ID: 977777225

View in Genome Browser
Species Human (GRCh38)
Location 4:100935430-100935452
Sequence CTGAGAGTATGTAAGGCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977777221_977777225 8 Left 977777221 4:100935399-100935421 CCAATAGATTTAGTCACCTTTAC No data
Right 977777225 4:100935430-100935452 CTGAGAGTATGTAAGGCCCTAGG No data
977777222_977777225 -8 Left 977777222 4:100935415-100935437 CCTTTACCTAAGTCTCTGAGAGT No data
Right 977777225 4:100935430-100935452 CTGAGAGTATGTAAGGCCCTAGG No data
977777220_977777225 15 Left 977777220 4:100935392-100935414 CCAAACACCAATAGATTTAGTCA No data
Right 977777225 4:100935430-100935452 CTGAGAGTATGTAAGGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977777225 Original CRISPR CTGAGAGTATGTAAGGCCCT AGG Intergenic
No off target data available for this crispr