ID: 977772101

View in Genome Browser
Species Human (GRCh38)
Location 4:100871504-100871526
Sequence TTCTGCCAGTAGAAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977772101_977772104 4 Left 977772101 4:100871504-100871526 CCCTCAGACTTCTACTGGCAGAA 0: 1
1: 0
2: 1
3: 13
4: 176
Right 977772104 4:100871531-100871553 GCAATAGCCAGCTGGATCCCAGG 0: 1
1: 1
2: 0
3: 9
4: 138
977772101_977772103 -4 Left 977772101 4:100871504-100871526 CCCTCAGACTTCTACTGGCAGAA 0: 1
1: 0
2: 1
3: 13
4: 176
Right 977772103 4:100871523-100871545 AGAAAGCTGCAATAGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977772101 Original CRISPR TTCTGCCAGTAGAAGTCTGA GGG (reversed) Intronic
900670774 1:3853009-3853031 TTCTGCAGGCAGAAGTCAGATGG - Intronic
901109175 1:6781883-6781905 ATCTGACAGTAGAAGACTGCTGG + Intergenic
901974183 1:12931199-12931221 TTCTGCAAGTGAAAGTCTTAGGG + Intronic
902010992 1:13270569-13270591 TTCTGCAAGTGAAAGTCTTAGGG - Intergenic
904055932 1:27669968-27669990 TTCTGACAGCAGAAGTGTGGGGG + Intronic
906934116 1:50196765-50196787 TTCCACCATTAGAAGTCTGCTGG - Intronic
908166009 1:61459612-61459634 TTCTGACAGTCAAAGTGTGAAGG + Intronic
908353275 1:63307215-63307237 TTCTGCTGGTAGAAGTTTCAAGG - Intergenic
915484391 1:156210268-156210290 TTCTGCCATCAGCTGTCTGAAGG - Exonic
915529410 1:156494684-156494706 TTCCGCCAGAAAAAGTGTGATGG - Intronic
915766148 1:158364701-158364723 TTCTGCCAGCAGATAACTGAGGG + Intergenic
918420914 1:184363532-184363554 TTCTGCAAGGGGAAGTCTGCAGG + Intergenic
918608934 1:186464264-186464286 TTCTGCTATTTGAAGACTGAGGG - Intergenic
921343533 1:214158291-214158313 CTCAGCCAGCAGAAGACTGAAGG + Intergenic
924822421 1:247506135-247506157 TGCAGAGAGTAGAAGTCTGAGGG + Intergenic
1064324729 10:14339545-14339567 TTCTGTAAGGAGAATTCTGAAGG + Intronic
1064943390 10:20759992-20760014 GTTGGCCAGTTGAAGTCTGAAGG + Intergenic
1067514105 10:46921957-46921979 TTCTGGGGGCAGAAGTCTGAGGG - Intronic
1067648148 10:48129875-48129897 TTCTGGGGGCAGAAGTCTGAGGG + Intergenic
1069169335 10:65205436-65205458 TTCTGCCAGGTGAGGGCTGAGGG - Intergenic
1072646126 10:97255981-97256003 GTCTGCCAGTAGAATTTTGGGGG - Intronic
1075478722 10:122760316-122760338 AGATGCCAGTAGAAATCTGAAGG + Intergenic
1077046837 11:550411-550433 CTCTGTCACTGGAAGTCTGACGG + Intronic
1077649803 11:3960085-3960107 TGCTGCATGTAGAAGTTTGATGG + Intronic
1078079950 11:8196847-8196869 TAAAGCCAGGAGAAGTCTGAAGG - Intergenic
1081648029 11:44803486-44803508 TTCTGTCATTAGGAGTCTGAAGG + Intronic
1085188298 11:74595140-74595162 TTCATCCATGAGAAGTCTGAGGG - Intronic
1088642749 11:111889216-111889238 GTCTGCCATCAGAAGACTGAAGG - Intergenic
1089851361 11:121499504-121499526 ATCTGCCTGTAGAAGGCTCAGGG - Intronic
1090156739 11:124446218-124446240 TTGTGCCACCAGAAGTCTGAGGG - Intergenic
1090336122 11:125966952-125966974 TTCTTACAGTACAAGACTGAAGG - Intronic
1093864278 12:24206330-24206352 CCCTGCCATTAGCAGTCTGAAGG - Intergenic
1094812150 12:34148910-34148932 TGCAGAGAGTAGAAGTCTGAGGG - Intergenic
1095152330 12:38810089-38810111 TCCTGCCAGAAGAAGTTGGAGGG + Intronic
1095608148 12:44095437-44095459 TTCTGCAAATAGAAATTTGATGG + Intronic
1096473419 12:51893605-51893627 TTCTCCCAGAAGAGCTCTGAAGG + Intergenic
1098762424 12:74441745-74441767 TTCTGCCATTGGAAGTCTTGGGG - Intergenic
1098946111 12:76591634-76591656 TTCTGCCAGTAAAATTTTGGAGG - Intergenic
1100278098 12:93090714-93090736 TTCTGCAGGTAGAATTCTGTGGG + Intergenic
1100676933 12:96878447-96878469 TCCTGCCTGCAGAATTCTGAAGG - Intergenic
1103140864 12:118547053-118547075 GTCTGTTAGTAGAAGACTGATGG + Intergenic
1103600303 12:122050543-122050565 TTCTGCAGGTAGAAGGCAGAGGG + Intronic
1105445909 13:20456935-20456957 TTGTGACAGTAGGAGTCTGGTGG + Intronic
1105633667 13:22196951-22196973 TTCTACCAGTAGATGGCTCAGGG + Intergenic
1107100075 13:36580808-36580830 TTTGGCCTGTAGAAGTTTGAAGG - Intergenic
1109093402 13:58078045-58078067 TTCTCCCAGTGTAACTCTGAAGG - Intergenic
1111800490 13:92974792-92974814 TTATGCCAGCAGGGGTCTGAAGG - Intergenic
1111823826 13:93244245-93244267 TTCTGCCAGCAGAAGTCTGTGGG - Intronic
1112002527 13:95224427-95224449 TTCTTATAGTAGAAGTCTGCTGG - Intronic
1112204385 13:97309585-97309607 TTCTGCCCCTAGAACTGTGAGGG + Intronic
1112809239 13:103198451-103198473 TTCTCCCAGGAGAATTCTAATGG - Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1118536141 14:66767226-66767248 TCTTCCCATTAGAAGTCTGAGGG - Intronic
1119052360 14:71382512-71382534 TTTAGCCAGTAGCAGTCCGAAGG + Intronic
1124206878 15:27728447-27728469 TCCTGCCAGTAGAATTTTGGGGG + Intergenic
1125171096 15:36767647-36767669 TAATGCAAGTGGAAGTCTGAAGG - Intronic
1127520386 15:59737870-59737892 TTCTGCCAGCAGCACACTGAGGG - Intergenic
1128743501 15:70098654-70098676 GCCTGCGAGGAGAAGTCTGAGGG + Intergenic
1129174964 15:73833212-73833234 TTCACCCAGCAGATGTCTGAAGG - Intergenic
1129454650 15:75670230-75670252 TTCTGGCAGTAGATGTTTGCTGG + Intergenic
1137483424 16:48871498-48871520 TTTTTCCAGTAGAAGTCAAATGG - Intergenic
1138116638 16:54366174-54366196 TTCTCCAAGTGCAAGTCTGAAGG + Intergenic
1141297697 16:82785080-82785102 CTCTGCCTGATGAAGTCTGAAGG + Intronic
1145357878 17:22179742-22179764 TTATGTCAGTATAAGTCTGGTGG + Intergenic
1146140782 17:30366205-30366227 TTATGCCAGTACAAGGCTGCAGG - Intergenic
1147447022 17:40480699-40480721 TCCTGCCAGAAGAAATCTGCGGG - Exonic
1149027761 17:52049702-52049724 TGTTGGCAGGAGAAGTCTGAGGG - Intronic
1149352670 17:55807313-55807335 TTCTGCCAGTAGAAATCTATGGG - Intronic
1150298719 17:64030548-64030570 TTCTCACACAAGAAGTCTGAAGG + Intergenic
1151116083 17:71736750-71736772 TTCTGTGATTAGAATTCTGAAGG + Intergenic
1151310531 17:73290015-73290037 TGGTGGCAGTAGAAGCCTGAAGG - Intronic
1151579302 17:74969097-74969119 TTCTCCCATTAGAAGCCTAAGGG - Intronic
1151737501 17:75953607-75953629 TTCTTCCAGGTGAAGCCTGATGG - Exonic
1152191237 17:78889223-78889245 TTCTGCCAATTGCAGTCTTAGGG - Intronic
1152976130 18:220511-220533 TGCTGCTGGTAGGAGTCTGATGG - Intronic
1152976274 18:222647-222669 TTCTGCCATTAGATGTTTGCTGG - Intronic
1157900371 18:51509119-51509141 TTCTGTCAGTTGAAGACTGTTGG - Intergenic
1158432878 18:57406265-57406287 TTCTGCCTGAAGAACTCTCAAGG + Intergenic
1159307693 18:66666525-66666547 ATTTGCCTGTAGAAATCTGAGGG - Intergenic
1159748101 18:72264412-72264434 TTCTGTCAGCAGAAGTGTTATGG + Intergenic
1160035285 18:75295782-75295804 ATCTGCAAGCAGAAATCTGATGG + Intergenic
1161041078 19:2111085-2111107 TCCTGCCAGTCCAAGTCTCAGGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
927597595 2:24410240-24410262 TTCTGACAGAAGAAGTCTCCTGG - Intergenic
927812843 2:26189734-26189756 TTCTGGCAGGAGAGGACTGATGG + Intergenic
929441699 2:41970295-41970317 CTGGGCCAGTAGAAGACTGAGGG + Intergenic
934307077 2:91835463-91835485 TTATGCCAGTAGAAGTATATTGG - Intergenic
934326179 2:92017249-92017271 TTATGCCAGTAGAAGTATATTGG + Intergenic
935316272 2:101837397-101837419 TCCTGCCAGCAGAAGACAGAGGG - Intronic
935731991 2:106072075-106072097 TATTGCCAGTAAATGTCTGAAGG + Intronic
936000155 2:108819516-108819538 TTCTGCTGGAAGAGGTCTGAGGG + Intronic
938412594 2:131077329-131077351 TTCAGCCAGGAGAAGTATGTGGG + Intronic
938878136 2:135555445-135555467 TACTGCCAGTAGGAGTGTAAAGG + Intronic
938955213 2:136290961-136290983 TCCTGCCAGTAGAATTCTGGGGG + Intergenic
940294731 2:152110679-152110701 TACAACCAGTAAAAGTCTGAAGG + Intergenic
942534653 2:176950351-176950373 TTCTGCTAGTAGAACTATGCTGG + Intergenic
943730612 2:191299524-191299546 TTCTGCAATTTGAGGTCTGAAGG - Intronic
1169153985 20:3313730-3313752 TCTTGCCAGTAGAATTTTGAGGG - Intronic
1169319329 20:4618387-4618409 TTCTGACACTAGATGTGTGAGGG + Intergenic
1170906048 20:20515990-20516012 TGCTGCTAGTAGAACACTGAGGG + Intronic
1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG + Intronic
1172905875 20:38368926-38368948 GTCTGCCAGGAGAGGCCTGAGGG - Intronic
1177337431 21:19749446-19749468 TTGTCCCACTAGAAGTCTGCAGG - Intergenic
1178413767 21:32387255-32387277 TTCTGGCAGGAGAATTCTGTGGG - Intronic
1180732780 22:17994409-17994431 TGTTGCCAGTTGAAGTCTGGAGG - Intronic
1182234695 22:28866091-28866113 TTCTGGCTGAAGAAGTCAGAAGG - Intergenic
1182890195 22:33811789-33811811 TTCTGGCAGTATAAGAATGATGG + Intronic
949616038 3:5754736-5754758 TTCTGCAAGAAGCAGTCTGGTGG - Intergenic
949651886 3:6169156-6169178 TTCTGACAGCAGCTGTCTGAAGG + Intergenic
949845382 3:8364992-8365014 TTCATGCAGTAGAAGTCTGAAGG + Intergenic
951288473 3:20845485-20845507 CTCTGCCAGTGGTAGTCTGTAGG + Intergenic
951600988 3:24375647-24375669 TTCTATCAGTAGTAGTCTGGGGG - Intronic
952256874 3:31703283-31703305 TTCTTTCAATAGAATTCTGAGGG - Intronic
955383414 3:58459609-58459631 TTCTGCCAGTGGAAATGTAATGG - Intergenic
955446995 3:59022995-59023017 TACTGCCAGTAGAGGTGTGGTGG + Intronic
956286753 3:67618487-67618509 ATCTCACAGAAGAAGTCTGAAGG + Intronic
958254858 3:91313918-91313940 TTCTTCCAGTTGAAGTCAGAGGG - Intergenic
960291576 3:115891797-115891819 TACTACCAGGAGAAGTGTGATGG - Intronic
962426664 3:135274809-135274831 CTCTGCCAGAAGTTGTCTGATGG + Intergenic
962626790 3:137233604-137233626 TCCTTCCAGTAGAAGTTTGAGGG - Intergenic
964388455 3:156174001-156174023 TTGTTCCAGTACGAGTCTGAAGG - Intronic
967918820 3:194599297-194599319 TTCTGCCAGTGGGATTTTGAAGG - Intronic
969963207 4:10967813-10967835 TTTTGCCAGAAGAAATCTAAAGG - Intergenic
970877665 4:20891232-20891254 TTAAGCCTGTAGAAGTCTGGTGG + Intronic
971025454 4:22584851-22584873 TTCTTCTTGTAGACGTCTGAAGG + Intergenic
971930135 4:33070949-33070971 TTCTGCCAGTAGAATTTTGGGGG - Intergenic
974490460 4:62557709-62557731 TGCTGCCAGTGGAACACTGAGGG - Intergenic
974882663 4:67778739-67778761 TTCTGCCAGAAGAAACCTGCTGG + Intergenic
975354962 4:73391433-73391455 TTCTACATTTAGAAGTCTGAGGG - Intergenic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
978807816 4:112818854-112818876 TGCTGGCAGTAGAAGAATGATGG + Intronic
979024648 4:115553579-115553601 TTCTGCCAACAGAAGCCAGAGGG + Intergenic
987000976 5:13659309-13659331 TACTGGCAGAAGAACTCTGAAGG - Intergenic
987624275 5:20377172-20377194 GTCTGCCAATAGAATTTTGATGG + Intronic
987674248 5:21053513-21053535 TTCTCCAAGCAGAAGCCTGAGGG - Intergenic
988887900 5:35579399-35579421 TTCAAACAGTAGAAATCTGAAGG - Intergenic
991261173 5:64670032-64670054 TACTTCCAGTTCAAGTCTGAAGG + Intergenic
991456163 5:66806929-66806951 ATCTGGCAGTGGAACTCTGAGGG + Intronic
996081421 5:119262083-119262105 TTCTGGCCATAGAAGTTTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999924879 5:156364169-156364191 TTATGACAGCAGAAGTCTGGGGG + Intronic
1000720282 5:164697519-164697541 TTCTGTCAGTGGTAGTTTGATGG - Intergenic
1001434104 5:171686029-171686051 TGCTGTAAGTAGAAGTCTGGAGG - Intergenic
1009000504 6:57707159-57707181 TTCTTCCAGTTGAAGTCAGAGGG + Intergenic
1009188969 6:60606586-60606608 TTCTTCCAGTTGAAGTCAGAGGG + Intergenic
1009397978 6:63223780-63223802 TTCTTTCAGTAGAATGCTGAAGG + Intergenic
1010209217 6:73349668-73349690 TTTTGGAAGTAAAAGTCTGAAGG - Intergenic
1010868579 6:81010491-81010513 CTCAGCCAGTGGAAGTCTGGTGG - Intergenic
1011394458 6:86891657-86891679 TGCTGCCAGTGGAACACTGAAGG + Intergenic
1013572552 6:111444114-111444136 ATCTGCCAGTAGATGTTTGAAGG - Intronic
1013952433 6:115799831-115799853 TTCTGGCAGAACAAGTCTGTTGG - Intergenic
1014871843 6:126605624-126605646 TAGTCCCAGTCGAAGTCTGAAGG - Intergenic
1015281954 6:131443446-131443468 TTCTTCCAGCAGGGGTCTGAAGG - Intergenic
1015619363 6:135114239-135114261 TTTTGCCCTTACAAGTCTGAAGG - Intergenic
1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG + Exonic
1018209355 6:161465401-161465423 TTCATGCAGTACAAGTCTGATGG + Intronic
1018486825 6:164249147-164249169 TTCTGACAGTAGGAGCCTGCAGG + Intergenic
1020808961 7:12827866-12827888 TTCTGCAAGTGGAAGGCTGAGGG + Intergenic
1022284362 7:28941019-28941041 TTATGCCTTTAGAAATCTGAAGG - Intergenic
1024762130 7:52611393-52611415 TTCAGCCAGCAGAAATCTGCTGG - Intergenic
1025962618 7:66236944-66236966 CTCTGCCAGTAGATCTCTGTGGG + Intronic
1029435789 7:100563370-100563392 TTCAGCCAGCATGAGTCTGAGGG - Intronic
1031718367 7:125136421-125136443 TTCTGACATTAGAAATCTCAGGG + Intergenic
1032232938 7:130091865-130091887 TTATTTCATTAGAAGTCTGAAGG + Intronic
1032374860 7:131403069-131403091 TTCTTCCAATAGAAGTCTATTGG + Intronic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1033968039 7:147002417-147002439 TTGTGCCTATAGAATTCTGAAGG + Intronic
1035019035 7:155789398-155789420 TTCTGCCAGGAGCAGACTCAGGG - Intergenic
1035333062 7:158108666-158108688 TTCTAGAAGTAGAAATCTGAAGG - Intronic
1036614795 8:10379786-10379808 TTCTGCCAGTGGCAGTCTGCAGG + Intronic
1037456023 8:19065181-19065203 TTCTGCCTATAAAACTCTGAGGG + Intronic
1039427898 8:37501898-37501920 TTGTGCCTTTAGAAGTTTGATGG - Intergenic
1040591095 8:48792774-48792796 TTCTGGCAGAGGAAGCCTGAGGG + Intergenic
1044410759 8:91880235-91880257 TTCTGCCTGTGAAATTCTGAAGG + Intergenic
1045182033 8:99794631-99794653 TTCTGCTGGTAGAATTTTGAAGG + Intronic
1047546065 8:125818354-125818376 TCCAGCCAGTAGAATTTTGAAGG - Intergenic
1049938592 9:523246-523268 TTTTACCACTAGAAGTCTGTGGG - Intronic
1051026749 9:12622226-12622248 CTCTCCCTGTAGAAGTCTGCTGG - Intergenic
1055409570 9:76014672-76014694 TCCTGGCAGAAGAAGTCAGAAGG - Intronic
1056481280 9:87008881-87008903 TTCTGCCAGGAAAAGCCTGCTGG + Intergenic
1058628096 9:106956617-106956639 TTCTTCCAATAAAAGTCTGTGGG + Intronic
1059268194 9:113055796-113055818 TTCTGTGACTAGAAGTCTAAGGG - Intronic
1059357431 9:113710733-113710755 TACTGCCAGAACAAGTTTGAGGG + Intergenic
1062032238 9:134366909-134366931 TTCTCCCAGCAGGAGCCTGAGGG - Intronic
1189245427 X:39559985-39560007 TGCTGCCAGAGGAAGCCTGAAGG - Intergenic
1189685942 X:43563630-43563652 TTCCCTCAGAAGAAGTCTGATGG - Intergenic
1190725420 X:53187287-53187309 TCCTGCCAGTAGAATTTTGGGGG - Intergenic
1195934816 X:110114782-110114804 TTCTCCTAGTAGAAGACAGATGG - Intronic
1196394929 X:115249412-115249434 TTCTTACAGTATAAGTCTGTTGG - Intergenic
1199744978 X:150766816-150766838 TTCTGCAAACAGAAGGCTGAGGG + Exonic
1201720891 Y:17095716-17095738 GTGTTCCAGTAGAAGTCAGAAGG + Intergenic