ID: 977779862

View in Genome Browser
Species Human (GRCh38)
Location 4:100968545-100968567
Sequence CTCATCAGTGCTACTTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977779862_977779866 15 Left 977779862 4:100968545-100968567 CCCTGTCAAGTAGCACTGATGAG No data
Right 977779866 4:100968583-100968605 AATATTTCAACAAATATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977779862 Original CRISPR CTCATCAGTGCTACTTGACA GGG (reversed) Intergenic
No off target data available for this crispr