAACCACTTAAAATTTGG + Intergenic
1072177106 10:92937441-92937463 TAAAGCAAATAGTTTAAATCAGG - Intronic
1072254202 10:93605177-93605199 TAAAACTACCAGTTTAAATATGG - Intergenic
1072432099 10:95381960-95381982 CAAAACAACCAGTTAAAGTTTGG + Intronic
1074076173 10:110127713-110127735 GAGAGCAACCAATTTAGATTTGG - Intronic
1074713641 10:116198644-116198666 AAAGGAAACCAGTTTACATTTGG - Intronic
1075535414 10:123267598-123267620 CAAAGCAACCAGGTCTTATTGGG - Intergenic
1078861252 11:15249298-15249320 AAAAGCAACCAGTATTACTTTGG + Intergenic
1078919493 11:15816370-15816392 CTAAGCAACCAGTTTGCATCAGG + Intergenic
1080129615 11:28778965-28778987 CAAAGCATCCAGTTGATACTGGG + Intergenic
1080510219 11:32962342-32962364 CAAATAACCCAGTTTAAAATGGG - Intronic
1081647140 11:44797975-44797997 CAAAGGAGCCTGTTTAACTTGGG + Intronic
1083079882 11:60080278-60080300 CAAACCAACCATTTTAAAAGAGG + Intergenic
1085148052 11:74221684-74221706 CAAAGAATCCAGTTTAGTTTAGG + Intronic
1085232337 11:74982964-74982986 CAAACCAAGCAGTTTAAGATAGG - Intergenic
1086849751 11:91795596-91795618 CACAGAAAGCACTTTAAATTAGG + Intergenic
1088634381 11:111805777-111805799 CAAAGCCCACAGTTTACATTAGG - Intronic
1092481850 12:8866328-8866350 AAAAGCACCAAGTTTAAATATGG + Intronic
1092771416 12:11900515-11900537 CTAGGCTACCAGTTCAAATTAGG - Intergenic
1094179383 12:27575613-27575635 AAAAGAAACCAGTCTATATTTGG - Intronic
1095372989 12:41491956-41491978 GAAAGAAACAAGTATAAATTAGG - Intronic
1095747896 12:45680346-45680368 CAAAGAAAACATTCTAAATTTGG - Intergenic
1096261494 12:50095105-50095127 CATAGCAACCTGATTAAAATAGG - Intronic
1097716147 12:62968644-62968666 CAAAGAAATCTGTTTAAAGTGGG + Intergenic
1097934629 12:65232128-65232150 TAAAGCAGTCATTTTAAATTGGG - Intronic
1099719277 12:86340890-86340912 AAAATCAACCAGGTTAAACTTGG - Intronic
1100936309 12:99671811-99671833 CAAAAGAAGCATTTTAAATTTGG - Intronic
1101759908 12:107649965-107649987 CAAAGCTCCCAGTTTCAATTAGG - Intronic
1101939282 12:109087909-109087931 CAAAACTACTAGTTTAACTTAGG - Exonic
1102352432 12:112204014-112204036 CAAATAAGCCAGTTTAAAATGGG + Intronic
1103720422 12:122971774-122971796 CAAAGCTGGCAGTTTACATTAGG - Intronic
1105798080 13:23877486-23877508 TAAAGAAACCTGTTTAACTTGGG - Intronic
1107101390 13:36597471-36597493 CAAAACAACTATTTTAAAATAGG - Intergenic
1109095675 13:58112500-58112522 CAAAGCAACAATTTTAAAAACGG + Intergenic
1110167558 13:72461371-72461393 CACAGATACCAGTTTAAACTAGG - Intergenic
1110299849 13:73913665-73913687 CAAAGTAACAAATTTAAACTTGG + Intronic
1112079721 13:95956472-95956494 CAAAGAACCCAATTTAAAATGGG + Intronic
1112106783 13:96249175-96249197 AAAAGCAACTAGTTGAAAATGGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113977502 13:114240063-114240085 CAAACCATACAGTTTAAATGGGG - Intronic
1114052136 14:18929450-18929472 CAAAGCAAACAATATAAAGTGGG - Intergenic
1114110423 14:19472474-19472496 CAAAGCAAACAATATAAAGTGGG + Intergenic
1115132629 14:30072407-30072429 CAAAGCAATCAGTTTCAAAATGG + Intronic
1115841942 14:37482235-37482257 CAAAACACCCAGTTTAAAAATGG + Intronic
1116050097 14:39791676-39791698 CAATGCAACAATTTTAAATAAGG + Intergenic
1116678101 14:47931535-47931557 CAGAGTAAGTAGTTTAAATTGGG - Intergenic
1116776235 14:49184326-49184348 CAAAGCAACCCAATTAAAATTGG + Intergenic
1117322666 14:54638917-54638939 AAAACCAACCTGTTTAATTTAGG - Intronic
1117984880 14:61377442-61377464 GAAAGAAATGAGTTTAAATTTGG - Intronic
1118999644 14:70870787-70870809 TAAGGCAACCAGTTTAAGGTAGG + Intergenic
1120438346 14:84505416-84505438 CATAGCAGCAATTTTAAATTGGG - Intergenic
1124194717 15:27612721-27612743 AATAGCAACCACTTTAAATGTGG + Intergenic
1124529883 15:30496403-30496425 CAAAGCAACCAGCATAAAAATGG + Intergenic
1124768776 15:32511285-32511307 CAAAGCAACCAGCATAAAAATGG - Intergenic
1127142494 15:55992465-55992487 TTAAGCAAGCAGTATAAATTAGG + Intronic
1131858052 15:96620079-96620101 CATAGCAGCCAGTTTCAATGTGG - Intergenic
1133588366 16:7217456-7217478 GAAAGCAACCAGTGAATATTTGG + Intronic
1133793029 16:9024037-9024059 CAAAGCAAAGATTTTAATTTAGG - Intergenic
1134314457 16:13105661-13105683 CTAAGCAGCCAGTTTCATTTTGG + Intronic
1135003541 16:18798950-18798972 GAAACCAACTAGTTTAAAATTGG - Intronic
1135719432 16:24802631-24802653 CTAAGCAACATGTTTATATTTGG + Intronic
1138912142 16:61413677-61413699 CACAGCAACCTGTCTATATTTGG + Intergenic
1144086505 17:11813870-11813892 CAAAGCAAAAATATTAAATTAGG + Intronic
1148571581 17:48674173-48674195 CAAATAACCCAATTTAAATTTGG + Intergenic
1148737706 17:49874224-49874246 CAAAGGAACCAAATTAAATTGGG - Intergenic
1149036253 17:52137481-52137503 CAAAACAAACAATATAAATTTGG + Intronic
1150037523 17:61820051-61820073 CAAACCACCCTGTTTAAATCAGG + Intronic
1151156711 17:72129312-72129334 GAAAACAACCAGGCTAAATTTGG + Intergenic
1153335087 18:3915192-3915214 CAAATCACCCAGTTTAAAAATGG - Intronic
1154067881 18:11126156-11126178 CAAAGCAACCAGTCTCTATGCGG - Intronic
1156136038 18:34039202-34039224 CAATGTAACCACTTAAAATTAGG - Intronic
1156967286 18:43109663-43109685 CAAAACAATAAGTTTATATTAGG - Intronic
1159651317 18:70982428-70982450 CCAAAGAAGCAGTTTAAATTGGG - Intergenic
1163318260 19:16556224-16556246 CAAAAAAACCAGTTTAGGTTGGG + Intronic
1167804714 19:51772978-51773000 CAAAGCCCACAGTTTACATTAGG + Intronic
925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG + Intronic
927975821 2:27337354-27337376 CAAAGGGAACAGTCTAAATTTGG + Intronic
928343118 2:30462849-30462871 CAAAGTAACCAGTCTGAATAGGG + Intronic
928585955 2:32758334-32758356 CCAAGCAAGCAGTATAAACTAGG - Exonic
928951720 2:36819226-36819248 CAAATCACCCACTTTAAATGAGG - Intergenic
929431581 2:41892194-41892216 CAAGGCAGCCAATTTCAATTTGG - Intergenic
930876436 2:56223410-56223432 CACAGCCACCAGGTTGAATTTGG + Intronic
932389590 2:71374274-71374296 CAAATCAACAAGGATAAATTAGG - Intronic
932650174 2:73546975-73546997 CAACGGAACCACTGTAAATTGGG - Intronic
935543035 2:104371812-104371834 GAAAGCAAACAGTTTACATTGGG + Intergenic
935873761 2:107483855-107483877 TAAAGCAACCATTATAAATATGG - Intergenic
936914959 2:117630881-117630903 CTAAGTAATCAGTTTAACTTTGG - Intergenic
937573121 2:123388224-123388246 CTAAGCAAACAGAGTAAATTTGG + Intergenic
938865261 2:135412216-135412238 CAAAACAACTAGATTAAATATGG + Intronic
939439033 2:142219169-142219191 CAAAGCTACCATTATAAATATGG - Intergenic
939536854 2:143442226-143442248 CTAAGCAACCAATTTACAATTGG - Intronic
939799108 2:146684898-146684920 CAAAGCAAACAGATAAAATATGG + Intergenic
940280470 2:151983521-151983543 CATAGAAAACAGTATAAATTTGG + Intronic
941080667 2:161057221-161057243 CAGAGCAACCACTTTAAACAGGG + Intergenic
942785377 2:179695255-179695277 CCACACAACCAGTTTGAATTTGG + Intronic
942886766 2:180934941-180934963 CAAAACAACAAGATGAAATTTGG - Intergenic
943978835 2:194520095-194520117 CAAGGAAGCCAGTTTAAAGTTGG + Intergenic
945181016 2:207091190-207091212 AAAAGCAAACAGTTTGAAATGGG - Intronic
945442702 2:209899290-209899312 CAAAGTCAACAGTTTACATTAGG - Intronic
945778045 2:214131917-214131939 CAAAGCTCACAGTTTACATTAGG - Intronic
946752900 2:222910743-222910765 CACAGCAACAAGTATAAATCAGG - Intronic
1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG + Intronic
1171402368 20:24883111-24883133 AAAAGCAACCACTTTTAAGTGGG + Intergenic
1176922308 21:14703186-14703208 CAAAGGAACCAGTTTCTCTTTGG + Intergenic
1178215310 21:30590665-30590687 CTAATCATCAAGTTTAAATTGGG - Intergenic
1180470608 22:15651823-15651845 CAAAGCAAACAATATAAAGTGGG - Intergenic
1180849125 22:19003978-19004000 CAAGGCAGCCAGGTCAAATTTGG + Intergenic
1181284775 22:21743931-21743953 CAAGGCAAGCAGCTTAATTTTGG - Intergenic
1182215817 22:28716533-28716555 CCAAGCAACCAGTGCAAATATGG + Intronic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1182937052 22:34234108-34234130 CAAAGCATCCGGTTAAAATGTGG + Intergenic
1184167257 22:42737169-42737191 CAAAGCAACCACTTCAAATTTGG - Intergenic
1184979042 22:48083031-48083053 AAAAGCAATCAGTATAAATATGG - Intergenic
951410852 3:22364410-22364432 CAAAGCAACCTGATTAAAAATGG + Intronic
952635442 3:35523532-35523554 CAAAGAAACCAGTTTAAAAAGGG - Intergenic
952699772 3:36314165-36314187 CAAAGCAACAAGTGTAAACATGG + Intergenic
953872697 3:46641207-46641229 CGAAGCAACCATTTTGATTTTGG - Intergenic
954543190 3:51409827-51409849 CAAGGCAACCACATGAAATTTGG + Intronic
955618633 3:60836759-60836781 CAAAGCAATCACTTTGATTTTGG + Intronic
957296018 3:78333481-78333503 CAAAGTACATAGTTTAAATTAGG + Intergenic
957585319 3:82125110-82125132 CAAGGCTACCAAATTAAATTGGG - Intergenic
957670774 3:83299606-83299628 CAAAGTTTACAGTTTAAATTGGG - Intergenic
957705854 3:83782591-83782613 CCTAGCAAAGAGTTTAAATTTGG - Intergenic
957949467 3:87106752-87106774 CAAAGCATTCAGTTTTAAATGGG + Intergenic
958144667 3:89608695-89608717 CAAATGAAACAGTTAAAATTGGG - Intergenic
959225017 3:103569163-103569185 CAAAGTAGCCAGTTTAGAGTAGG - Intergenic
960065163 3:113364099-113364121 AAAGGAAATCAGTTTAAATTTGG + Intronic
960904560 3:122586813-122586835 CAAAGCCCCTAGTTTATATTTGG + Intronic
961596641 3:128022947-128022969 CAAAGCAGCCATTGTAAATATGG - Intergenic
962886140 3:139629658-139629680 CAAAGGAAACTGTTTCAATTTGG + Intronic
963270001 3:143277145-143277167 CAAAGCAACCAGCTTAAGTAGGG + Intronic
963951764 3:151209913-151209935 AAAAGAAACCAATTAAAATTGGG + Intronic
964112553 3:153102891-153102913 AAGAGGAAGCAGTTTAAATTTGG - Intergenic
965242947 3:166227449-166227471 TAAAGCACCCAGTTTACAATGGG - Intergenic
965768567 3:172156730-172156752 TAAAGCAACCAGTATTTATTTGG + Intronic
965832575 3:172810090-172810112 CAAAGCTACCAGCTTATCTTAGG - Intronic
968217236 3:196903492-196903514 ACAAGCAACCAGATTATATTAGG - Intronic
968863371 4:3190763-3190785 GAAAGCAGCCAGTCCAAATTAGG + Intronic
969058551 4:4416873-4416895 CAAAACAACCAATTCAAATGAGG - Intronic
969958753 4:10920608-10920630 CAAAGCTCACAGTTTACATTAGG - Intergenic
970136950 4:12935793-12935815 AAAAGCAACCCATTTTAATTAGG + Intergenic
970145024 4:13026944-13026966 CAAAGCATTGGGTTTAAATTTGG - Intergenic
970814647 4:20139762-20139784 CATGGCATCCAGTTTAGATTTGG + Intergenic
970834038 4:20379139-20379161 CAAAGCCCACAGTTTACATTAGG - Intronic
971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG + Intronic
971617955 4:28817867-28817889 CAAATAATCCAGTTTAAAATTGG + Intergenic
975228245 4:71900020-71900042 CAAAGCAATAAGATAAAATTTGG - Intergenic
975573290 4:75839252-75839274 CAAAGCACCCAGTTGGTATTTGG + Intergenic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
977981363 4:103326727-103326749 CAAAGCAAAGAGATAAAATTAGG - Intergenic
979013512 4:115401087-115401109 CAAAGCAACCACTTCAATTTTGG + Intergenic
980884813 4:138751134-138751156 CTAACAAACCAGTATAAATTTGG - Intergenic
980977829 4:139628059-139628081 CAAGGCAAACAGTTTAAAATGGG - Intergenic
981702288 4:147619845-147619867 CAGAGTAACCAGTTAAAACTTGG + Intronic
981922745 4:150103587-150103609 CAAAGAAACAAATTTAATTTTGG - Intronic
982384253 4:154782211-154782233 CAAAGAAACATTTTTAAATTAGG - Intronic
983603104 4:169552059-169552081 CAAAGACAATAGTTTAAATTTGG + Intronic
984149692 4:176111371-176111393 CAAGGCAACTAATTTAAATGAGG - Intronic
987353907 5:17045586-17045608 CAAAGGACTCAGTTTAAATGTGG + Intergenic
987495657 5:18641058-18641080 AAAAGCCACCGGTTTCAATTAGG + Intergenic
988716303 5:33831946-33831968 CAAAACAAACAGTTACAATTAGG + Intronic
989347351 5:40444686-40444708 CAAATTAACCAATTTAAAATGGG + Intergenic
989720285 5:44519930-44519952 CAAAGCAAGTAGTTGGAATTTGG + Intergenic
992649621 5:78845709-78845731 CAAATAATCCAGTTTAAAATGGG - Intronic
993185822 5:84617930-84617952 CAAAACATCCATTTTAAGTTTGG + Intergenic
995280445 5:110330052-110330074 CCAAGCAACCTTTTTAAATAAGG - Intronic
996546984 5:124690355-124690377 CAAAGCTCCTAGTTTATATTAGG - Intronic
999068086 5:148713616-148713638 CAAAGCAGCAACTTTAAATAGGG - Intergenic
999152631 5:149436511-149436533 CAAAGGAGCTATTTTAAATTGGG + Intergenic
999798699 5:155012324-155012346 CAAAGCCAATAGTTTACATTAGG + Intergenic
999802671 5:155052389-155052411 CAAAGAAACAAATTAAAATTTGG - Intergenic
1000459356 5:161495024-161495046 AACAGCAACCACTTTAAATAAGG - Intronic
1000586554 5:163106467-163106489 CAAAACACTCATTTTAAATTGGG - Intergenic
1001458804 5:171890024-171890046 CAAAGAACCCATTTTAAAATGGG + Intronic
1003712658 6:8610081-8610103 CAAAGCACACAGTTTACATTAGG + Intergenic
1005023448 6:21439801-21439823 CAAATAAACCAGTTGAAATCGGG + Intergenic
1005899273 6:30203776-30203798 GAAAGGAACCATTTCAAATTAGG - Intronic
1006235168 6:32624365-32624387 CAAAGAAATCAGATGAAATTTGG + Intergenic
1013140483 6:107328959-107328981 CATAGCAAGCAGTTAAAAATTGG - Intronic
1014117095 6:117677837-117677859 CAATGCAACCAGTTTTGCTTGGG + Intronic
1014331455 6:120070547-120070569 CAAAGAAACAAGTATAAATTTGG - Intergenic
1014608355 6:123507695-123507717 CAAATCACCCAGTTTTATTTAGG + Intronic
1014869530 6:126575403-126575425 CAAACCAACCATTGTACATTGGG - Intergenic
1015243067 6:131047684-131047706 CAAAGCAACCTGTTTGTATATGG - Intronic
1015540329 6:134307146-134307168 CAAAGCAAACACATTAAATCAGG - Intronic
1016004584 6:139076393-139076415 CTAGGCTACCAGTTCAAATTTGG + Intergenic
1017705205 6:157115931-157115953 AAAATCAAGCAGTGTAAATTAGG + Intronic
1018240219 6:161767053-161767075 CAAAATAACCAGGTTAAGTTGGG + Intronic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1021258918 7:18429700-18429722 CAAAGCATAAAGTTTAAACTTGG + Intronic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1022942322 7:35253082-35253104 ATAAGAAACCAGTTTAATTTTGG - Intronic
1024844736 7:53629409-53629431 CAAATCAACCAATTTAAAAATGG + Intergenic
1027519723 7:79190451-79190473 CAAATAAACCAGTTTAAAAATGG - Intronic
1027527311 7:79286409-79286431 CAAAGCCAGCAGTTTAACTCAGG + Intronic
1027936233 7:84606829-84606851 CAATGCAATCAGTATAAATTTGG - Intergenic
1030732934 7:113011256-113011278 CAGAGCAACTACTTTAGATTAGG - Intergenic
1031033956 7:116766851-116766873 CAAAGCCACCAGTTTAATTTTGG + Intronic
1031338171 7:120563850-120563872 CAAAGCCACCAGATTGAATTAGG + Intronic
1031447208 7:121869902-121869924 CAGAGCAACTAGTTAAACTTGGG + Intergenic
1032693672 7:134315038-134315060 CAAAGCAACCAGTTTACTTAAGG - Intronic
1033779616 7:144653047-144653069 TAAAGCAACCATTTAAAATTAGG + Intronic
1036385120 8:8272283-8272305 CAAAGCAAACAGTCTCATTTTGG + Intergenic
1039148158 8:34473182-34473204 CAAAGCCAACCGTTTAAATTGGG - Intergenic
1040467783 8:47711154-47711176 CACAGGAACCAGCTTAAATATGG - Intronic
1040928162 8:52707313-52707335 AAAAGCACCGAATTTAAATTTGG - Intronic
1043711747 8:83427963-83427985 CAAATAAACTATTTTAAATTTGG - Intergenic
1043953074 8:86331010-86331032 CAATGCATCCAATTTAAAATTGG - Intergenic
1045066583 8:98452652-98452674 CCCAGCAACCAGGTTAAAATAGG + Intronic
1046366814 8:113243933-113243955 CAAATAAATCAGTTTAAATATGG - Intronic
1047022660 8:120792558-120792580 GCAAGCAACTAGTTTATATTTGG - Intronic
1049286419 8:141777882-141777904 CAAATGAACCAGTTTCAATGTGG - Intergenic
1049517604 8:143069693-143069715 CAGAGCAACCACTTCAAATGTGG - Intergenic
1050362809 9:4846856-4846878 AAAAACATGCAGTTTAAATTAGG + Intronic
1051124264 9:13786316-13786338 CAAAGCAGCCAGTCTCACTTCGG - Intergenic
1057295102 9:93830186-93830208 GAAAGCAAACATTTTATATTTGG + Intergenic
1059862410 9:118479633-118479655 CCAAACAGCCAGTTTACATTGGG - Intergenic
1061265383 9:129501816-129501838 CAAAGCAGCCAGCTTCAATCTGG + Intergenic
1186011506 X:5139172-5139194 CACAGCAAACAATTTAAAATAGG + Intergenic
1188292204 X:28403051-28403073 CAAAACAGCAAGTTTTAATTTGG - Intergenic
1189033272 X:37470989-37471011 CCAAGAAACCAGTCTAACTTGGG + Intronic
1191725214 X:64272028-64272050 CAAAGACAGCAGTTTAAACTAGG + Intronic
1191750131 X:64533580-64533602 CAAAGTAGCCTGTTTAAAATTGG + Intergenic
1192962884 X:76148720-76148742 CAAAACAACAAGATTAATTTGGG + Intergenic
1193383500 X:80844144-80844166 CAAAGAAAACAGTTTCATTTTGG + Intergenic
1195758605 X:108223438-108223460 CACAGCAAACAGTACAAATTTGG + Intronic
1196292688 X:113961653-113961675 AAGAGCAACCATTGTAAATTAGG + Intergenic
1196854467 X:119969982-119970004 CACAGCACCCAGATAAAATTAGG - Intergenic
1200849864 Y:7872046-7872068 CCCAGCAACAAGTTTAGATTGGG - Intergenic
1201518330 Y:14842794-14842816 CCAAGTAACCAATTTAAAATGGG - Exonic