ID: 977771710

View in Genome Browser
Species Human (GRCh38)
Location 4:100868526-100868548
Sequence CCTGCTATGCTGCAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 4, 2: 13, 3: 40, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977771710_977771716 20 Left 977771710 4:100868526-100868548 CCTTCCAGCTGCAGCATAGCAGG 0: 1
1: 4
2: 13
3: 40
4: 296
Right 977771716 4:100868569-100868591 TGGCAGTAAGCAAGGCTCTGTGG 0: 1
1: 21
2: 256
3: 519
4: 1129
977771710_977771715 12 Left 977771710 4:100868526-100868548 CCTTCCAGCTGCAGCATAGCAGG 0: 1
1: 4
2: 13
3: 40
4: 296
Right 977771715 4:100868561-100868583 TGCTGCACTGGCAGTAAGCAAGG 0: 4
1: 14
2: 162
3: 344
4: 660
977771710_977771717 21 Left 977771710 4:100868526-100868548 CCTTCCAGCTGCAGCATAGCAGG 0: 1
1: 4
2: 13
3: 40
4: 296
Right 977771717 4:100868570-100868592 GGCAGTAAGCAAGGCTCTGTGGG No data
977771710_977771718 26 Left 977771710 4:100868526-100868548 CCTTCCAGCTGCAGCATAGCAGG 0: 1
1: 4
2: 13
3: 40
4: 296
Right 977771718 4:100868575-100868597 TAAGCAAGGCTCTGTGGGTGTGG 0: 7
1: 62
2: 232
3: 488
4: 867
977771710_977771719 27 Left 977771710 4:100868526-100868548 CCTTCCAGCTGCAGCATAGCAGG 0: 1
1: 4
2: 13
3: 40
4: 296
Right 977771719 4:100868576-100868598 AAGCAAGGCTCTGTGGGTGTGGG 0: 7
1: 78
2: 307
3: 768
4: 1455
977771710_977771714 0 Left 977771710 4:100868526-100868548 CCTTCCAGCTGCAGCATAGCAGG 0: 1
1: 4
2: 13
3: 40
4: 296
Right 977771714 4:100868549-100868571 TGGATCTCAGATTGCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977771710 Original CRISPR CCTGCTATGCTGCAGCTGGA AGG (reversed) Intronic
900629873 1:3628708-3628730 GCTGCCCTGCTGCTGCTGGAAGG + Exonic
901754831 1:11435147-11435169 CCTGCCAGGCTGCAGCGGGCAGG - Intergenic
902060178 1:13635262-13635284 TGGGCTCTGCTGCAGCTGGAGGG - Intergenic
903754611 1:25652180-25652202 CCTGACATGCGGCAGCAGGAAGG - Intronic
904039819 1:27577332-27577354 CCTGCCGTGCGGCAGCTAGAGGG + Intronic
907933700 1:59022996-59023018 CCTCTTATGCTGCAGCAGAAGGG - Intergenic
909455788 1:75847030-75847052 CATGTTATGATGCAGCAGGAAGG - Intronic
909707818 1:78608088-78608110 CCTGCTACGCTGCAGCTTGATGG + Intergenic
910915117 1:92279876-92279898 CCTGCGAGGCTGCAGCTAGACGG + Intronic
912738712 1:112173934-112173956 CCTGCTGTGGCACAGCTGGAGGG - Intergenic
915046660 1:153023170-153023192 ACTGCTATGTTGTACCTGGATGG + Intergenic
915625507 1:157111830-157111852 CCTGGAATGCTGCATCCGGAGGG + Intergenic
916012011 1:160714675-160714697 CCTGCTGAGCTGCAGGTGGCAGG - Intergenic
920631575 1:207658473-207658495 CCTGCACTCCTGCAGCTGGCAGG + Intronic
920879671 1:209867941-209867963 CCTGCTGGGCTGCAGGTGGGTGG + Intergenic
922414217 1:225405601-225405623 CCTGGGATGCTGCAGCAGAAGGG + Intronic
922786755 1:228286714-228286736 CCTGTCGTGCTGCCGCTGGAGGG - Intronic
923548133 1:234939772-234939794 CCTGCTTTCCGGCAGCTAGAAGG - Intergenic
923808705 1:237288737-237288759 CCTTTTATTTTGCAGCTGGAAGG - Intronic
1062860795 10:807657-807679 CCTGCCCTGGTGGAGCTGGAGGG - Exonic
1062905405 10:1176225-1176247 GCTCCAATGCTGCAGCCGGAGGG - Intergenic
1063529837 10:6820554-6820576 CCTGCAATTCTGCAGATGGGTGG - Intergenic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064492879 10:15878263-15878285 CCTGCAACGCTGCAGCTTGGTGG - Intergenic
1064897475 10:20254349-20254371 CTTGCTTTGCAGCTGCTGGATGG + Intronic
1067053963 10:43040689-43040711 CCTGCTATGCTGTGGGGGGAGGG + Intergenic
1067335455 10:45359145-45359167 CCTGCGAGGCTGCAGCTGGGTGG + Intergenic
1069917828 10:71798194-71798216 CCTCCTGTGCTGCAGCCTGAGGG + Intronic
1070045917 10:72836291-72836313 CATGTTATACTACAGCTGGAAGG + Intronic
1070338793 10:75477944-75477966 TCTCCTGTGCTGCAGCTGAAAGG - Intronic
1071941325 10:90594735-90594757 CCTGCTCTCCTGAAGCTGGGGGG - Intergenic
1071964415 10:90837531-90837553 CATGCTATGATGCAGCAAGAAGG + Intronic
1072736166 10:97881107-97881129 TCTGCAATTCAGCAGCTGGAGGG + Intronic
1076384774 10:130048232-130048254 CCTGCTGTCCTGCAGCTGTAGGG - Intergenic
1076648397 10:131970268-131970290 CCAGCTCTGCTGTAGGTGGAGGG - Intronic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1077575343 11:3378899-3378921 GCCGCCATGGTGCAGCTGGAGGG + Intronic
1078001138 11:7496938-7496960 CCAGCTACACTGTAGCTGGAAGG + Intronic
1078560415 11:12366357-12366379 CCTGCGATGCTGCAGATTGGCGG + Intergenic
1078994044 11:16678872-16678894 CCTGCGATGCTGCAGATTGGTGG + Intronic
1079799780 11:24854469-24854491 CCTGGTATGCTCAAGCTTGATGG - Intronic
1080590312 11:33717720-33717742 CCTCCTAACCTGCAACTGGAAGG + Intronic
1083855376 11:65390585-65390607 CCTGCTCAGCTGCTGCTGGGAGG + Intronic
1083951550 11:65959345-65959367 TCTGCCATGCTGCTGCGGGAAGG + Intronic
1084411366 11:69008063-69008085 CCTGCTGTGCTCCAGCTGGTGGG + Intronic
1084421103 11:69061036-69061058 CCTGCCGTGCTGCTGCTGGCTGG + Intronic
1087003455 11:93444794-93444816 CCTGTGATGCTGCAGCTTGGTGG - Intergenic
1087172540 11:95065192-95065214 CTTGATATTCTGCAGGTGGATGG + Intergenic
1089032363 11:115345514-115345536 ATTGCTATTATGCAGCTGGAGGG - Intronic
1091450661 12:570335-570357 CCTGCTCTGCGGCAGAGGGATGG + Intronic
1092139360 12:6172078-6172100 CTTGCTTTCCTGCAGATGGATGG + Intergenic
1092304367 12:7283843-7283865 CCTGGGATGCTCCAGCTTGATGG + Intergenic
1093469129 12:19482293-19482315 CCTGCTCTGCTGGAGGTGGCAGG + Intronic
1093900422 12:24625342-24625364 CCTGCTAGGCTGCAGCCTGGCGG - Intergenic
1095830955 12:46586056-46586078 CCTGCCTTGCTGCAGCTGGATGG - Intergenic
1096030539 12:48410159-48410181 CCTGCGACACTGCAGCTTGATGG - Intergenic
1100153551 12:91770734-91770756 CATGCCATGTTGCAGGTGGATGG + Intergenic
1100900802 12:99238319-99238341 CATGCAATGCTGCAGCTTGACGG + Intronic
1102606716 12:114073434-114073456 CCTGCCATCCTACAGCTGAATGG - Intergenic
1102892222 12:116568770-116568792 CATGTTATGATGCAGCAGGAAGG + Intergenic
1103996874 12:124835856-124835878 CCTGCTTTGCTCCAGCGGGCTGG - Intronic
1105355767 13:19658073-19658095 CCTGGGATGCTGCACCAGGATGG + Intronic
1105742730 13:23345369-23345391 ACTGCTAGGCTGGAGGTGGAGGG - Intronic
1106026470 13:25960248-25960270 CATCCTCTGCTCCAGCTGGACGG - Intronic
1107473465 13:40712718-40712740 CCTGGTATGCTCCAGCTTGGTGG - Intergenic
1108164622 13:47679112-47679134 CCTGAGATGCTCCAGTTGGAGGG - Intergenic
1108546545 13:51501024-51501046 CCTCCTAAGTTGCAGGTGGAGGG + Intergenic
1108797031 13:54044235-54044257 CCTGCGACACTGCAGCTTGACGG + Intergenic
1109075094 13:57824067-57824089 CCAGCCATGCTGCAGGTGGCAGG + Intergenic
1109290806 13:60473135-60473157 CATGTTATGATGCAGCAGGAAGG - Intronic
1109456923 13:62605219-62605241 CCTACTGTGCTGAAGCAGGAAGG + Intergenic
1110575610 13:77051874-77051896 GCTGCGATGCTGAGGCTGGACGG - Exonic
1111509455 13:89242049-89242071 CCTGCTATGGGGCAGGTGAAAGG + Intergenic
1112032907 13:95473746-95473768 CCTGCTATGCTGCTGGTTCAGGG + Intronic
1112087048 13:96042128-96042150 CCTGCTCTGCTGGAGGTGGCAGG - Intronic
1112458748 13:99584582-99584604 CCTGCAATACTGCAGCTGGTGGG - Intergenic
1113397959 13:109966114-109966136 CATCCTAGGCTGCAACTGGATGG - Intergenic
1113640238 13:111952159-111952181 CCAGCTGAGCTGCAGCAGGACGG + Intergenic
1113891472 13:113737824-113737846 CCTGCTCAGGTGCACCTGGATGG - Intergenic
1114342578 14:21760462-21760484 CCTGCGATGCTGCGGCTTGATGG + Intergenic
1114694266 14:24612107-24612129 CCTGCTCTGGTGGAGGTGGAAGG + Intergenic
1115906831 14:38210397-38210419 CATCCTATGCCTCAGCTGGATGG + Exonic
1115996867 14:39203922-39203944 CCTTTTATGTTGCAGCTGGGAGG + Intergenic
1117442178 14:55770343-55770365 CATGCTGTGCTGGAGCTGAAAGG + Intergenic
1118241290 14:64060977-64060999 CCTGCCATGCTGCTGCTGCTGGG + Intronic
1118745001 14:68767286-68767308 TCTGCTAATCTCCAGCTGGATGG - Intergenic
1119406336 14:74401938-74401960 CCTGGAACGCTGCAGCAGGAAGG - Intergenic
1119547196 14:75480458-75480480 CCTGCTCTGCTTCAGGTGGGTGG + Intergenic
1121207571 14:92182314-92182336 GCTGCTTTGCTTCAGCTGAATGG + Intergenic
1121961200 14:98261880-98261902 CATGCTATGATGCAGCAAGAAGG - Intergenic
1122476815 14:102015932-102015954 CATGATGTGCTCCAGCTGGAAGG - Exonic
1123033734 14:105463335-105463357 CGTGCACTGCTGCAGCAGGAGGG + Intronic
1127570619 15:60237565-60237587 CCTGTGATGCTGCAGCTGGATGG + Intergenic
1128291589 15:66482443-66482465 CCAGGTATGCTGCAGTTAGAAGG - Intronic
1128538321 15:68507228-68507250 CATGTTATGATGCAGCAGGAAGG - Intergenic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129720459 15:77875210-77875232 CTTGCTTTGCTGCTGCTGGGTGG - Intergenic
1130344631 15:83031621-83031643 CCTGCTGTGGGGCAGCGGGAGGG + Intronic
1131103256 15:89711120-89711142 CCTGATATGATGCAGTAGGAAGG + Intronic
1131175952 15:90209977-90209999 GCTGCTATGCTGCAGCCAGAGGG - Intronic
1131371408 15:91885133-91885155 CCTGCTCTGCGTCACCTGGAAGG + Intronic
1131419258 15:92290537-92290559 CCTGCACTGCAGCAGCTTGAGGG - Intergenic
1132711028 16:1267614-1267636 CTGCCTATGCTGCAGCTGTATGG + Intergenic
1132783642 16:1642330-1642352 CCTGCTGTGCTGGGACTGGAGGG - Intronic
1133143591 16:3766953-3766975 CATGTTACTCTGCAGCTGGAAGG - Intronic
1133774548 16:8886597-8886619 CCTGTAAGGCTGCAGCTGTACGG - Intergenic
1134571991 16:15298983-15299005 CCTGCTAACCTCCAGGTGGAAGG - Intergenic
1134730390 16:16457060-16457082 CCTGCTAACCTCCAGGTGGAAGG + Intergenic
1134937041 16:18254836-18254858 CCTGCTAACCTCCAGGTGGAAGG - Intergenic
1136088601 16:27902915-27902937 GGTGCCATGCTGCAGCTGGGAGG + Intronic
1136458371 16:30395221-30395243 CCTCCTGGGCTGCAGCTGGGTGG - Exonic
1137461508 16:48668363-48668385 CCTGCTAGGCTGCAGCCTGTCGG - Intergenic
1138224458 16:55280876-55280898 CAGGGTGTGCTGCAGCTGGACGG + Intergenic
1138430952 16:56969005-56969027 CCTGGTGTGCTGAAGATGGAGGG - Intronic
1138615106 16:58158906-58158928 CTTGCTATGCTGGACCTGGAAGG - Intronic
1139453418 16:67050882-67050904 ACTGCCATACTGCAGCAGGATGG + Intronic
1142410749 16:89915417-89915439 CGTGCCAAGATGCAGCTGGAGGG - Intronic
1143342939 17:6227276-6227298 CCTGATATGATGCAACAGGAAGG + Intergenic
1144366017 17:14545590-14545612 CCTGCAGTGCTGCAGCTCGTAGG + Intergenic
1144891419 17:18496432-18496454 CCTGAGACGCTGCTGCTGGAAGG + Intergenic
1145140802 17:20447885-20447907 CCTGAGACGCTGCTGCTGGAAGG - Intergenic
1146885095 17:36465098-36465120 CCTGCCCTCCCGCAGCTGGAAGG - Intergenic
1147867572 17:43563341-43563363 CCTGTTATAATGCAGCAGGATGG + Intronic
1148194767 17:45705458-45705480 CCTGTGTTGCTGCAGGTGGAGGG - Intergenic
1148689658 17:49520010-49520032 CCAGCTCTGCGGCAGCTGGTGGG + Intergenic
1149192971 17:54086040-54086062 CCTGAAATGCTGCAGCTGGATGG + Intergenic
1149197568 17:54139627-54139649 CCTGATATGATGCAACAGGAAGG + Intergenic
1151277854 17:73049405-73049427 CCTGCCCTGCTGCTCCTGGAAGG - Intronic
1151800599 17:76377149-76377171 TCTGCCAGGCTGCAGATGGATGG + Intronic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1153582534 18:6589039-6589061 CCTGGTATGCTGGAGTTGGCTGG - Intronic
1153625200 18:7016610-7016632 CCTGCCACGCTGCAGTTGCAGGG + Exonic
1156482920 18:37447504-37447526 CTTCCTCTCCTGCAGCTGGAGGG + Intronic
1156910623 18:42407737-42407759 CCTGCAATGATGCAGCAAGAAGG - Intergenic
1157451384 18:47791727-47791749 GCTGCTCTGCAACAGCTGGAGGG + Intergenic
1157569225 18:48701253-48701275 CCTGGTCTGCAGCAGCTTGAAGG + Intronic
1159314487 18:66753856-66753878 CCTGCTAAGCTGGGCCTGGATGG + Intergenic
1161560929 19:4972049-4972071 CCTGCCATGAGGCAGCTCGATGG + Intronic
1161591736 19:5132050-5132072 CGCGCTCTGCTGCTGCTGGAGGG + Intronic
1162099610 19:8331914-8331936 CCTCCTACTTTGCAGCTGGAGGG - Intronic
1163115326 19:15185486-15185508 TCTGCTATGATGCACCTGGCGGG - Exonic
1163177319 19:15573475-15573497 CCTGCTATGCTGGGCCTGGAGGG + Intergenic
1164541935 19:29128010-29128032 CTTGCTCTTCCGCAGCTGGAAGG - Intergenic
1165008326 19:32824323-32824345 CCAGCCCTGCTGCAGCTGGTCGG + Intronic
1165636348 19:37343504-37343526 GCTGCTCAGCTACAGCTGGATGG + Intronic
1165686913 19:37829753-37829775 CCTGCTCCGTTGCAGCTGGCTGG - Intergenic
1166744003 19:45131284-45131306 GCTGCTGTGCAGCAGCTGGCGGG - Intronic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
925018785 2:552570-552592 CCTGCTCTTCTGCACATGGATGG + Intergenic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
926109087 2:10170701-10170723 CCTGCTTTCTTGCTGCTGGAAGG + Intronic
926362144 2:12099787-12099809 CCTGCTATGCTGCAGCAGTGAGG - Intergenic
926408400 2:12577083-12577105 CCTGCTGGACTGCAGCTTGAGGG - Intergenic
927393261 2:22620295-22620317 CCTGTAATGCTGCAGCGGGCTGG + Intergenic
930479281 2:51926451-51926473 CTTGCCATGTTGAAGCTGGAGGG - Intergenic
931306562 2:61034728-61034750 CCAGCAACGCTGCAGCTTGATGG + Intronic
931721673 2:65071673-65071695 GCAGAGATGCTGCAGCTGGAAGG - Exonic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932868706 2:75374624-75374646 CCTGTGATACTGCAGCTGGATGG - Intergenic
933241502 2:79926238-79926260 CATGCTATTCTTCACCTGGAAGG - Intronic
933983952 2:87575295-87575317 CCTGCTTTGCTGGGGCTGGGGGG + Intergenic
934855577 2:97727383-97727405 CCTGCCCTGCTGCATCTGGAGGG + Intronic
936309903 2:111375501-111375523 CCTGCTTTGCTGGGGCTGGGGGG - Intergenic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
936775339 2:115965742-115965764 CCTGCAAGGCTGCAGCCGGGCGG - Intergenic
936857756 2:116980629-116980651 CCTGCTCTGGTGAAGCTGGCAGG - Intergenic
938247882 2:129792945-129792967 CCTGTTATGATGCAGCCTGAAGG + Intergenic
938692758 2:133807539-133807561 TCTGCTGTGCTGCAGCTGGAAGG - Intergenic
939096040 2:137834566-137834588 CTTCCCATGCTGCACCTGGACGG + Intergenic
939497088 2:142937081-142937103 ACTGCTATGTTGTACCTGGATGG + Intronic
940487643 2:154316649-154316671 CATGCTATGATGCAGCAAGAAGG - Intronic
940501631 2:154501259-154501281 CCTGCTTTTATGCAGCCGGAGGG + Intergenic
947440589 2:230117840-230117862 CCTGCGATGCTGCAGCTTGATGG - Intergenic
948858576 2:240742091-240742113 CTGGCTCTGCAGCAGCTGGAGGG + Intronic
948884128 2:240874528-240874550 GTTGCCAGGCTGCAGCTGGATGG - Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169583197 20:7048709-7048731 CCTGCTATGATACAGCAAGAAGG - Intergenic
1169861694 20:10159457-10159479 CCTGCAATGCTGCAGCTTGATGG + Intergenic
1170566378 20:17610172-17610194 CCAGCTGGACTGCAGCTGGAAGG + Intergenic
1170627194 20:18038848-18038870 CCAGCTTTGCTGCTGCTGGATGG + Intronic
1171183473 20:23108311-23108333 CATCCCATGCTCCAGCTGGAGGG + Intergenic
1171493349 20:25537696-25537718 CCTGGGCTGCTGCAGGTGGAGGG + Intronic
1171502351 20:25603605-25603627 CAAGCTAAGCTGCAGCTGGAGGG + Intergenic
1171982650 20:31638484-31638506 CCTGCTCTGCTGGATCTGGTTGG - Intronic
1172060672 20:32185182-32185204 CCAGATATGTTCCAGCTGGATGG + Intergenic
1173304307 20:41833598-41833620 TCTGCTATGCTGCATCGGCATGG - Intergenic
1173363936 20:42368405-42368427 CCTGGGATGCTAAAGCTGGAGGG - Intronic
1173945077 20:46944090-46944112 CCTGCTCTGCTCCCCCTGGATGG + Intronic
1174200232 20:48801966-48801988 CATGCCATGATGCAGCAGGAAGG + Intronic
1174519406 20:51118227-51118249 CCAACTTGGCTGCAGCTGGAAGG + Intergenic
1175256677 20:57652167-57652189 ACTGCTCTGCTGGTGCTGGAAGG + Exonic
1175641045 20:60630712-60630734 CCTGCAAGGTTGCAGCTGGAAGG + Intergenic
1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG + Intronic
1179601390 21:42479986-42480008 CCTGCTTTGCTCCAGCTAAAAGG - Intronic
1180010774 21:45049857-45049879 CAGGCTCTGCTGCAGCTGGGTGG + Intergenic
1180039917 21:45270655-45270677 CCTGCTCTGCTGGAGGTGGCGGG - Intronic
1181790571 22:25262603-25262625 CGTTCTCTGCTGCACCTGGAAGG + Intergenic
1181826380 22:25519637-25519659 CATTCTCTGCTGCACCTGGAAGG + Intergenic
1181968222 22:26671365-26671387 CCTCTGAAGCTGCAGCTGGAGGG + Intergenic
1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG + Intergenic
1182817518 22:33178978-33179000 CCTGTTATGATGCAGCAAGAAGG - Intronic
1183022473 22:35038460-35038482 CCTGCTGTTCTGGAACTGGAAGG - Intergenic
1183463466 22:37967109-37967131 CCTGTGATGGTGGAGCTGGAGGG + Exonic
1183827599 22:40400731-40400753 CCTGCTATCTTAGAGCTGGAAGG - Exonic
1184106227 22:42368897-42368919 CCGGAGATGCTGCAGCTCGAGGG + Intergenic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185078517 22:48696282-48696304 CCTGCTATGCTACATCTGGCCGG - Intronic
1185117883 22:48948418-48948440 CCTGCTATTCTGCTGAGGGATGG + Intergenic
953715241 3:45311914-45311936 TCTGCTTTTCTGCAGCTGCAGGG - Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
954306097 3:49726258-49726280 GCAGCTGTGCTGCTGCTGGATGG - Exonic
957245335 3:77709341-77709363 CATGAGATGATGCAGCTGGAAGG - Intergenic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
958637662 3:96765241-96765263 CCTTCTTTGATCCAGCTGGAGGG - Intergenic
958842026 3:99217684-99217706 CCTACTATGCTCCAGCTACAAGG + Intergenic
959295293 3:104527835-104527857 CTTGCTATGCTCCAGCTTAAAGG - Intergenic
961577450 3:127849424-127849446 CCTTCTATGCTCCAGATGAAAGG + Intergenic
964696749 3:159516566-159516588 CCTTCCATTCTGCAGCTAGATGG + Intronic
966871566 3:184293277-184293299 CCAGCTGTTCTACAGCTGGAAGG + Intronic
968059273 3:195714640-195714662 ACTCCTATGCTGCAGCTGAATGG + Intergenic
968193493 3:196688370-196688392 CCTGCTGGGCTTCAGCTTGATGG - Intronic
968933628 4:3597643-3597665 CTTTCTATCCTGCAGCCGGAAGG + Intergenic
969233495 4:5848753-5848775 CATGCTATGATGCAGCAAGAAGG - Intronic
969322638 4:6422018-6422040 CCTGAGACGCTGCAGCCGGATGG + Intronic
969330714 4:6472311-6472333 CCTGCTAGGCTGCGGCGGCATGG - Intronic
972425283 4:38927105-38927127 CTTGCTACACTGCAGCTGGAAGG + Intronic
972679378 4:41290670-41290692 CCTGCCATTCTGCAGCAGGGAGG - Intergenic
972962744 4:44474001-44474023 CCTGGGATGCTGCAGCTTGGTGG + Intergenic
973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG + Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974566911 4:63589999-63590021 CCTGCGATGCTGCAGCTTGATGG + Intergenic
975291194 4:72679732-72679754 CCTGCAATGCTGCAGCTTGATGG + Intergenic
976407825 4:84679532-84679554 CCTGCTGTGCTGCAGCTAGATGG + Intronic
976777585 4:88722965-88722987 CGTGTTATGCTGCAGCTGCCCGG - Intergenic
977326472 4:95580521-95580543 CCTGTGATGCTACAGCTTGAAGG - Intergenic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
978173762 4:105705339-105705361 CTTGCTTTCCTGCAGCTAGACGG - Intronic
978464541 4:108994376-108994398 CCTGCGAGGCTGCAGCTTGATGG + Intronic
978485118 4:109244576-109244598 TCTGCTATGCTGCACATGAAAGG + Intronic
980092706 4:128458965-128458987 CCGTCTGTGCTGTAGCTGGAGGG + Intergenic
980480873 4:133385490-133385512 CTTGCAAGGCTGCAGCTGGAGGG - Intergenic
981716037 4:147753189-147753211 ACTGCTGTGTTGGAGCTGGAAGG + Intronic
981953395 4:150439653-150439675 TCTGCTTTGCTGCAGTTGGAAGG + Intronic
982713706 4:158784560-158784582 CCTGTTTTTCTGCAACTGGAAGG + Intronic
984372425 4:178884319-178884341 CCTGCAACACTGCAGCTTGATGG + Intergenic
984680353 4:182601107-182601129 CCAGCTGTCCTGCAGCTGGACGG - Exonic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
985731444 5:1551524-1551546 CCTGCCGTGCTGGAGCTGGCTGG + Intergenic
986242774 5:5976349-5976371 CCTGCTGTGCAGCACCGGGAGGG + Intergenic
986656368 5:10016767-10016789 CCTGCAATGCTGCTGCTTGGCGG - Intergenic
987772349 5:22321795-22321817 CTTGCTATTCTGGAGTTGGAGGG - Intronic
989358066 5:40567109-40567131 CCTGGGATGCTGCAGCTAGTTGG - Intergenic
990207959 5:53450616-53450638 ACTGCTATGCTGGAGGTGGAGGG - Intergenic
992105339 5:73445670-73445692 GCTACTATGTTGCAGATGGAAGG - Intronic
993233790 5:85276081-85276103 CATGCTATGTTGCAGCAAGAAGG + Intergenic
993591497 5:89800823-89800845 CCTGTGATGCTGCAGCTTGATGG + Intergenic
993620621 5:90163564-90163586 CCAGACATGCTGCAGATGGAGGG + Intergenic
994407988 5:99369908-99369930 GCTGCTTTACTGCAGCTGAAAGG + Intergenic
994883618 5:105529513-105529535 CCTGTTATTTTGCAGCTGGGTGG - Intergenic
995324181 5:110872648-110872670 CCTGCTTTGCTGCATCTCCAAGG - Intergenic
995463889 5:112430980-112431002 CTTGTTTTCCTGCAGCTGGATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995788170 5:115854046-115854068 CATGTTATGATGCAGCAGGAAGG - Intronic
999321107 5:150615520-150615542 CCTGCAATGCCACAGTTGGACGG + Intronic
999801986 5:155046836-155046858 CCTGCTCTCCTGCACCTGGCAGG + Intergenic
1001347792 5:170922540-170922562 ACTGCGATGCTGCAGCTTGACGG - Intronic
1002288953 5:178186716-178186738 GCTTGTATGCTGCAGCTGGATGG - Intergenic
1003228201 6:4225360-4225382 CCCACGATGCTGCAGCTGGACGG + Intergenic
1003971013 6:11299259-11299281 CCTGCAACGCTGCAGCTTGAGGG + Intronic
1004243045 6:13945126-13945148 CCTGTTATGTTGGAGCTGGAAGG + Intronic
1005935975 6:30521199-30521221 CCTGGCATGCTGCAGCTTGTTGG + Intergenic
1007408224 6:41646914-41646936 CCTGCAATGAGGCAGCAGGATGG + Intronic
1007878985 6:45140657-45140679 CCTGCTGTGCTGGAGGTGGCAGG - Intronic
1008370459 6:50724734-50724756 CCGTCTGTGCTGCAACTGGATGG - Intronic
1009603394 6:65833727-65833749 CCAGGTAAGCTGAAGCTGGAGGG - Intergenic
1010820670 6:80411687-80411709 CCTGCGAGGCTGCAGCCTGATGG - Intergenic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1012597996 6:101062399-101062421 CCTGCGATGCTGCACCTTGACGG + Intergenic
1013436645 6:110116454-110116476 CCTGTGACGCTGCAGCTTGACGG + Intronic
1015296490 6:131599243-131599265 CTTGCTAAGCTGCAGTTGGCTGG - Intronic
1016973264 6:149785210-149785232 CCTGATATGATGCAACAGGAAGG - Intronic
1018206166 6:161439161-161439183 CCTGCGATGCCGCAGCTGAAAGG + Intronic
1018455961 6:163952341-163952363 CTTTCTGTGCTGCTGCTGGAAGG - Intergenic
1020148289 7:5662102-5662124 CCTGCACAGCTGCAGCTGCACGG - Intronic
1020429879 7:8107904-8107926 CCTGCCATGATGCAGTGGGACGG - Intergenic
1020746884 7:12090355-12090377 CCTGCTATGCAGCTGCCGGAAGG + Intergenic
1020834035 7:13126569-13126591 CCTGCAACACTGCAGCTTGACGG - Intergenic
1022894814 7:34739791-34739813 CCTGCTCTGGTGCAGGTGGCAGG + Intronic
1023051752 7:36258673-36258695 CCTGGGATGCTGGAGCTGGTGGG - Intronic
1023644329 7:42293523-42293545 CCTCCTGTGCTGCATCTAGATGG + Intergenic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1028413012 7:90551253-90551275 CCTGTGATACTGCAGCTTGACGG - Intronic
1028764729 7:94540584-94540606 CCTGTGATGCTGCAGCTGACGGG + Intronic
1029974859 7:104823401-104823423 CATACAATGCTGTAGCTGGAAGG - Intronic
1030771483 7:113480810-113480832 GCTGGTTTGCTCCAGCTGGAAGG - Intergenic
1031754310 7:125618594-125618616 ACTGATATCCTGCCGCTGGAGGG + Intergenic
1032391215 7:131556523-131556545 CCGGCTCTGCTGCAGCGGCAGGG - Exonic
1033740682 7:144273582-144273604 CCTTCTATGCCCCAGCTGGTGGG - Intergenic
1033753225 7:144376031-144376053 CCTTCTATGCCCCAGCTGGTGGG + Intronic
1034172121 7:149070837-149070859 CCCGCTGTGCAGCAGCTGGTGGG + Exonic
1034875384 7:154720593-154720615 CCTGCCATGCTGCAGCCGGGGGG - Intronic
1035763513 8:2086777-2086799 CCTGGAATGTTGCAGCAGGAAGG - Intronic
1037813096 8:22098170-22098192 CCTGCCAGGCCCCAGCTGGACGG + Exonic
1038170082 8:25123411-25123433 CCTTCTATCCTGTAGCTGCAGGG + Intergenic
1041316229 8:56565206-56565228 CATGGTATGATGCAGCTAGAAGG + Intergenic
1041349878 8:56937687-56937709 CCTGCGACACTGCAGCTTGATGG + Intergenic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1041951695 8:63510480-63510502 CCTGCAAAGCTGCAGCTTGACGG - Intergenic
1042847941 8:73186929-73186951 CCTGCAGTGATTCAGCTGGAAGG - Intergenic
1046237529 8:111446398-111446420 CATGCTATGATGCAGCAAGAAGG - Intergenic
1046249520 8:111611842-111611864 CCTGCTTTGCTGCAGCAGCCAGG - Intergenic
1047766119 8:127991520-127991542 CATGCCCTGCTGCACCTGGAGGG + Intergenic
1048570506 8:135650930-135650952 CCTGCTGTGTTGCAGATGGTAGG + Intronic
1048880636 8:138869741-138869763 CCTGGTGACCTGCAGCTGGAGGG + Intronic
1048959751 8:139566526-139566548 GATGCTATGCTGCAGTTTGAGGG + Intergenic
1049413797 8:142485895-142485917 CATGCTGTGCTGCAGCAGGAGGG - Intronic
1049635773 8:143688367-143688389 CCTGCTGTGCTGGAGGTGGGAGG + Intronic
1049690962 8:143958693-143958715 CCTGCTCTGCTGCAGCAGGGTGG + Intronic
1050407688 9:5327315-5327337 CCGGCTACGCAGCAGCTTGATGG + Intergenic
1051425572 9:16928293-16928315 CCTGCAAGGCTGCAGCAGGATGG - Intergenic
1052680051 9:31679625-31679647 CCTGCTGTGATGCATCAGGAAGG + Intergenic
1053751715 9:41263726-41263748 CCTGCTCAGCTGCAGCATGAAGG + Intergenic
1054257242 9:62828055-62828077 CCTGCTCAGCTGCAGCATGAAGG + Intergenic
1054456517 9:65434174-65434196 CTTTCTATCCTGCAGCCGGAAGG - Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056094659 9:83240624-83240646 CATGCTATGATGCAGCAAGAAGG + Intergenic
1056348462 9:85723416-85723438 CCTGCAATGCTGCAGCTTGGTGG - Intronic
1056632767 9:88307324-88307346 CCTGCTATAATGCATCAGGAAGG - Intergenic
1057255089 9:93539833-93539855 CCTGCAAAGGGGCAGCTGGAGGG - Intronic
1060345033 9:122808502-122808524 CATGCTAGGATGCAGCTAGAAGG - Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1061974692 9:134062243-134062265 CCTGCTCTCCTGCAGCTGCCTGG + Intronic
1061996716 9:134189898-134189920 CCTGCTTTGCACCAGATGGAAGG - Intergenic
1185508253 X:644394-644416 CAGGCTCAGCTGCAGCTGGAAGG + Exonic
1186201397 X:7158573-7158595 CCTGCTACTCTCCAGGTGGAGGG + Intergenic
1191711384 X:64152992-64153014 CCTGCAATGCTGCAGCTTGATGG + Intergenic
1192629026 X:72760721-72760743 CCTGCTATGCTGCAGCTTGACGG - Intergenic
1192652684 X:72960093-72960115 CCTGCTATGCTGCAGCTTGACGG + Intergenic
1192735214 X:73844198-73844220 CCTGGTATACTGCAAATGGAGGG + Intergenic
1194910798 X:99642019-99642041 CCTGCTCTGCAGGAGCTGGCTGG - Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic
1198770266 X:140123404-140123426 CCTGCTATGGTGGAGGTGGCAGG + Intergenic
1199408959 X:147496895-147496917 CCTGTTATGCTGTAGCAAGAAGG + Intergenic
1200085713 X:153603626-153603648 CCTGCTTTGCTCCAGCGAGAGGG - Intergenic
1200086790 X:153611058-153611080 CCTGCTCTGCCCCATCTGGAGGG + Intergenic
1200143976 X:153916437-153916459 CCTGCTAGGCTTTGGCTGGAGGG + Intronic
1200974498 Y:9194173-9194195 CTTACTATCCTGCAGCTAGACGG - Intergenic
1201320418 Y:12692633-12692655 CCTGGTAAGCTGCAGCAAGAAGG - Intergenic
1201797003 Y:17906649-17906671 CCTGCTTTGCAACAGCTGGCAGG + Intergenic
1201804550 Y:17999336-17999358 CCTGCTTTGCAACAGCTGGCAGG - Intergenic
1202047280 Y:20747705-20747727 CATGATATGGTGCAGCAGGATGG + Intergenic
1202054837 Y:20818874-20818896 CCTGCGATGCTGCAGCCTTACGG + Intergenic
1202136355 Y:21669293-21669315 CTTACTATCCTGCAGCTAGATGG + Intergenic