ID: 977787254

View in Genome Browser
Species Human (GRCh38)
Location 4:101051035-101051057
Sequence GAGAGCAGCCAGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 421}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977787251_977787254 8 Left 977787251 4:101051004-101051026 CCAGATTATGGCAAACACACTTG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 421
977787249_977787254 10 Left 977787249 4:101051002-101051024 CCCCAGATTATGGCAAACACACT 0: 1
1: 0
2: 0
3: 19
4: 153
Right 977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 421
977787247_977787254 27 Left 977787247 4:101050985-101051007 CCAGGCTAAAGGCTGGACCCCAG 0: 1
1: 0
2: 1
3: 27
4: 174
Right 977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 421
977787250_977787254 9 Left 977787250 4:101051003-101051025 CCCAGATTATGGCAAACACACTT 0: 1
1: 0
2: 1
3: 18
4: 196
Right 977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977787254 Original CRISPR GAGAGCAGCCAGGATGCTGC TGG Intronic
900092655 1:927188-927210 GACAGCAGACAGGGGGCTGCCGG - Intronic
900418059 1:2544044-2544066 GGGGACAGCCAGGAGGCTGCGGG - Intergenic
900429585 1:2595456-2595478 GAGCACAGCCAGGATGCCCCGGG - Intronic
900596476 1:3482363-3482385 GAGAACCGCCCGGAGGCTGCAGG - Intergenic
900990221 1:6095263-6095285 GTGAGCAGGCGGGAGGCTGCCGG - Intronic
901396568 1:8986402-8986424 AATAGGAGCCAGGAAGCTGCTGG + Intergenic
901510517 1:9716095-9716117 CAGAGCAGCCTGGATGCCGCAGG - Intronic
901647354 1:10723812-10723834 GAGAGCAGCCAGGTTGCAGGGGG - Intronic
903111031 1:21133782-21133804 GACAGCACCCAGGATGATTCCGG + Intronic
903550783 1:24156360-24156382 GAGAGCACCCAGGACACAGCAGG + Exonic
903892400 1:26578458-26578480 GAGAGCAGACTTGATGGTGCTGG + Intergenic
904040519 1:27581830-27581852 GAGAACAGCCAGGAGGTTGGTGG - Intronic
904859131 1:33521571-33521593 GAGAGCAGGTGGGAGGCTGCTGG + Intronic
904935241 1:34125586-34125608 GTGAGCAACCACGGTGCTGCAGG - Intronic
905179141 1:36155987-36156009 GAGAGGCGCCGGGAGGCTGCGGG + Intronic
905297556 1:36963770-36963792 GAAAGCATTCAGGAGGCTGCTGG - Intronic
905306471 1:37022337-37022359 AAGAGCAGCCGAGATGCTGACGG + Intronic
905401735 1:37708615-37708637 GAGAGCAGGGAGGATTCAGCTGG - Exonic
906678695 1:47710575-47710597 GAGCGAAGCCTGGAAGCTGCGGG + Intergenic
907241838 1:53085258-53085280 GAGAGCCCCCTGGGTGCTGCTGG + Exonic
908114861 1:60930537-60930559 GAAAGAAGCCAGGATGAAGCTGG - Intronic
908794255 1:67815888-67815910 GAGAGCAGCCTTCTTGCTGCCGG - Intronic
910340916 1:86186102-86186124 GAGAGCAGCCATCATACTGGAGG - Intergenic
910946718 1:92600743-92600765 GAGCTCAGACAGTATGCTGCTGG + Intronic
912245386 1:107956768-107956790 GAGAGCAGTCAGCACGGTGCGGG + Intronic
915288416 1:154867424-154867446 GAGAGCAGCCGGGTTGCTGGAGG + Intronic
915366439 1:155319547-155319569 GGAAGCAGCCAGGAAGATGCCGG + Intronic
920018995 1:202939484-202939506 TAGAGCAGACCAGATGCTGCTGG - Intergenic
920214307 1:204351146-204351168 CCGAGCAGCTGGGATGCTGCTGG + Intronic
922467678 1:225855499-225855521 GATGGCAGCCAGGATGCCTCTGG - Intronic
922478186 1:225921350-225921372 GGGAGCTGCCAAGATGCTGCTGG - Exonic
923766356 1:236895550-236895572 GGTAGGAGCCAGGAGGCTGCGGG + Exonic
924390218 1:243546645-243546667 CAGAGCAGCCATGGAGCTGCTGG + Intronic
924607801 1:245550417-245550439 GGGAGCAGCCAGGACGGAGCAGG - Intronic
1064231926 10:13536721-13536743 AAGAGCACACAGGCTGCTGCAGG + Intergenic
1064353209 10:14595861-14595883 GAGACCAGCCGGGGTGCCGCTGG - Intronic
1064743049 10:18452789-18452811 AAAAGCAGCCAGGGTGCTGCTGG - Intronic
1064827667 10:19423801-19423823 AAGAACAGCCAGGATGCAGCAGG + Intronic
1065487209 10:26247114-26247136 CAGAGCAGCCTGGAGGCTGCTGG + Intronic
1065648307 10:27860487-27860509 GAATGCAGCCATGATGCAGCAGG + Intronic
1066227064 10:33393718-33393740 GAGAGGAGACAGAAAGCTGCAGG + Intergenic
1066263240 10:33749425-33749447 AAAAGCAGCCAGGAGGCTGCAGG + Intergenic
1066466328 10:35653573-35653595 GAAAGCTGCCAGGAGACTGCTGG - Intergenic
1067533758 10:47093093-47093115 GAGAGCATCCAGGGACCTGCTGG - Intergenic
1067759434 10:49032519-49032541 GAGAGGCTCGAGGATGCTGCTGG + Intronic
1067774552 10:49153443-49153465 GACTGCAGCATGGATGCTGCAGG + Intergenic
1068929803 10:62577743-62577765 GTCAGCAGCTAGGAAGCTGCAGG + Intronic
1069683321 10:70300478-70300500 CAAGGCAGCCAGGCTGCTGCTGG + Exonic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1071089773 10:81904719-81904741 GAGAACAACCAGAATGCTGCAGG - Intronic
1071279510 10:84087283-84087305 CAGAGCAGCCTGGGGGCTGCTGG + Intergenic
1071380739 10:85056886-85056908 GAGAGCATACAGCATGATGCTGG - Intergenic
1073189843 10:101643492-101643514 GAGGGCACCCAGGATGCCGCAGG + Intronic
1073733215 10:106315759-106315781 CAGAGGAGCCAGGATGATGCAGG + Intergenic
1074009384 10:109461173-109461195 GAGAGTAGCGTGGAAGCTGCTGG - Intergenic
1074783755 10:116820929-116820951 GAGAGGAGTAAGGATGATGCTGG - Intergenic
1075249388 10:120851798-120851820 GAGAGAAGCCTGGAAGCTGGAGG - Intronic
1075814703 10:125256140-125256162 CAAAGCAGCCATGATGCTTCAGG + Intergenic
1076742997 10:132497312-132497334 GAGAGCAGCAAGGGTGCCGGCGG + Intergenic
1076743011 10:132497381-132497403 GAGAGCAGCAAGGGTGCCGGCGG + Intergenic
1077259300 11:1607298-1607320 GGGAGGAGCCAGGAGGTTGCGGG + Intergenic
1077277702 11:1723014-1723036 CAGACCAGCCAGGCTGTTGCAGG + Intergenic
1077443956 11:2581554-2581576 GAGCGCAGCCAGGTCCCTGCAGG - Intronic
1077997958 11:7470068-7470090 GAGAGCAACCATGAGACTGCAGG - Intergenic
1078151349 11:8762090-8762112 GACAGGAGCCATGATGCTGGTGG - Intronic
1078315490 11:10289972-10289994 GGGAGCAGCAATGATGCTGGTGG - Intronic
1078551819 11:12286305-12286327 GATTGAAGCCAGGAAGCTGCAGG - Intronic
1078589996 11:12632169-12632191 GGGAGCAGCCAGGAAGATGGAGG - Intergenic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1079129956 11:17741533-17741555 GAGAGCAGCTGGGGGGCTGCCGG - Intronic
1079570517 11:21937586-21937608 GAAAGCACTCAGAATGCTGCTGG + Intergenic
1079924452 11:26476532-26476554 GTGAGCAGACACAATGCTGCAGG + Intronic
1080384553 11:31803536-31803558 CAGAGCAGCCAGTATGTGGCTGG + Intronic
1080700431 11:34639758-34639780 GAAAGCAGCCAGCATGGTGAGGG - Intronic
1081606858 11:44532532-44532554 GAAAGCAGCCAAGATGGTGGAGG - Intergenic
1081784110 11:45734205-45734227 GGGCACAGCCAGGATGCAGCCGG + Intergenic
1081935343 11:46899986-46900008 CAGAGCAGTCAGGCTGCTGCAGG + Intronic
1082895243 11:58183375-58183397 GAGACCAGGCAGGATGCAGATGG - Intergenic
1083696805 11:64448836-64448858 GCGAGGAGCCAGGGTGCTTCCGG - Intergenic
1083707433 11:64526017-64526039 GAGAGCTGCCAAGAGGCTGCTGG - Intergenic
1083896990 11:65624961-65624983 GGCAGCAGCCAGCAGGCTGCGGG - Exonic
1084086411 11:66857219-66857241 GAGAGCGGCCAGGAGTCGGCGGG + Intronic
1084534911 11:69750921-69750943 AAGAGCACCCAGCATGCAGCAGG - Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1084674212 11:70624711-70624733 GGGAGAGGCCAGGCTGCTGCTGG + Intronic
1084692626 11:70735899-70735921 GTGAGCAGCTAGGATGGTGATGG - Intronic
1085052927 11:73388995-73389017 GGGAGCAGGCAAGGTGCTGCTGG - Intronic
1085513662 11:77100303-77100325 GGGAGCAGGCAGGATGCAGGAGG - Intronic
1087826856 11:102774833-102774855 AAGAATAGCCAGGATGCTCCTGG - Intronic
1089334312 11:117712639-117712661 GACACCAGCGAGGATGCTGTCGG - Intronic
1089635420 11:119808646-119808668 GAGTGGAGTGAGGATGCTGCTGG + Intergenic
1090276589 11:125424442-125424464 GAAGGCAGCCAGGATGGTGGGGG - Intronic
1090570605 11:128040697-128040719 GAGAGAAGCCAGGTTGATGCTGG - Intergenic
1090815079 11:130285859-130285881 GCTAGCAGCCAGTATGCAGCAGG + Intronic
1091797617 12:3306257-3306279 GCCAGCAGGCAGGATGCTGAGGG - Intergenic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1091970245 12:4780626-4780648 GAGAGCAGCCAAGATGCCTGTGG + Intronic
1094470184 12:30795876-30795898 GAGAGGAGCCAGGATGGGTCTGG - Intergenic
1095397248 12:41775091-41775113 GAAAGCAGCCAGGAGGATGAAGG - Intergenic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1096504179 12:52082306-52082328 GTGAGCAGACACGATGATGCTGG - Intergenic
1098301070 12:69054824-69054846 GAGAGCATGCAGCATGCTGGTGG + Intergenic
1100371712 12:93974811-93974833 GGGAGTAGCCAGGATCTTGCAGG + Intergenic
1101036927 12:100716165-100716187 GAGGGCAGCCAGGCGGCGGCGGG - Intergenic
1101389737 12:104289499-104289521 GAGAGCAACCAGGAAGCTCTTGG + Intronic
1102304209 12:111792335-111792357 GAGAGCAGCCAGGGAGAGGCTGG - Intronic
1102433057 12:112898552-112898574 GATGGCAGCCAGGAAGCTGTTGG - Exonic
1102540601 12:113616499-113616521 GGGAGGAGCCAGAAGGCTGCTGG + Intergenic
1102738288 12:115182575-115182597 GAAAGCAGCCAGACTGCTACTGG - Intergenic
1103330539 12:120150980-120151002 GAAAGCAGCAAGGACGCAGCTGG + Intronic
1104669382 12:130670009-130670031 GAGAGCATCCTGGATTATGCAGG + Intronic
1106036945 13:26051840-26051862 GAGAGCCGGCCGGAGGCTGCCGG - Intergenic
1106262053 13:28076526-28076548 GAGAGCCCCCAGAAGGCTGCTGG + Intronic
1106865367 13:33958778-33958800 GAGGGCAGCCAGGATGCTCATGG - Intronic
1107316002 13:39132937-39132959 CAGAGCATTCAGGATACTGCAGG + Intergenic
1108560468 13:51638278-51638300 GAGACCAGCTAGTATGCTCCTGG + Intronic
1110162289 13:72392913-72392935 GAGATCAGCTAGGAAGCTGTTGG - Intergenic
1111102490 13:83606213-83606235 TATAGCAGCCAGGATGCAGGGGG - Intergenic
1112770786 13:102792721-102792743 GACAGCAGCCAGGAAGAGGCAGG + Intronic
1113155986 13:107322621-107322643 GAGCACATCCAGGAAGCTGCTGG - Intronic
1113921557 13:113916003-113916025 ATGAGAGGCCAGGATGCTGCTGG - Intergenic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1115307518 14:31947606-31947628 GAGAGAGGTCAGCATGCTGCTGG - Intronic
1116044830 14:39731995-39732017 CCGAGTAGCCAGGATGCTGTAGG + Intergenic
1117063933 14:51989810-51989832 GAGAGGGGCCCGGAGGCTGCCGG - Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117760592 14:59023417-59023439 AAGAGAAGCCAAAATGCTGCAGG - Intergenic
1117802428 14:59458832-59458854 GAGTGCAGCCAAGAAGCTGGGGG - Intronic
1119618384 14:76113338-76113360 GGGAGCAGCCAAGAACCTGCTGG - Intergenic
1121177168 14:91899265-91899287 GACAGCAGCCAGGAGGGAGCAGG - Intronic
1121440701 14:93947313-93947335 GAGAGCTGCCTGGGTGCTGGCGG + Intronic
1121482833 14:94291676-94291698 GAGCGCAGGGTGGATGCTGCCGG + Intronic
1121941861 14:98078474-98078496 GATAGCATAAAGGATGCTGCAGG + Intergenic
1121952460 14:98183625-98183647 GAGAACTGCCAAGATGCAGCAGG + Intergenic
1122468603 14:101950774-101950796 GAGAACAGCAAGAAAGCTGCTGG - Intergenic
1122940174 14:104977668-104977690 GAGAGCAGCCAGGCTGGTCCAGG - Intronic
1123922452 15:25080009-25080031 CAGAGAAGCCAGGAAGCTCCTGG + Intergenic
1124551185 15:30682702-30682724 GAGAGCAGGGAAGATGTTGCTGG - Intronic
1124680062 15:31722962-31722984 GAGAGCAGGGAAGATGTTGCTGG + Intronic
1125356772 15:38824786-38824808 GAGAGAAGCCTGGATCCTCCTGG - Intergenic
1126135507 15:45386512-45386534 GAGAGGAGCCAGGTGGCTGTGGG - Intronic
1126856100 15:52840912-52840934 GAGAGCTGCCAGGAATCTGAGGG + Intergenic
1127867911 15:63047031-63047053 AGGAGCAGCCAGGAAACTGCTGG - Intronic
1129247132 15:74286445-74286467 GAGGGCACCCAGGATGCTGTGGG - Intronic
1129368043 15:75069049-75069071 GAGAAGAGCCAGCATGCTGAAGG + Intronic
1129382508 15:75177092-75177114 GAGAACAGCCCGGGAGCTGCAGG - Intergenic
1131111552 15:89767783-89767805 GTGGGCAGCCAGGTGGCTGCAGG + Intronic
1131155017 15:90069518-90069540 GAGAGAGGCCAGGATGCAACAGG + Intronic
1131419003 15:92287883-92287905 GGGAGCAGCCAGGAGGCAGTGGG - Intergenic
1131511100 15:93049968-93049990 GAGAGCAGCCTGGTGTCTGCAGG - Intronic
1132513038 16:353368-353390 GAGGGCAGTCAGGGGGCTGCAGG + Intergenic
1132554160 16:565338-565360 GAGAGGGGCCGGCATGCTGCAGG - Exonic
1132757855 16:1494594-1494616 GAGACCATCGAGGGTGCTGCGGG + Exonic
1132911844 16:2317770-2317792 GAGAGAAGCCATCACGCTGCTGG + Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133522355 16:6571301-6571323 GGGAGGAGCAAGGAAGCTGCAGG + Intronic
1133774835 16:8888156-8888178 CAGAGCAGCCAGGCTGTGGCAGG + Intergenic
1133835141 16:9361210-9361232 GAGAGAAACCAGAATGCTGTAGG + Intergenic
1135144735 16:19951311-19951333 GAGAGAAGCCAGGAACCTGGAGG - Intergenic
1136085484 16:27881926-27881948 GAGGCCAACCAGGAGGCTGCAGG - Intronic
1136246723 16:28980470-28980492 GAGGGCAGCCAGTCTCCTGCAGG - Intronic
1138086277 16:54136478-54136500 GAGATTAGCCAGGATGCTGCTGG - Intergenic
1138349149 16:56337316-56337338 GGGAGGGCCCAGGATGCTGCAGG + Intronic
1138626369 16:58255177-58255199 TAGAGCCCCCAGGAAGCTGCTGG + Intronic
1138718699 16:59053462-59053484 GAGAGCCCCCAGGAAGCTGCTGG - Intergenic
1138999363 16:62490472-62490494 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1139390932 16:66605772-66605794 GAGAGCGGCCAGGAGGGTGGGGG + Intronic
1140338268 16:74132208-74132230 GAAAACAGCCAGAATGCTTCTGG + Intergenic
1141086742 16:81101189-81101211 GAGAGGAGCCTGGAAGCAGCAGG - Intergenic
1141148229 16:81546953-81546975 GAGAGCTCCCTGGATGGTGCTGG + Intronic
1141199093 16:81883371-81883393 GGGAGCTGGCGGGATGCTGCTGG + Intronic
1141747027 16:85932773-85932795 GAGAGCAGCCTGGATTATCCGGG + Intergenic
1141747445 16:85935218-85935240 GAGAGCAGCCTGGATTATCCGGG + Intergenic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1142041686 16:87898254-87898276 GAAAGCAGCCCAGAAGCTGCAGG + Intronic
1142239333 16:88938075-88938097 TAGAGCAGCCGGGATGAGGCTGG + Intronic
1142344295 16:89544373-89544395 GAGAGGCTCCAGGATGCTGTAGG + Intronic
1142848836 17:2694682-2694704 GAGGGCAGCCGGGAGGCTCCCGG - Intronic
1142933769 17:3310444-3310466 GATGGCCGCCAGGATGCTGAGGG - Intergenic
1143374377 17:6458635-6458657 GAGAGCAGCCAGGTGGGGGCTGG - Intronic
1143984067 17:10895942-10895964 CAGAGCTGCCAGGGTGCTGGGGG + Intergenic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1148485355 17:47987404-47987426 GAGGGCATCAAGGCTGCTGCAGG + Intergenic
1150132229 17:62675397-62675419 GAGAGCTGCCAGGATGGAGAGGG - Intronic
1151519225 17:74616507-74616529 GGGAGCAGCCTGGAAGCTGATGG + Intronic
1151620755 17:75243409-75243431 GAGGGCTGCCTGGAGGCTGCGGG + Intronic
1151722507 17:75865477-75865499 GAGACCAGCCAGGGCGCTGCAGG - Intergenic
1152057423 17:78040953-78040975 GGGAGCTGCCAGGAAGCTCCCGG - Intronic
1152283333 17:79398172-79398194 GAGAGCAGTCCTGATCCTGCTGG + Intronic
1152476445 17:80521473-80521495 TATAGCAGCGAGGATGCTGGCGG + Intergenic
1152556448 17:81055439-81055461 GAGAGAAACAAGGCTGCTGCTGG - Intronic
1152732390 17:81978655-81978677 GGGCGCAGCCAGGAGGCTGTTGG + Intronic
1152805113 17:82352059-82352081 CAGAGCAGCCCGGAGGCAGCAGG - Intergenic
1154379770 18:13838493-13838515 GAGAGCAGCTAGGAGCCAGCTGG + Intergenic
1155032740 18:21998437-21998459 GACAGCTCCCTGGATGCTGCTGG - Intergenic
1157226156 18:45866546-45866568 GAGGGCTGCCAGCAAGCTGCTGG - Intronic
1157279128 18:46334262-46334284 GCGAGGAGCCAGGATGGTCCTGG + Exonic
1157598618 18:48879039-48879061 GAAAGGAGACAGGAGGCTGCCGG - Intergenic
1157845493 18:51000282-51000304 GAGAGCCTCCAGGAGGCTGCCGG - Intronic
1158318397 18:56237257-56237279 GAGAGCAACCTGGATTATGCAGG + Intergenic
1158931100 18:62325498-62325520 CGGAGGAGCCAGGATGCCGCCGG - Intronic
1159276757 18:66232051-66232073 GAGAGTCCCCAGGAGGCTGCTGG - Intergenic
1160310025 18:77780471-77780493 GAGAGCAGCAAGCACACTGCTGG - Intergenic
1160812208 19:1017725-1017747 GAGAGCGGGCAGGCTGCTCCTGG - Intronic
1161028837 19:2048758-2048780 GATAGCTACCAGGAGGCTGCTGG + Intronic
1161328573 19:3675415-3675437 AAGGGCAGCCAGTCTGCTGCAGG + Intronic
1161350418 19:3788150-3788172 GAGAGCATCCTGGATGCCCCAGG - Intronic
1161564797 19:4995694-4995716 CAGAGCAGCCAGTGAGCTGCTGG + Intronic
1161593740 19:5140906-5140928 AAAAGCAGGCAGGACGCTGCTGG - Intronic
1161597219 19:5156691-5156713 GACAGCAGCCAGGAGGCGGGCGG + Intergenic
1161680108 19:5675928-5675950 GGGAGAAGCCAGGTTGCCGCTGG + Intronic
1161811690 19:6475251-6475273 GTGAGCAGCGGGGACGCTGCGGG - Intronic
1161945913 19:7436677-7436699 CAGCCCTGCCAGGATGCTGCTGG + Intronic
1162099073 19:8328832-8328854 GAGAGCAGCCAGGAGGTTGCAGG + Intronic
1162788666 19:13051870-13051892 GGGAGCAGCCGGGCGGCTGCGGG + Intronic
1163327770 19:16616178-16616200 GTGAGCACCCAGGATGCTTCAGG + Intronic
1164570272 19:29369475-29369497 GAGACCAGCTGAGATGCTGCTGG + Intergenic
1164866987 19:31612653-31612675 GAGAGCATCCTGGGGGCTGCTGG + Intergenic
1165306447 19:35005574-35005596 GAGACCAGGGAGGAGGCTGCTGG + Intronic
1165730581 19:38142359-38142381 GAGAGAAGCTGGGATGCTCCTGG - Intronic
1165735295 19:38172012-38172034 AAGAGCAGCCAGGGTAATGCGGG + Intronic
1165947363 19:39452227-39452249 GGAGGCATCCAGGATGCTGCTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166819888 19:45571560-45571582 TATGGCAGCCAGGCTGCTGCTGG - Intronic
1166917705 19:46206931-46206953 GAGACCAGGCAGGAAGCTGATGG - Intergenic
1166919995 19:46222743-46222765 GAGACCAGGCAGGAGGCTGATGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1168594609 19:57665040-57665062 GAGAGCTCCCAGAATGCCGCTGG - Intergenic
925429607 2:3779798-3779820 GGTGGCAGCCAGGAAGCTGCAGG - Intronic
925440740 2:3883214-3883236 GAGAGCCCCCAGGAAGCTGCTGG + Intergenic
926926283 2:17991347-17991369 GAAAGCAGCCAGGGTGCAGGGGG + Intronic
927576514 2:24206307-24206329 TATAGCAGCCAGGAAGCTGGTGG + Intronic
928125186 2:28610727-28610749 TAAAGCAGCCAGGATGTTGATGG + Intronic
931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG + Intergenic
932177778 2:69618675-69618697 GAGGGAAGCCAAGATGCTACAGG - Intronic
932420681 2:71599637-71599659 AAGAGGAGGCTGGATGCTGCCGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933833035 2:86225778-86225800 GACACCAGCCAGCAGGCTGCAGG + Intronic
935458009 2:103293104-103293126 GAGACCAGCCAGGATGGCGGGGG - Intergenic
935584036 2:104784684-104784706 GACAGCAGTCAGAGTGCTGCTGG - Intergenic
935632242 2:105221604-105221626 CACAGCAGCCAGGGTGCTCCCGG - Intergenic
936235107 2:110735682-110735704 CACAGCAGCCAGGATGCTCCCGG - Intronic
938376258 2:130808643-130808665 GCCAGCAGCCAGGAGGCAGCAGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
940035783 2:149310768-149310790 GAGAGCTGCCATGATGGTGAGGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941893342 2:170605241-170605263 AAGAGCAGCCATGAGGCTGGGGG - Intronic
943984485 2:194602833-194602855 AAGAGCAGACAAGATGGTGCTGG + Intergenic
945093192 2:206195480-206195502 GATCACAGCCTGGATGCTGCTGG + Intronic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
947603169 2:231467246-231467268 GACACCAGCCAAGAAGCTGCAGG + Intronic
947982236 2:234420403-234420425 GAGACCAATCTGGATGCTGCTGG - Intergenic
948851627 2:240711162-240711184 CAGAGCAGGCAGGAAGCTGGGGG + Intergenic
948932678 2:241142085-241142107 GAGAGTGCCCAGGATACTGCAGG - Intronic
1168936580 20:1670982-1671004 CAGCACAGCCAGGATGGTGCTGG - Intergenic
1169707263 20:8519493-8519515 GAGAGCAGGCAGGATGAAGAGGG - Intronic
1171022975 20:21603374-21603396 AGGAGCAGCCAGAATGCTGAGGG - Intergenic
1171343878 20:24451272-24451294 AAGAGCAGCCAGGCTTCTCCTGG + Intergenic
1171395846 20:24832639-24832661 GAGAGCAGACAGGCTGCTGTGGG + Intergenic
1171441076 20:25163583-25163605 CAGAGCAGCCCTGAGGCTGCTGG + Intergenic
1172813696 20:37670000-37670022 GAGAGCAGCCTGGAAGATGATGG - Intergenic
1173492626 20:43495510-43495532 GAGAGCCCCCAGGATGCTGCTGG + Intergenic
1174157972 20:48528874-48528896 GAGAGCAGCCAGGCAGGAGCAGG + Intergenic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174520581 20:51127239-51127261 GAAGGCAGCCAGGATGATGCAGG + Intergenic
1174592395 20:51656819-51656841 GACAGGAGCCAGGATGATGCAGG - Intronic
1175280991 20:57804023-57804045 GAAAGCAGCCCACATGCTGCAGG + Intergenic
1175592453 20:60203887-60203909 GACAACAGGCAGGAGGCTGCAGG + Intergenic
1175619776 20:60433580-60433602 AAGAGATGCCAGGATGATGCAGG + Intergenic
1175636858 20:60591662-60591684 GAGAGCAGGCTGGGGGCTGCAGG + Intergenic
1175705661 20:61174694-61174716 GGGAGCAGAGAGGCTGCTGCTGG + Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1178224441 21:30699430-30699452 GAAAGCAGCCAGGATGGCGATGG - Intergenic
1179196874 21:39172208-39172230 GAGAGCAGGCAGGGTGGGGCAGG + Intergenic
1179306774 21:40161103-40161125 GAGCGCAGCCAGGAAAATGCTGG - Intronic
1179656963 21:42851687-42851709 GAGAGCAGCCAGGCTGAGGGAGG - Intronic
1179883124 21:44301672-44301694 GAGGGCAGACAGGTTGCTGTGGG + Intronic
1179924945 21:44529209-44529231 GAGAGCAGTGGGGATGCGGCGGG + Intronic
1180042865 21:45288727-45288749 GGGAGCTGCCTGGAGGCTGCGGG - Intergenic
1181110353 22:20599109-20599131 GAGAGCAGCCAGGGAGCACCTGG - Intergenic
1181460428 22:23083017-23083039 GAGACCAGGCAGGAGGCTCCAGG + Intronic
1181537781 22:23555661-23555683 AGAAGCAGCCAGGACGCTGCTGG + Intergenic
1181689654 22:24551486-24551508 GAGGGCAGCCAAGATGAGGCTGG - Intronic
1181762221 22:25066603-25066625 GAGATCAGCCTGGATTCTCCAGG - Intronic
1182310694 22:29403516-29403538 GAGACCAGCTAGGAGGCTGGTGG + Intronic
1182690353 22:32157232-32157254 GAGACCAGCTAGGAGGCTGGTGG - Intronic
1183233046 22:36595194-36595216 AAGAGCAGTCAGGATAGTGCGGG + Intronic
1183257177 22:36770139-36770161 GACAGCAGGCAGGGCGCTGCAGG + Intronic
1183732789 22:39628006-39628028 AAGAGCAGCCTGGACCCTGCAGG + Intronic
1184249610 22:43252724-43252746 GAGAGCAGCCCAGATGGTGAGGG - Intronic
949756606 3:7418614-7418636 GAGACTTGCCAGGATGCTGCTGG + Intronic
952035417 3:29195565-29195587 GAGAGCTCCCAGGAAGCTACTGG + Intergenic
952232622 3:31447793-31447815 GGGAGCAGCCAGGAGACTGTAGG + Intergenic
953174523 3:40537724-40537746 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
953885433 3:46712249-46712271 GAGGGCAGCAAGGAGGCTGAGGG + Exonic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
956113371 3:65893979-65894001 GAAACCAGCTAGGAGGCTGCAGG - Intronic
956872905 3:73435704-73435726 GAGAGCACCCAGGAGGCTCTGGG - Intronic
957462819 3:80544225-80544247 AAGGGCAGCCAGGATGATGAAGG - Intergenic
958045602 3:88280384-88280406 AAGAGCAGCAAGGAAGCAGCAGG + Intergenic
960378331 3:116930118-116930140 GATGGCAGGCAGGATGGTGCGGG + Intronic
960401560 3:117205780-117205802 GAGAGCGGTGAGGAAGCTGCAGG + Intergenic
961329261 3:126129149-126129171 GAGAGGAGCCAGGCTGCAGGTGG - Intronic
961782604 3:129329575-129329597 AAGGGCAGCCAGGTTTCTGCTGG - Intergenic
962555743 3:136549457-136549479 AAAATCAGCCAGGATGGTGCAGG - Intronic
962749670 3:138424592-138424614 AAGAACAGCCAGGAGGCTGAGGG + Intergenic
963605652 3:147410100-147410122 CCGAGCAGCCACGATGCTCCTGG + Exonic
964758912 3:160115086-160115108 GAGAGCACCAAGGAGGCTCCTGG + Intergenic
967381131 3:188859361-188859383 GAGAGCAGGCAGTATGGTGGTGG - Intronic
967920217 3:194608957-194608979 GATGACAGCCAGGAGGCTGCTGG + Intronic
967983319 3:195078289-195078311 AAGAGGAGCCAGGAAGATGCAGG + Intronic
968263709 3:197345601-197345623 GAGAGCCTCCAGGACGCAGCTGG + Intergenic
968489989 4:884791-884813 CAGAGCAGGCCGGAGGCTGCGGG + Intronic
968632926 4:1661515-1661537 GACAGCAGCCAGGAGGCGGTAGG - Intronic
969319875 4:6405295-6405317 GGGAGCAGCCAGGCTGCTGTGGG - Intronic
969929747 4:10619484-10619506 GAGAGCAGCCAAGGTGCTTTGGG - Intronic
970138203 4:12949947-12949969 GATAGCAGCAAGCCTGCTGCTGG + Intergenic
970426888 4:15954008-15954030 AAGAGCAGCTAGGGGGCTGCTGG - Intergenic
970617609 4:17782037-17782059 GAGAGGAGCCAGGACATTGCGGG + Intergenic
970882525 4:20948529-20948551 GCTGGCAGCCAGCATGCTGCAGG - Intronic
971216608 4:24667890-24667912 GAGTGCAGCCAGGAGGCACCCGG + Intergenic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
974016533 4:56654115-56654137 GACAGCAGCCAGAAGGCAGCAGG - Intronic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
976014991 4:80542151-80542173 GAGAGCCGCTGGGAGGCTGCTGG - Intronic
977425328 4:96861463-96861485 GAGACAAGCTTGGATGCTGCAGG + Intergenic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
977967304 4:103168095-103168117 GAGAGCAGGGAGGCTGCAGCAGG - Intronic
979657966 4:123219164-123219186 GAGAGCCTCCAGGAGGCCGCTGG + Intronic
979810967 4:125035601-125035623 GAGAACAGTCAGGAAGCAGCAGG + Intergenic
981147635 4:141343614-141343636 GAGGGAAGCCAGGATGCAGGTGG + Intergenic
981443161 4:144806420-144806442 TAGAGCAGCCCTGATGCTGGTGG - Intergenic
981563521 4:146073543-146073565 GAGACCAGCTAGGAGGCTACTGG - Intergenic
981611397 4:146597397-146597419 GAAAGCAGCCAGGATGGGGGTGG - Intergenic
982352756 4:154433776-154433798 GAGAGCAGCGAGGCCACTGCAGG - Intronic
985547137 5:515358-515380 GAGAGCAGCCAGGGTGCCCAAGG - Intronic
985577600 5:680889-680911 GAAGTCAGCCAGGCTGCTGCTGG + Intronic
985592530 5:772987-773009 GAAGACAGCCAGGCTGCTGCTGG + Intergenic
985643994 5:1076561-1076583 GTGGGCAGTCAGGATCCTGCCGG - Intronic
985676528 5:1234370-1234392 GAGAGGTGCCAGGAGGCTGATGG - Intronic
987647255 5:20689953-20689975 GATAACATCCAGGATGCTGATGG + Intergenic
987768546 5:22268969-22268991 GAGTCCAGTCAGGATGCTTCAGG - Intronic
988177844 5:27750122-27750144 CACAGCGGCAAGGATGCTGCTGG + Intergenic
988727528 5:33939081-33939103 GAGAGCAGTCTGCGTGCTGCCGG + Intergenic
988788917 5:34589517-34589539 GTTAGCATCCAGGTTGCTGCAGG - Intergenic
990338245 5:54796052-54796074 GAGAGAAGCCAGGTGACTGCTGG - Intergenic
992597294 5:78359946-78359968 GAGAGCAGCCTTGGCGCTGCCGG - Intergenic
993455951 5:88127089-88127111 GAGAGAAACTAGGATGTTGCGGG - Intergenic
993964234 5:94341394-94341416 GATAGCAGCGATGATGATGCTGG - Intronic
994315683 5:98330538-98330560 GAGATCAGCCAGTATTCTGATGG + Intergenic
994590110 5:101761341-101761363 GACAGCAGCCAGGGAGCTGAAGG + Intergenic
995410038 5:111846590-111846612 GAGGGCTGCCTGGATACTGCTGG + Intronic
995518460 5:112976959-112976981 GAGATCGTCCAGGACGCTGCCGG - Exonic
997022309 5:130015928-130015950 GACAGCAGCATGGATGCAGCTGG + Intronic
997246366 5:132353127-132353149 GAGAGAAGCCAGGACTGTGCTGG - Intergenic
997292360 5:132747271-132747293 GCGCGCACCCAGGATGCGGCAGG - Intergenic
998950430 5:147388372-147388394 GTGGGCAGCCAGCAAGCTGCTGG + Intergenic
1000267969 5:159656653-159656675 GAGAGCAGGCCTGATGATGCTGG + Intergenic
1000280626 5:159778795-159778817 GGGTGCAGCCTGGATGATGCTGG - Intergenic
1001299902 5:170525955-170525977 GACAGCAGCCTGGTTGGTGCTGG - Intronic
1001924315 5:175625326-175625348 GTGAGCAGCAAGGACGCTGTTGG - Intergenic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002297065 5:178237674-178237696 GCAAGCAGCCAGGATGGAGCTGG + Exonic
1003501724 6:6708667-6708689 GAGAGAAGCCAGAATGGTGTTGG + Intergenic
1003916590 6:10792356-10792378 CAGAGGAGGCAGGCTGCTGCTGG - Intronic
1004959960 6:20776905-20776927 GGGAGCAGCAAAGAAGCTGCTGG - Intronic
1005347988 6:24909320-24909342 GAGAATAGCCATGATGGTGCTGG + Intronic
1005780238 6:29184020-29184042 GTGAGAAACCAGGATGCTACAGG - Intergenic
1005930498 6:30480753-30480775 GAAAGCACCCAGGCTGCGGCAGG - Intergenic
1006375622 6:33670269-33670291 GATGGCAGCCGGGAGGCTGCTGG - Intronic
1006848243 6:37078126-37078148 GGGAGCAGCCAGGCTGCAGCTGG + Intergenic
1006903113 6:37515757-37515779 GAAAGAAGGGAGGATGCTGCCGG - Intergenic
1007616842 6:43184862-43184884 GAGTGCAGGCAAAATGCTGCAGG + Exonic
1007729473 6:43937207-43937229 CAGAGGAGCCAAGAAGCTGCTGG + Intergenic
1007762025 6:44138836-44138858 GGGAGCAGCCAGCCAGCTGCAGG + Intronic
1007992702 6:46274087-46274109 GAAGGCAGCCAAAATGCTGCTGG - Intronic
1010897586 6:81383485-81383507 GAAAGCAGCCAAGAGGCTGTTGG - Intergenic
1013342050 6:109224474-109224496 GAGAGCACCCAGCATCCTCCAGG - Intergenic
1015541418 6:134317804-134317826 AAGAGCAGCCAGGTAGCTGGGGG - Exonic
1017244316 6:152206203-152206225 GAAATCAGCCAGCATGCGGCTGG - Exonic
1017554769 6:155551190-155551212 GTGAGCAGACAGGATGCAGTTGG + Intergenic
1017753407 6:157509906-157509928 GAGAGCAGAGTGGAGGCTGCAGG - Intronic
1017859138 6:158379052-158379074 GAGACCAGTTAGGAGGCTGCTGG + Intronic
1018188291 6:161286924-161286946 GGGAGCACCCAGGAGGCTGCGGG + Intergenic
1019446117 7:1072187-1072209 GTGGGCAGCCAGGATGCTTACGG - Intronic
1019552854 7:1611913-1611935 GAGAGCAGCAGGGATGAGGCTGG - Intergenic
1020065229 7:5183259-5183281 GAGAGCAGGAAGGATGCTCAGGG - Intergenic
1021338472 7:19433724-19433746 GAGAGCTCCCAGGAAGCTGCTGG - Intergenic
1021484586 7:21153664-21153686 GAGAGAAGCCAGAATGGTGTGGG + Intergenic
1022482081 7:30751023-30751045 CAGAGCAGGCAGGAAACTGCAGG - Intronic
1022515269 7:30971192-30971214 GAGAGCAACCAGGATGGTGATGG - Exonic
1022792749 7:33705060-33705082 GAGGGCAGCCCTGATGCTGGAGG - Intergenic
1023859725 7:44211139-44211161 GAGAACACCCAGGAGGCAGCAGG - Intronic
1024613632 7:51088591-51088613 GAGAGCAGAAAGGATGCTGGAGG - Intronic
1024702849 7:51923598-51923620 GGGAGCAGCCAAAATGCTGAAGG + Intergenic
1027596093 7:80176280-80176302 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1028364624 7:90013018-90013040 GGGAGCAGCAAGGGGGCTGCAGG + Intergenic
1028930753 7:96410219-96410241 GTGAGAATCCAGGATGGTGCTGG + Intergenic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1031957698 7:127958920-127958942 GAGAGCATGCAGCATGCTGGCGG + Intronic
1032189992 7:129759389-129759411 GAGGTCACCCAGGATGCTGGCGG + Intergenic
1032284969 7:130532923-130532945 GAGAGAATGCAGGATGGTGCAGG + Intronic
1033258598 7:139822834-139822856 AGGACCAGCCAGGAGGCTGCGGG - Intronic
1033330665 7:140414459-140414481 GACAGATGCCAGGATGTTGCAGG + Intronic
1033599176 7:142876699-142876721 GAGGGGAGCTGGGATGCTGCAGG - Intronic
1033619720 7:143051324-143051346 GAGAGCAGAAAGGGTGCAGCAGG - Intergenic
1034431063 7:151041324-151041346 GAGAGCAGCAAGGATGAGGGTGG - Intronic
1035154456 7:156900761-156900783 GAGTGAAGCCAGGATGGTGAGGG - Intergenic
1035444762 7:158932714-158932736 GAGAGCAGTTAGGAGGCTTCTGG + Intronic
1037010832 8:13840237-13840259 GAGAGAAGCCAGGTTGATGAAGG - Intergenic
1037114767 8:15210985-15211007 GAGAGAAGCCTGGGTGTTGCAGG - Intronic
1037492321 8:19408112-19408134 CAGAGCAGCCAGGACCCCGCTGG + Intronic
1037816298 8:22114551-22114573 GAGCGCCACCAGGAGGCTGCGGG + Exonic
1038229127 8:25684423-25684445 GAGAGCAGCCAGGGTGTGGCTGG + Intergenic
1039006967 8:33050370-33050392 GAGGGCAATCAGGAAGCTGCAGG - Intergenic
1039416045 8:37394751-37394773 GAGAGCACTCAAGATGCTGCGGG + Intergenic
1042125851 8:65536414-65536436 CAGAGCAGCTTGGGTGCTGCAGG - Intergenic
1044251128 8:90005210-90005232 GAGATCAGTCAGGTTGCTGGGGG + Intronic
1048016512 8:130501956-130501978 GAGAGCCCCCAGGAGACTGCTGG + Intergenic
1048862990 8:138737423-138737445 GTGGGCAGCCAGAATCCTGCTGG - Intronic
1049206576 8:141366418-141366440 GCCAGCAGCCAGGGTGCTGGCGG - Intronic
1049252100 8:141594720-141594742 GAGAGCAGCTAGAGTGGTGCCGG - Intergenic
1049344805 8:142133168-142133190 CAGAGGAGCCAGGGTGATGCAGG - Intergenic
1049402335 8:142434021-142434043 CAGAACAGCCAGGGTGCAGCAGG - Intergenic
1050739164 9:8800674-8800696 CAGAGCAGCCCCGAGGCTGCTGG - Intronic
1053063038 9:35046077-35046099 TAGAGCACTCAGGATTCTGCAGG + Intergenic
1053271118 9:36750168-36750190 GAGAACAGCCACCAGGCTGCAGG + Intergenic
1053352895 9:37424954-37424976 AAGAGGATCCTGGATGCTGCAGG + Exonic
1053382348 9:37659323-37659345 AGCAGCAGCCAGGATGCTGAAGG - Intronic
1054735374 9:68745070-68745092 GAGAGCTGGCTGGATGCTGACGG - Intronic
1054768824 9:69066092-69066114 AACAGCAGCCAGGCTGCTGAGGG - Intronic
1055149036 9:72972821-72972843 GATAGCAGCCAGGCTGCAGGGGG + Intronic
1055449061 9:76414508-76414530 CAGAGCAACCAGGGGGCTGCTGG + Intergenic
1055807361 9:80111441-80111463 GAGAGAAGTGAGGAAGCTGCAGG - Intergenic
1055882981 9:81024063-81024085 GAGAGCCCCCAGGAAGCTGCTGG - Intergenic
1056143217 9:83705014-83705036 GAAAGCACCCAGGATGGTGGAGG + Intronic
1056765339 9:89441587-89441609 GAGGGCAGCCTGGAAGCAGCAGG + Intronic
1056807278 9:89738667-89738689 GAGAGCAGCAAGGATGGGACTGG + Intergenic
1056943786 9:90976798-90976820 TAAAGGAGCAAGGATGCTGCGGG + Intergenic
1057500160 9:95590487-95590509 GGGAGCAGCCAGGACACAGCTGG - Intergenic
1057548246 9:96033984-96034006 GTGAGCAGCCAAGGTGCTCCGGG + Intergenic
1057949498 9:99358724-99358746 GAGAGCAGGCAGGTGGCTGGTGG + Intergenic
1058765604 9:108180102-108180124 GAGAGCCCCCAGGAGGCTGCTGG - Intergenic
1059730630 9:117053599-117053621 GAGAAGAGCCAGGATGTTGCTGG - Intronic
1059762224 9:117349159-117349181 CACAGCAGACAGGAAGCTGCCGG + Intronic
1060232831 9:121838350-121838372 GAGACCAGCGAGGAGGCTGTGGG - Intronic
1062346419 9:136117347-136117369 GGGAGCTGCGAGGATCCTGCAGG - Intronic
1062518386 9:136947222-136947244 AAGAGCAGCCCGGGGGCTGCAGG - Intronic
1062710724 9:137973821-137973843 GAGGGCAGACAGGATGTTGGAGG + Intronic
1186407393 X:9316189-9316211 GACAGAAGCCAGGAGGCTGTGGG + Intergenic
1186918485 X:14249561-14249583 GAGAGAAGCCAGGAGCATGCAGG - Intergenic
1187024301 X:15417876-15417898 GAGATTAGCCTGGATGATGCAGG - Intronic
1188505166 X:30874610-30874632 GTGAGTAGCAAGGATGTTGCTGG + Intronic
1189314196 X:40042173-40042195 GACAGCAGGAAGGAAGCTGCTGG - Intergenic
1192173610 X:68872323-68872345 GAGACCAGCCGGCAGGCTGCAGG + Intergenic
1194447155 X:94002293-94002315 CAGAGCAGCAAGAATGCTCCTGG - Intergenic
1194591083 X:95800461-95800483 GAGAGCCCCCAGCAAGCTGCTGG - Intergenic
1196311263 X:114168514-114168536 GAGAGCAGCCAGAATTGTTCTGG - Intergenic
1198685614 X:139225291-139225313 AAGCCCAGCCAGGAAGCTGCAGG - Intergenic
1199742109 X:150745376-150745398 GGAAGCAGCCAGGACACTGCCGG + Intronic
1199819299 X:151428823-151428845 AAGAGTAGCCAGGAGGCTCCTGG - Intergenic
1199860455 X:151796605-151796627 GAGTGCAGCCAAAGTGCTGCGGG + Intergenic
1200044659 X:153394971-153394993 GAGAGCACCCGGGCTCCTGCAGG + Intergenic