ID: 977786246

View in Genome Browser
Species Human (GRCh38)
Location 4:101038092-101038114
Sequence CATAACATGGGGCATGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977786240_977786246 20 Left 977786240 4:101038049-101038071 CCACAACCTTGCAAGCTTCCTGT 0: 1
1: 0
2: 4
3: 14
4: 247
Right 977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 117
977786241_977786246 14 Left 977786241 4:101038055-101038077 CCTTGCAAGCTTCCTGTGTCGAT 0: 1
1: 0
2: 2
3: 6
4: 97
Right 977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 117
977786242_977786246 2 Left 977786242 4:101038067-101038089 CCTGTGTCGATGATTGTCAAATG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977786246 Original CRISPR CATAACATGGGGCATGAACC TGG Intronic
900085894 1:896625-896647 CATGAAATGGGGCATGTTCCTGG - Intergenic
900650888 1:3729641-3729663 CATAGCAAGGGCCATGACCCAGG - Intronic
901564865 1:10105686-10105708 CAGAACATGGGGCTTGTTCCTGG - Exonic
908321288 1:62981553-62981575 CATGACATCGGGAATGAACTTGG - Intergenic
908695416 1:66835100-66835122 TATAACATGGGACATGTAACAGG - Intronic
914767905 1:150655464-150655486 CATGAAATGGGGCATGTCCCTGG + Intronic
915786691 1:158621013-158621035 CATAAAATGAGGCCTGAACAAGG - Intronic
921826935 1:219682780-219682802 CTTAAGTTGGGGCATGAACTTGG - Intergenic
922952869 1:229573839-229573861 CAAAACATTGAGCATGCACCTGG - Intergenic
1063491924 10:6471939-6471961 GATAATATGGGCCATGAGCCTGG + Intronic
1065517845 10:26542932-26542954 CATAGCTTGGGGCATGGAGCAGG + Intronic
1065764641 10:29016500-29016522 CATAACGTGCGACATGTACCAGG + Intergenic
1071577807 10:86742374-86742396 CCTAACATAGAGCATGAACCAGG - Intergenic
1074980137 10:118612966-118612988 CATAAAATGGGGTATGTCCCTGG - Intergenic
1075246322 10:120825217-120825239 CATGACAACAGGCATGAACCTGG - Intergenic
1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG + Intronic
1075897403 10:126008979-126009001 CACAGCAGGGGGCATGAGCCTGG - Intronic
1078667525 11:13339053-13339075 TGTCACATGGGGCATGTACCTGG + Intronic
1080279913 11:30545107-30545129 CAGACTATGGGGCTTGAACCTGG + Intronic
1088492179 11:110398964-110398986 CATGAAATGGGGCATGTCCCTGG + Intergenic
1089318150 11:117606036-117606058 AATAACAGGGGGCATGGAGCAGG + Intronic
1089833777 11:121352112-121352134 CAGTACATAGAGCATGAACCTGG - Intergenic
1089879596 11:121760932-121760954 CAGAGCATGGGGCAGGAACAAGG + Intergenic
1090377347 11:126300491-126300513 CACCACGTGGGGCATGAGCCAGG + Intronic
1091249092 11:134126750-134126772 CATGGCAAGGGGCATGAATCTGG + Intronic
1095912845 12:47446658-47446680 CATGAAATGGGGCATGTCCCTGG - Intergenic
1102970025 12:117159129-117159151 AATAACATGGTGCATAAAACTGG - Intronic
1104835079 12:131784653-131784675 CACAACATGGTGCAAGAAACAGG - Intronic
1106139864 13:27003137-27003159 CTTGACATGGGGCATTATCCAGG + Intergenic
1106304795 13:28500080-28500102 CGTAGCATGGTGCATGATCCAGG + Intergenic
1111110698 13:83705054-83705076 AAAAACAGGGGCCATGAACCTGG - Intergenic
1114409656 14:22488844-22488866 GATAACATGGGACTTGAACGTGG + Intergenic
1122647595 14:103205768-103205790 CGTGACAGTGGGCATGAACCTGG - Intergenic
1124626520 15:31310564-31310586 CCTAACATGGGGTATGACCAGGG + Intergenic
1133044444 16:3079516-3079538 CATGAAATGGGGCATGTCCCTGG - Intronic
1134092488 16:11399063-11399085 CAGAGCTTGGGGCAGGAACCAGG - Intronic
1140970717 16:80009857-80009879 CTTAACCTGAGACATGAACCAGG + Intergenic
1141034119 16:80613055-80613077 TAGGACATGGGGCATGAACTGGG - Intronic
1142231673 16:88903003-88903025 CACAGCCTGGGGCATGAAACAGG + Intronic
1152160450 17:78665220-78665242 AATCACACAGGGCATGAACCGGG + Intergenic
1153710302 18:7792501-7792523 AATAACAAGGGGTATGAGCCCGG - Intronic
1156138886 18:34080521-34080543 CATAAAAAGCGGCATGCACCAGG + Intronic
1160211068 18:76880283-76880305 CATCACAGTGGGCATCAACCAGG + Exonic
1162252106 19:9454401-9454423 CCAAACATGGGGCTCGAACCCGG + Intergenic
1164451822 19:28372667-28372689 AATAACCTGGGGCTTGTACCTGG + Intergenic
925062343 2:902840-902862 CATAACATGGGGGTTGCACCAGG + Intergenic
926171599 2:10556180-10556202 ATTAACATGGGGCATGAGTCCGG + Intergenic
933437612 2:82268649-82268671 CAGAACATGGGCCCTGAACAAGG + Intergenic
938427022 2:131201282-131201304 CAGAACAGTGGGCATGAGCCTGG + Intronic
940282745 2:152004411-152004433 CTTAACATGGGGCTTGCACAGGG - Intronic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
1170232022 20:14059589-14059611 AATAAGATGGGACATGAAGCTGG + Intronic
1172037654 20:32021027-32021049 GAGAAAATGGGGCATGGACCTGG - Intronic
1172581992 20:36055617-36055639 CTCAAGATGGGGCATGAAGCTGG - Intergenic
1173318029 20:41962533-41962555 CATATCTTGGGGCAGGACCCAGG - Intergenic
1173490594 20:43477067-43477089 CATAGCAAGGGGCAAGCACCTGG - Intergenic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1173667131 20:44771127-44771149 CTGAAGATGGGGGATGAACCTGG + Intronic
1175296904 20:57914830-57914852 CGAAAGCTGGGGCATGAACCAGG - Intergenic
1176632339 21:9151554-9151576 CACAAAATGGGGCATGTCCCTGG - Intergenic
1179241590 21:39597745-39597767 GATGAGATGGGCCATGAACCAGG + Exonic
1179680570 21:43018227-43018249 CATAAAATGGCGCACGCACCTGG - Exonic
1184314475 22:43673871-43673893 CATTATATGTGGCGTGAACCTGG + Intronic
1184675664 22:46041653-46041675 CAGGAGATGTGGCATGAACCAGG - Intergenic
1184985937 22:48134133-48134155 GATAACATGTGGCAGAAACCTGG - Intergenic
950744613 3:15077133-15077155 CTTAACCTTGGGCTTGAACCAGG - Exonic
951270431 3:20617712-20617734 CATAAAATGGGGCATGTCCCTGG - Intergenic
951439231 3:22704221-22704243 CTGAAAATGGGGCATGAACTTGG + Intergenic
957099179 3:75807299-75807321 CACAAAATGGGGCATGTCCCTGG - Intergenic
960198135 3:114796220-114796242 CATAACATTGGAAATGAACTTGG + Intronic
960268385 3:115647603-115647625 GATAACATGGGGCATGGTCATGG + Intronic
963995448 3:151703059-151703081 CATGAAATGGGGCATGTCCCTGG + Intergenic
965315343 3:167183391-167183413 CCATACATGGGGCTTGAACCCGG - Intergenic
974563657 4:63554908-63554930 AATCAAAAGGGGCATGAACCTGG - Intergenic
977786246 4:101038092-101038114 CATAACATGGGGCATGAACCTGG + Intronic
978249775 4:106616586-106616608 CATAAACTCGGGCAAGAACCAGG - Intergenic
981990921 4:150919903-150919925 TATAACATGAGGCATGAAAAAGG + Intronic
984931546 4:184852053-184852075 CATATCTTGGAGCATGCACCAGG - Intergenic
988069960 5:26275311-26275333 CATAACATTAGTCATGAATCAGG - Intergenic
988122856 5:26990648-26990670 CAAAACATGGGGCATGTTCTGGG - Intronic
990608342 5:57432466-57432488 CTTAACATGAACCATGAACCAGG + Intergenic
990766756 5:59192691-59192713 TTTAACCTGGGGCATGAAGCAGG - Intronic
996424113 5:123294161-123294183 CTTAACAGGAGGCATGAACTAGG + Intergenic
996493324 5:124125031-124125053 CATGACATATGGCATGAGCCAGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1005214282 6:23507395-23507417 CATAAAATGGTGCATGTGCCTGG - Intergenic
1005768971 6:29045721-29045743 GATAACCTGGAGGATGAACCTGG + Intergenic
1006038451 6:31233307-31233329 CATGAAATGGGGCATGTCCCTGG - Intergenic
1006876519 6:37302095-37302117 CATAACATAAAGCATGAAGCAGG - Intronic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1008093353 6:47314548-47314570 CATGAAATGGGGTATGTACCCGG - Intergenic
1008373246 6:50760744-50760766 CTTACCATGGGGCATGTAACTGG - Intronic
1008399541 6:51048964-51048986 CATGCGATGGGGCATGAACTGGG - Intergenic
1010517305 6:76789298-76789320 CATAAGATTTGGTATGAACCAGG - Intergenic
1015679591 6:135790606-135790628 AATAACATATAGCATGAACCAGG + Intergenic
1017329718 6:153182207-153182229 CATACCCTGGGGAATGAGCCTGG + Intergenic
1019234188 6:170595960-170595982 CATGAAATGGGGCATGTCCCTGG - Intergenic
1024610979 7:51063982-51064004 CATAGCATGGGGCTAGAGCCAGG - Intronic
1028519857 7:91717757-91717779 CATAACAGGGAACATGAACATGG - Intronic
1032529931 7:132611594-132611616 AACAACCTGGGGCATGATCCTGG + Intronic
1032868150 7:135950247-135950269 CAAAGCATGGTGTATGAACCTGG + Intronic
1036444761 8:8811781-8811803 CATAAGTTGGGGCATAAACACGG + Intronic
1039531962 8:38270509-38270531 CTTAACATAGGGCATGTAACAGG + Exonic
1040528691 8:48247680-48247702 CATGAAATGGGGCATGTCCCTGG - Intergenic
1041621375 8:59973958-59973980 GGTAACATGGGGCCTGACCCAGG - Intergenic
1042321856 8:67484024-67484046 CAGAAATTGGAGCATGAACCTGG - Intronic
1044426901 8:92062608-92062630 CAGAACAGGAGGCATGAGCCCGG - Intronic
1044442602 8:92239365-92239387 CATGAAATGGGGCATGTGCCTGG + Intergenic
1044930610 8:97248405-97248427 AAAAACATGGGCCAGGAACCAGG + Intergenic
1045483431 8:102611226-102611248 CATAATATTGGGCATTAATCAGG + Intergenic
1047563051 8:126009797-126009819 CATGAAATGGGGCATGTCCCTGG + Intergenic
1047935258 8:129770203-129770225 TATAATATGAGGCATGAGCCTGG - Intronic
1053126417 9:35584294-35584316 CATAAAATGGGGTATGTTCCTGG + Intergenic
1058504016 9:105651145-105651167 CATAACATGAGGCATGAGAAAGG + Intergenic
1189406842 X:40732998-40733020 CAGAACAAGAGGCATAAACCAGG - Intronic
1189886868 X:45555566-45555588 CATAGCATGTGGCATTAAGCAGG - Intergenic
1191149589 X:57207132-57207154 CATAAAATGGGGTATGTCCCTGG - Intergenic
1192256492 X:69465100-69465122 CATCACAAGTGGCATGGACCAGG - Intergenic
1196963062 X:121025042-121025064 CATGACATGTGGCCTGTACCTGG - Intergenic
1199449376 X:147962356-147962378 TATAAGATGGGGATTGAACCTGG + Intergenic
1199620767 X:149698543-149698565 CATAAGATGGGCCTTGTACCTGG + Intronic