ID: 977791358

View in Genome Browser
Species Human (GRCh38)
Location 4:101107531-101107553
Sequence CTGGTGATGATGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 2, 2: 4, 3: 57, 4: 583}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977791358_977791363 15 Left 977791358 4:101107531-101107553 CCTTCTTCCCTCATCATCACCAG 0: 1
1: 2
2: 4
3: 57
4: 583
Right 977791363 4:101107569-101107591 CTGTGATCTTTAAATGCAGACGG 0: 1
1: 0
2: 0
3: 26
4: 290
977791358_977791364 29 Left 977791358 4:101107531-101107553 CCTTCTTCCCTCATCATCACCAG 0: 1
1: 2
2: 4
3: 57
4: 583
Right 977791364 4:101107583-101107605 TGCAGACGGTATTATTATGTTGG 0: 1
1: 0
2: 1
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977791358 Original CRISPR CTGGTGATGATGAGGGAAGA AGG (reversed) Intronic
901218597 1:7569216-7569238 ATGGTGATGATGATGGATGATGG - Intronic
902175401 1:14646457-14646479 ATGGTGATAGTGAGGGAAGCTGG + Intronic
902550332 1:17215372-17215394 ATGATGATGATGATGAAAGAAGG - Intronic
903329922 1:22592131-22592153 GTGGTGATGGTGAGGCAGGAGGG - Intronic
903501487 1:23802419-23802441 CTGGGGATGATGTGGAAATAGGG - Exonic
903954898 1:27018580-27018602 CTGGAGATGATGGGGGATGTAGG + Intergenic
904213045 1:28898301-28898323 GTGGTGAAGATGAGGGGAGAAGG - Intronic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
905361193 1:37421915-37421937 CTGGCCATGATGTGGGAAGAGGG - Intergenic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906944333 1:50283002-50283024 ATGTTGAAGATGAGGGCAGAGGG - Intergenic
907014579 1:50999386-50999408 CTGGTGATGATGTGGAGAAAAGG + Intergenic
907038793 1:51239281-51239303 TAGGTGATGATGAGGGATGAGGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907814687 1:57906686-57906708 TAAGTGAAGATGAGGGAAGAGGG + Intronic
908477216 1:64501395-64501417 CTGGTCATGATGAGTGAAGTTGG - Intronic
908578600 1:65489250-65489272 CTGGTGAGGATGTGGCAAAAGGG - Intronic
908994465 1:70134640-70134662 CTGGTGATCATGTGGCTAGAAGG - Intronic
909045006 1:70699162-70699184 TTGATGAGGATGAGGGCAGATGG - Intergenic
909500405 1:76328908-76328930 CTGGAGATGATGAGGGCAATTGG - Intronic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910174808 1:84417955-84417977 CTGGTGATGATGAGGAGAAAGGG - Intergenic
910212455 1:84807318-84807340 CTAGAGATGAGGAGGGCAGAGGG + Intergenic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
912927545 1:113926814-113926836 CTAGTGATGGTGAAGGAAGAGGG - Intergenic
913132360 1:115852569-115852591 CTGATGATGATGTGGAAAAAGGG - Intergenic
913488368 1:119355101-119355123 ATTGTGATGATGTGTGAAGAAGG - Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914979084 1:152396920-152396942 CTGGTGAGGATGTGGAAAAAAGG + Intergenic
915944318 1:160138731-160138753 CTGGAGAGGCTGAGGCAAGAGGG + Intronic
917237384 1:172909016-172909038 CTGGTGAGGTTGTGGGAAAAAGG + Intergenic
917666260 1:177228662-177228684 TTGGTGCTGACGAGGGGAGATGG + Intronic
917803191 1:178589158-178589180 CTGGTGAGGATGAGGAGAAAAGG - Intergenic
918851209 1:189693002-189693024 CTGGTGCTGGTGAAGGAGGAAGG - Intergenic
919031365 1:192247360-192247382 ATGGTGATGCTGGGGGAAAATGG - Intergenic
919573314 1:199275706-199275728 TTGGTGAGGATGAGGCAAAAAGG + Intergenic
919700853 1:200629760-200629782 CTGGGGCTGATGAGGAAAGCAGG + Intronic
919843489 1:201626351-201626373 CTGGAGATGGGGAGGGAAGCAGG - Intronic
920954626 1:210607029-210607051 CTGGGGGTGAAGAAGGAAGAGGG + Intronic
921147605 1:212373861-212373883 CTGGTGAAGATGTGGAAAAAGGG + Intronic
922380789 1:225022605-225022627 CTGGTGAGGATGTGGCAAAAAGG + Intronic
922564949 1:226595749-226595771 CTGGCGGTGATGATGGAGGAAGG + Intronic
922971827 1:229748404-229748426 TTGGTGATGATGAGGAGAAAAGG + Intergenic
923963616 1:239110549-239110571 GTTGTGATGATGAGGAAAGGAGG + Intergenic
924329089 1:242924451-242924473 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
924872053 1:248058372-248058394 CTGGGGGTGATGACGGAGGAGGG - Intronic
924929945 1:248721764-248721786 CTGGTCATGATGAAGGTACAAGG - Intronic
1065439002 10:25729893-25729915 CTGGTGGTGAGGTGGGAGGATGG + Intergenic
1065849663 10:29777223-29777245 CTGGTGATATTGAAGGAAGCCGG + Intergenic
1067464953 10:46490906-46490928 CTGGTGGTGGGGAGGAAAGATGG - Intergenic
1067622236 10:47893695-47893717 CTGGTGGTGGGGAGGAAAGATGG + Intergenic
1068236995 10:54250014-54250036 CTGGTGCTGAAGTGGGAGGATGG - Intronic
1069202442 10:65637663-65637685 CTGGTGAGGATGAAGAAAAAGGG + Intergenic
1069671847 10:70212689-70212711 CTGGAGAGGAGGAGGGAATAGGG + Intronic
1070038074 10:72747415-72747437 CTTGTTATGATGAGGTAATAAGG + Intronic
1070508182 10:77135348-77135370 TTGGTGAGGATGTGGGAAAAAGG + Intronic
1071110685 10:82151660-82151682 CTGGTCTTGATGAATGAAGAAGG + Intronic
1071236398 10:83655505-83655527 CTGGTAAGGATGGGGAAAGAGGG - Intergenic
1071678343 10:87678788-87678810 CTGGTGAGGATGTGGAAAAAAGG + Intronic
1071853427 10:89599021-89599043 TTGGTCAGGTTGAGGGAAGAAGG - Intronic
1072263457 10:93704629-93704651 GTGGTCAGGATGAGGGAAGTTGG + Intergenic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1073562808 10:104511272-104511294 CAGGTGATGATGAGGGGATGGGG + Intergenic
1073628355 10:105122132-105122154 GTGCTGATAATGAGGGAAGTTGG + Intronic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074972502 10:118550656-118550678 CTGGTGATCAGGTTGGAAGATGG + Intergenic
1075079735 10:119375332-119375354 CAGGTGAAGAAGAGGGAAAAAGG - Intronic
1075859292 10:125661167-125661189 CGGGTGATGTGGAAGGAAGATGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076616245 10:131756745-131756767 CTTGAGAGGATGAGGAAAGAAGG - Intergenic
1076891368 10:133285456-133285478 CTGTTGATGATGAGCGAAAGGGG + Exonic
1077245650 11:1536205-1536227 CTGGTGATGATGAGCGTGGCTGG - Intergenic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079766977 11:24406266-24406288 AGGGGGATGAAGAGGGAAGACGG - Intergenic
1080505723 11:32911282-32911304 CTGGGGGTGGTGGGGGAAGACGG + Intronic
1080793086 11:35538624-35538646 CATGTGATGCTGAGGGGAGAGGG - Intergenic
1081132671 11:39399682-39399704 CTGATGATGGGGAGGTAAGAGGG + Intergenic
1081192740 11:40124174-40124196 CTGGTGAGGATGTGGGAAAAAGG + Intronic
1081757630 11:45555955-45555977 CTGGTCTTGCTGAGGGAAGCAGG - Intergenic
1082143493 11:48637576-48637598 CTAGTTTTGATGATGGAAGAGGG + Intergenic
1082856402 11:57811074-57811096 CAGGTGATGATGAAGGATGATGG + Intronic
1083361214 11:62109871-62109893 CATGTGATCATGAAGGAAGAAGG - Intergenic
1084360402 11:68665222-68665244 CGGGAGGAGATGAGGGAAGAGGG + Intergenic
1087128414 11:94648161-94648183 GTGGTGTTGGTGAGGGAGGAGGG + Intergenic
1087538542 11:99484385-99484407 CTGGTGAGGATGTGGAGAGAAGG + Intronic
1087628921 11:100627850-100627872 CTGCTGAAGATGAGTGAAGCAGG - Intergenic
1087838256 11:102896421-102896443 CTGGAGAGGATGTGGGAAGAGGG - Intergenic
1087900776 11:103637977-103637999 CTGGTGCTGATGACAGAGGAAGG + Intergenic
1088818049 11:113434774-113434796 CTGGTGCTGATGGGGGGGGATGG - Intronic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1090164032 11:124527800-124527822 CTGGTGAGGATGTGGAAAAAAGG - Intergenic
1090267804 11:125364501-125364523 CTTGGGATGAAGAGGGATGAAGG - Intronic
1090345884 11:126070047-126070069 CAGGTGAGAATGAGGGAAAAGGG - Intergenic
1090441574 11:126729096-126729118 CTGCTAGAGATGAGGGAAGATGG - Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091408041 12:221122-221144 ATGTTGGTGATGAGGGAAGCTGG - Intronic
1091555351 12:1569341-1569363 GTGGGGTTGAAGAGGGAAGAAGG - Intronic
1091699391 12:2650235-2650257 CAGGAGATTATGAGGGAAGCAGG - Intronic
1092236966 12:6816388-6816410 CTGGTGGTGATGAGAGGTGAGGG + Exonic
1092292002 12:7165601-7165623 CTGATTAAGATGGGGGAAGAGGG + Intergenic
1092334176 12:7614434-7614456 CTGGTGAGGTTGAGGCAAAAAGG + Intergenic
1093240080 12:16659275-16659297 CTGGTGATGAGCAGGGCAGGTGG + Intergenic
1093246580 12:16745588-16745610 CTGGTGAGGATGAGGAAAAAAGG + Intergenic
1093824584 12:23668087-23668109 CTAGTGTTTATGAGGCAAGAGGG + Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1094002244 12:25707614-25707636 CTTGTGAAGCTGTGGGAAGAAGG + Intergenic
1094415637 12:30212187-30212209 CTGGTGAAGAGTAGGGGAGAGGG + Intergenic
1094822379 12:34236407-34236429 GTGGTGATGGTGATGGATGATGG - Intergenic
1095136808 12:38614983-38615005 CTGGTTTTGATGATGGAAAAGGG - Intergenic
1095277153 12:40299832-40299854 GTGGTGGTGGTGAGGGAAGAAGG + Intronic
1095487863 12:42703231-42703253 CTGGGGAGGCTGAGGGAACAAGG + Intergenic
1096256791 12:50067259-50067281 ATGGTGATGATGGGGGAAGAAGG - Intronic
1096613856 12:52820524-52820546 GTGGAGATGAAGAGGAAAGAAGG + Intergenic
1097331657 12:58338317-58338339 CTGGTGATTTTGATAGAAGAGGG - Intergenic
1097558123 12:61166277-61166299 CTGGTGGAGATGTGGAAAGAGGG - Intergenic
1099619668 12:84985629-84985651 TTGGTGATGTTGAAGGAAAATGG - Intergenic
1100712089 12:97268554-97268576 CTGGGGGTGATGGTGGAAGAAGG + Intergenic
1101032496 12:100674388-100674410 CTGCTGATGATGATGGATGATGG - Intergenic
1101788989 12:107911318-107911340 CTGATGATGAGGAGGGAGCAGGG + Intergenic
1101797489 12:107988870-107988892 CTGGTTAACATGAGGGAAAATGG + Intergenic
1101879839 12:108618657-108618679 CTGGGGGTGCTGATGGAAGAAGG - Intergenic
1102461230 12:113100786-113100808 ATGATGATGATGATGGTAGATGG - Intronic
1102622918 12:114210875-114210897 ATGGTGGTGATGATAGAAGAAGG + Intergenic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1104649608 12:130522244-130522266 CTAATGAGGATGAGGGAGGAAGG + Intronic
1105282208 13:18972831-18972853 TTGGTGATGATGTGGAAAAAAGG + Intergenic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105697749 13:22906551-22906573 CTAGAGATGATGAGAGAACAGGG + Intergenic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106323656 13:28666766-28666788 GTGGTGATAGTGATGGAAGATGG + Intronic
1106568304 13:30905934-30905956 CTGGTGTTGATTGGAGAAGAAGG - Intergenic
1106860388 13:33901047-33901069 CTGGTGAGGATGTGGAGAGAGGG + Intronic
1107083435 13:36399386-36399408 CTGGTGAGGATGTGGAAAAAAGG - Intergenic
1107174618 13:37386059-37386081 CTACTGAGTATGAGGGAAGAGGG - Intergenic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1108158138 13:47609645-47609667 CTGGTGAGGATGTGGAGAGAGGG + Intergenic
1108292066 13:48971921-48971943 TTGGTGATGAAGAGGAGAGATGG - Intergenic
1108328955 13:49365652-49365674 CTGGTGAGGATGTGGGGAAAAGG + Intronic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1108974537 13:56421880-56421902 TTCGTGATGATGAAAGAAGATGG + Intergenic
1111065550 13:83087399-83087421 CTTGTGATGATGTGAGAATAAGG - Intergenic
1111186152 13:84738435-84738457 CTGGATATGATGGAGGAAGATGG + Intergenic
1111479150 13:88799317-88799339 CTGGTGATGATATGGAAAAATGG - Intergenic
1111800038 13:92969902-92969924 CTGGTGAACATGTGGGAAGAAGG + Intergenic
1112471434 13:99693349-99693371 CTGGTGATTTTAAGGGAAGGAGG - Intronic
1112801573 13:103116353-103116375 CTGGTGAGGATGTGGAAAAAGGG - Intergenic
1113097178 13:106678320-106678342 CTGATGAAGATGAGGCAGGATGG + Intergenic
1113453747 13:110432376-110432398 GGGGTGAGGATGAGGGAAGGGGG + Intronic
1114244008 14:20895589-20895611 GTGGTGATGGAGAGGGCAGAGGG - Intergenic
1114247069 14:20924170-20924192 GTGGTGATGGAGAGGGCAGAGGG - Intergenic
1114251674 14:20967144-20967166 CTGGGAATGTTGGGGGAAGAAGG + Intergenic
1114713139 14:24798448-24798470 CTGGTCATGAAGAAGAAAGAAGG - Intergenic
1114733521 14:25019631-25019653 CTGAGGATGATGAGCAAAGATGG - Intronic
1114826887 14:26091613-26091635 CTGGTGAGGATGCGGGGAAAAGG + Intergenic
1115047393 14:29013000-29013022 CTGGTGAGGATGTGGAAAAAGGG + Intergenic
1115221640 14:31063996-31064018 CTGGTGGTCATGATGAAAGAAGG + Intronic
1115343333 14:32315935-32315957 CTGGTGAGGATGTGGAAAAAAGG - Intergenic
1116353641 14:43899166-43899188 TTAATGATGATGATGGAAGACGG + Intergenic
1117153773 14:52916520-52916542 GTGGTGGTGATGAGGAGAGAGGG + Intronic
1117440769 14:55757022-55757044 CTGGTGAGGACTAGGGAAAATGG + Intergenic
1117605721 14:57426849-57426871 CTGGTGAGGCTGTGGGAAAAAGG + Intergenic
1117881600 14:60318121-60318143 CTGGTGCTGTTATGGGAAGATGG - Intergenic
1118303664 14:64636655-64636677 CTGGTGATGCGCAGGGAAGGAGG + Intergenic
1118960122 14:70522134-70522156 GGAGTGATGATGAGGGAAGAAGG - Intergenic
1119435547 14:74595577-74595599 CTGGTGCTGCTGTGGGAGGATGG - Intronic
1120247881 14:82027559-82027581 CTGGTGGAGATGTGAGAAGAGGG - Intergenic
1120874918 14:89367156-89367178 CTGTTGAAAATTAGGGAAGATGG - Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1122461065 14:101895952-101895974 CTGGTGAGAATGTGGGGAGATGG - Intronic
1122680702 14:103459933-103459955 CTGGTGATGAATATGGAAAAGGG - Intronic
1123106650 14:105844947-105844969 CAGGTGAGGCTGAGGGCAGAGGG + Intergenic
1123992193 15:25691905-25691927 CTGGGGAAGATGGGGGAAAAAGG + Intronic
1124160916 15:27269058-27269080 CTGGCCAAGATGAAGGAAGAAGG - Intronic
1124475809 15:30033501-30033523 CCAGTGATGATGAGGACAGAGGG - Intergenic
1124637928 15:31376766-31376788 CCGGTGTCCATGAGGGAAGAGGG + Exonic
1124901325 15:33825649-33825671 CTGGGGATGGTGACTGAAGAAGG + Exonic
1125336527 15:38631910-38631932 CTGGTGATGATGAGTTGAGCTGG - Intergenic
1125911236 15:43441464-43441486 CTACTGGTGATGAGGGTAGATGG - Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126069231 15:44851253-44851275 CTGTTGACAATGAGGAAAGAAGG - Intergenic
1126385940 15:48093479-48093501 CTGAGGAAGATGAGGGAAGGGGG - Intergenic
1127174039 15:56335008-56335030 CTGGTGAGGATGAGGAGAAAAGG + Intronic
1127406356 15:58651882-58651904 CTGGTGAGGATGTGGGGAAAAGG - Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1127779540 15:62299195-62299217 CCGCAGATGATGAGGGAAGGAGG - Intergenic
1127849704 15:62901994-62902016 CTGGTAATAATGAGGGCAGTGGG - Intergenic
1128056408 15:64702978-64703000 CTGGAGCAGATGAGGGAGGATGG + Intronic
1128484126 15:68068395-68068417 CTGGTGATGTTTGTGGAAGAAGG + Intronic
1128569908 15:68726459-68726481 CCGGGGCTGCTGAGGGAAGAGGG - Exonic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129245407 15:74276178-74276200 CTGCTGGTGATGAGGCAAGGAGG + Intronic
1129317371 15:74753167-74753189 GTTGTGCTGAGGAGGGAAGAGGG - Exonic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129636067 15:77319537-77319559 CTTGTGATGATAATGGAAAAGGG + Intronic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130198699 15:81805425-81805447 ATGGTGATAAAGAGGAAAGATGG + Intergenic
1130617993 15:85431029-85431051 CTGGTGATAATGAGAGATAAAGG + Intronic
1130838102 15:87671679-87671701 ATGGTGATGAGGATGGAAGATGG - Intergenic
1131314700 15:91324422-91324444 CTGGTGAAGATGAGGAGAAAAGG - Intergenic
1131643498 15:94317329-94317351 TTGGTGATGATGAGGAGAGCCGG + Intronic
1131931375 15:97446303-97446325 CTGGGGATGATGAGAAAAGCTGG - Intergenic
1132006803 15:98234838-98234860 CTGCTGATAATGGGGGAAGTTGG - Intergenic
1132414450 15:101610478-101610500 CCTGTGCTAATGAGGGAAGAGGG + Intergenic
1134848812 16:17463578-17463600 CTGGTGAGGATGTGAGAAAATGG + Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136464754 16:30434851-30434873 CAGGTGATGGTGGGTGAAGATGG + Intergenic
1137793386 16:51194347-51194369 ATGGTGATGATGATGGCAGTAGG + Intergenic
1138609364 16:58110662-58110684 CCAGTGAGGCTGAGGGAAGAGGG - Intergenic
1138661214 16:58518460-58518482 CTGGAGATGGTAGGGGAAGAGGG + Exonic
1139023096 16:62776960-62776982 CTGGTGAGGATGTGGGGAAAGGG + Intergenic
1139389754 16:66599862-66599884 CTGGTGAGGATGTGGGGAGCTGG - Intergenic
1140127208 16:72128012-72128034 CTGCTTATGATGAGGGAGAAAGG + Intronic
1140249213 16:73280608-73280630 TTGGTGATGATGTGGAAAGAAGG + Intergenic
1140486628 16:75298785-75298807 CTGGAGGTGATAGGGGAAGAAGG - Intronic
1140673500 16:77303145-77303167 CTGGTGGAGATGAGGGGAGATGG - Intronic
1141362379 16:83407953-83407975 CTGGGAATGTTGTGGGAAGAGGG - Intronic
1141933621 16:87221702-87221724 GTGGTGATGATGATGGATGACGG - Intronic
1141933664 16:87221972-87221994 GTGGTGATGATGATGGATGATGG - Intronic
1142308104 16:89296917-89296939 CAGGTGCTGAGGAGGGATGAGGG - Intronic
1142376010 16:89707490-89707512 CTGGGGAGCATCAGGGAAGAGGG - Exonic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143410081 17:6703382-6703404 CTGGGGATGGTAAGGGAACACGG + Intronic
1143420779 17:6790247-6790269 CCAGAGATGATGAGGGAACAAGG + Intronic
1143550441 17:7627362-7627384 CAGGTGAAGATCAGTGAAGAAGG - Exonic
1143562324 17:7703413-7703435 CTGGTGATCATCAGGGATGCTGG - Exonic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144494291 17:15736905-15736927 CTGGGCAGGATGGGGGAAGATGG + Intronic
1144905974 17:18639771-18639793 CTGGGCAGGATGGGGGAAGATGG - Intronic
1145109030 17:20145482-20145504 CTCGTGATGACGAGGGGAGCTGG - Intronic
1146090946 17:29877229-29877251 CTGGTGAGGATGTGGAAAAAAGG + Intronic
1147630777 17:41930033-41930055 GTGGTGATGGTGAGGGAATGGGG + Intronic
1148359958 17:47003533-47003555 CTGGTGTTGAGCAGAGAAGATGG + Intronic
1149602272 17:57900631-57900653 ATGGTGATGATGATGGTGGAAGG - Intronic
1150687005 17:67328948-67328970 CTGGTGATTAGGAGGGGAGGTGG + Intergenic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1153356038 18:4136373-4136395 CTGGTGAGGATGTGGGGAAAAGG - Intronic
1153625120 18:7016034-7016056 CAGGAGATGCTGAGGGAAGCGGG + Intronic
1154296027 18:13149218-13149240 CTGGTGAGGATGTGGAAAAAGGG - Intergenic
1154513567 18:15135994-15136016 CTGGTGGAGCTGTGGGAAGAGGG - Intergenic
1155788639 18:29934799-29934821 CTGGGGAGGCTGAGGCAAGAAGG + Intergenic
1156591366 18:38492730-38492752 TTGGTGAGGATGTGGGAGGATGG + Intergenic
1156907657 18:42373497-42373519 CTTATAATCATGAGGGAAGAAGG + Intergenic
1157089429 18:44618897-44618919 CTGGTGAGGATGTGGCAAAAAGG + Intergenic
1157327919 18:46682144-46682166 ATGGTGATCATGTGGGCAGAGGG + Intronic
1158623449 18:59051791-59051813 CTGGTGATGCTGTAGGAAGGTGG + Intergenic
1158720663 18:59921520-59921542 GTGGTGGGGGTGAGGGAAGATGG + Intergenic
1159755423 18:72358249-72358271 CTTATGATGATGAAGGTAGATGG - Intergenic
1160005208 18:75064031-75064053 CAGGTGGTGGTGAGCGAAGAGGG + Exonic
1160109219 18:76009516-76009538 CTGGTGAGGTTGAGGGGAAAAGG - Intergenic
1160222954 18:76990471-76990493 CAGGGGATGGTGAGGGATGAGGG + Intronic
1160799757 19:962327-962349 CTGCTGCTGCTGAGGGGAGAGGG - Intronic
1160929146 19:1561491-1561513 CTGGTGGGGAGGAGGGAAGCTGG + Intronic
1161186135 19:2922096-2922118 CAGGAGATGGTGAGGGAAGCAGG - Intergenic
1161374644 19:3933297-3933319 CTGGCCAGGAGGAGGGAAGAGGG + Intronic
1163133362 19:15290790-15290812 CCTGTGTTTATGAGGGAAGAGGG - Intronic
1163224883 19:15952351-15952373 CTGGTGAGGATGAGGAGAAAAGG - Intergenic
1163586675 19:18168188-18168210 CTGGTGATGATGAGGGGCCTGGG + Intronic
1163850223 19:19658678-19658700 TTGGTGAAGATGAAGGGAGAGGG + Intronic
1164521296 19:28982197-28982219 CAGGTGAGGAGGAGGGAAGGAGG + Intergenic
1164588751 19:29494674-29494696 CGGGTGGTAAGGAGGGAAGAAGG + Intergenic
1165711161 19:38011951-38011973 CTGTGGAGGATGAGGGAAGGAGG + Intronic
1166355403 19:42224549-42224571 CTGGTGATGCTGGAAGAAGAGGG - Exonic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1167145117 19:47676615-47676637 CTGATGATGAAGAGGGAAGGCGG - Intronic
1168116117 19:54222166-54222188 CTGGGGATGATGTGGGAGGTGGG - Intronic
1168119100 19:54241914-54241936 CTGGGGATGATGTGGGAGGTGGG - Intronic
1168121888 19:54256377-54256399 CTGGGGATGATGTGGGAGGTCGG - Intronic
1168125352 19:54279683-54279705 CTGGGGATGATGTGGGAGGTGGG - Intronic
1168129935 19:54311752-54311774 CTGGGGATGATGTGGGAGGTGGG - Intronic
1168169131 19:54574673-54574695 CTGGGGATGATGTGGGAGGTGGG + Intronic
1168181236 19:54664128-54664150 CTGGGGATGATGTGGGAGGTGGG + Intronic
1168185446 19:54697154-54697176 CTGGGGATGATGTGGGAGGTGGG + Intronic
925251595 2:2443638-2443660 CTGGTGATAATGCAGCAAGAAGG - Intergenic
926044194 2:9697701-9697723 CAGGTGCTCATGAGTGAAGAGGG + Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926738995 2:16095547-16095569 CTGGTGATGCTTTGAGAAGATGG + Intergenic
926803412 2:16682751-16682773 CTAGTAAGGATGAGGGAAGGCGG + Intergenic
927611827 2:24548966-24548988 CTAGTGATGCTGTGAGAAGAGGG - Intronic
928388002 2:30885790-30885812 CTGATGGTGAAGAGGGAAGTTGG + Intergenic
928891454 2:36208383-36208405 TTGGTGAGGATGTGGAAAGAAGG - Intergenic
930086229 2:47499216-47499238 GTGGTGATGAGGAGGGGAGGTGG + Intronic
931945831 2:67306233-67306255 CTGGAGATGATTAGGTAAAAAGG - Intergenic
932368588 2:71169225-71169247 CCTGGGATGATGAGGGCAGAGGG - Intergenic
932430605 2:71671819-71671841 CTGGTCAGGAGGAAGGAAGAAGG + Intronic
932966286 2:76479077-76479099 CTGCTGATGATGGGGGAAGAGGG + Intergenic
933846688 2:86332543-86332565 CTGGGGAGAATGAGGGAAGGGGG - Intronic
934602526 2:95668709-95668731 CTGGTGATGCTGAGGGCAACAGG - Intergenic
934616427 2:95774189-95774211 CTTGTGATTATGAGGGAAGCTGG + Intergenic
934644466 2:96050371-96050393 CTTGTGATTATGAGGGAAGCTGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
934837882 2:97606461-97606483 CTTGTGATTATGAGGGAAGCTGG - Intergenic
934903063 2:98176322-98176344 GTGGTGATGATGAGGGAGGGAGG - Intronic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935286778 2:101571686-101571708 CTAGTGGTCATGAGGGCAGAAGG - Intergenic
936156868 2:110052662-110052684 GTGGTGATGATGTTGGATGATGG + Intergenic
936187826 2:110318782-110318804 GTGGTGATGATGTTGGATGATGG - Intergenic
936650767 2:114423473-114423495 CTGGTGAACCTCAGGGAAGAAGG + Intergenic
937280169 2:120712385-120712407 CTTCTGATGATGAGATAAGAAGG + Intergenic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
938067981 2:128292198-128292220 CTGGTGAAGGTGTGGGGAGAGGG + Intronic
938944397 2:136198495-136198517 CTGGTGAGGATGTGGGGAAAGGG - Intergenic
939030136 2:137064140-137064162 CTGGTGAGGATGTGGAAAAAAGG - Intronic
939086378 2:137723717-137723739 CTGGTGAGGATGTGGAAAAAAGG + Intergenic
940716245 2:157227821-157227843 CTGGTGATGATGTGGAGAAAAGG - Intergenic
940732679 2:157412002-157412024 CTGGTAATGAAGAGGAAAAAGGG - Intergenic
940975488 2:159938723-159938745 CTGGTAGTGTTGAGGGGAGAAGG - Exonic
941745677 2:169084473-169084495 CTGATGATGATGTGAGAAAAGGG - Intronic
943312666 2:186345842-186345864 CTGATGTTGATGAGTGATGAAGG - Intergenic
943536260 2:189154538-189154560 CTAGGGAGGGTGAGGGAAGAGGG - Intronic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
944884079 2:204044706-204044728 ATGGAGAGGATGAGGGAAAAAGG + Intergenic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
944922458 2:204429583-204429605 GTGGTGATAAGGAGGGAAGCAGG + Intergenic
946022868 2:216653637-216653659 CTGGAGATGAGGAAGGCAGATGG - Intronic
946815487 2:223573610-223573632 TTGGTGATGATGTGGGGAAATGG + Intergenic
946938921 2:224750867-224750889 CCGGTGGTGATGAGGCAAGATGG - Intergenic
947450646 2:230205312-230205334 TTGGTGATGATGAAGAAAGAAGG - Intronic
947665441 2:231902607-231902629 CTGGTTTTGAAGACGGAAGAAGG - Intergenic
948132099 2:235608447-235608469 CTGGAGATGCTCAGGGAAGGGGG + Intronic
948167510 2:235874385-235874407 CTGGTGATGTAGAAGGAAGTTGG + Intronic
949066165 2:241991547-241991569 CTGGCGAAGGTGAGGGAAGCAGG - Intergenic
1168951590 20:1805526-1805548 CTGGGGATGAGAAGGGAAGGTGG + Intergenic
1169501566 20:6165712-6165734 CTGGTCATGGTTAGGGAAGAGGG + Intergenic
1169511547 20:6269385-6269407 CTTGTGAAGCTGAGGGGAGACGG + Intergenic
1170111903 20:12813831-12813853 CTGGTGATGATGTGGAGAAAAGG + Intergenic
1171054647 20:21894630-21894652 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1171773758 20:29347294-29347316 TTGATGAAGATGAGTGAAGATGG - Intergenic
1171815770 20:29784843-29784865 TTGATGAAGATGAGTGAAGACGG - Intergenic
1171902596 20:30871194-30871216 TTGATGAAGATGAGTGAAGATGG + Intergenic
1172200510 20:33122819-33122841 CTAGTGATGCTGTGAGAAGAGGG + Intergenic
1172610457 20:36247483-36247505 CTGGAGTTGATGGGGGAAAACGG - Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174130816 20:48342188-48342210 GTGAGGATGACGAGGGAAGAAGG - Intergenic
1174254898 20:49247259-49247281 CAGGGGATGATGTAGGAAGATGG - Exonic
1174684869 20:52445016-52445038 CAGGTGATGTTGTGGGAAGAGGG - Intergenic
1174823657 20:53749302-53749324 ATGGTGATGATTAAGTAAGAAGG + Intergenic
1175012436 20:55753229-55753251 CATGTGATGATGCAGGAAGAAGG - Intergenic
1175029510 20:55938356-55938378 GTGTTGATGATGAGGGAGGTAGG - Intergenic
1175316959 20:58055181-58055203 ATGGTGAGAATGAGGGAACAGGG + Intergenic
1177616591 21:23529805-23529827 TTGGTGAAGATGTGGGAAAAAGG + Intergenic
1177761372 21:25406110-25406132 CTGGTGAGGATGTGGAAATAGGG + Intergenic
1177820595 21:26027158-26027180 CTTGCACTGATGAGGGAAGAGGG + Intronic
1178021575 21:28414490-28414512 CTGGTGAGGATGTGGATAGAAGG + Intergenic
1178121598 21:29475176-29475198 CTGGGGCTGATGAGGAATGAGGG + Intronic
1179634463 21:42698486-42698508 CTCGTGATGATGGGGGGAGGGGG + Intronic
1180319221 22:11305410-11305432 TTGATGAAGATGAGTGAAGACGG - Intergenic
1180335986 22:11577162-11577184 TTGATGAAGATGAGTGAAGATGG + Intergenic
1180641606 22:17303744-17303766 GTGGAGGTGATGAGGGAAGCTGG + Intergenic
1180744345 22:18077509-18077531 CTGGTGAGGATGAGGGACTTAGG - Intergenic
1181096935 22:20511777-20511799 CTTGTGCTGTTGGGGGAAGAAGG - Intronic
1181139764 22:20795959-20795981 CTGGTGGGGATCAGGGGAGAGGG - Intronic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1181537911 22:23556234-23556256 CTGGTGCTGATGAGGCTTGAAGG + Intergenic
1182310655 22:29403213-29403235 CTTGTGAGGATGATGGGAGAGGG + Intronic
1182690393 22:32157535-32157557 CTTGTGAGGATGATGGGAGAGGG - Intronic
1182904974 22:33927966-33927988 CTTGTGATCATGAGGAAACATGG - Intergenic
1183348110 22:37319042-37319064 ACGGTAAGGATGAGGGAAGAGGG + Intergenic
1183457956 22:37932953-37932975 CTGTTACTGATGAGGGAAGAGGG - Intronic
1184445436 22:44544408-44544430 CTGATGATGCAGAGGTAAGAGGG - Intergenic
1184720701 22:46311016-46311038 CTGGGGAGGATGAGGGAAAGGGG + Intronic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
949147630 3:721865-721887 CTGGTTTTGAAGATGGAAGAAGG + Intergenic
949480129 3:4485862-4485884 CTGGTGAGGAATAGGGTAGAGGG - Intergenic
949910965 3:8907706-8907728 AAGGGGATGATGCGGGAAGAAGG - Intronic
950634769 3:14307183-14307205 CAGGTGGTGCTGACGGAAGAGGG + Intergenic
950674566 3:14546811-14546833 CCGGTGAAGATGTGGGGAGATGG + Intergenic
950780933 3:15390992-15391014 AAGGGGATGATGCGGGAAGAAGG + Intronic
950936064 3:16840528-16840550 CTGGTGAGGATGCAGAAAGATGG + Intronic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951282307 3:20766960-20766982 CTGGTGAGGATTGGAGAAGAGGG - Intergenic
951839676 3:27021156-27021178 ATGGTGAGGATGATAGAAGATGG + Intergenic
951999794 3:28772345-28772367 CTGGTGGAGATGTGAGAAGAGGG + Intergenic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
952230449 3:31424217-31424239 ATGGTGATGCTGAGGGGATATGG + Intergenic
952769966 3:36990669-36990691 TGGGTGATGGGGAGGGAAGAGGG + Exonic
952849084 3:37713014-37713036 CTAGTGTTGATGAAGGACGAGGG + Intronic
953889611 3:46742539-46742561 CTTGTGAAGTTGAGGGCAGATGG - Exonic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954456207 3:50601109-50601131 CTGGTGACCTTGAGGGAAGTAGG - Intergenic
955006041 3:54969831-54969853 GCTGTGATGATGAGGTAAGACGG + Exonic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955221642 3:57027935-57027957 CCAGTGATGATGAGGGAAAAAGG - Intronic
955895450 3:63694763-63694785 CTGGTGATACTGAGGCAAAAAGG + Intergenic
957104160 3:75865607-75865629 CTGGGGGTGATGAGAGAAAATGG + Intergenic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957766859 3:84636761-84636783 CTGGTGAGGATGCAGGAAGAAGG - Intergenic
958568214 3:95843690-95843712 CTGGTGATGATGTGGAGAAAGGG + Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
958991379 3:100849631-100849653 CTGGACATGATGAAGAAAGATGG - Intronic
959563283 3:107807266-107807288 CTGGTGGGGATGGAGGAAGAAGG + Intronic
959578852 3:107963791-107963813 CTGGTGATTAGCAGGGGAGATGG + Intergenic
960056805 3:113281895-113281917 CTGGTGTGCATGATGGAAGAGGG - Intronic
960657184 3:120018058-120018080 TTTGTGATGATGAGTGATGATGG - Intronic
960841592 3:121964042-121964064 CTGGTGATGAGCAGGGAGGCTGG - Intergenic
960975499 3:123169880-123169902 CTGGTGACAGTTAGGGAAGAGGG - Intronic
961315883 3:126035350-126035372 CTGGTGATGAGGAGGGAAGGAGG + Intronic
961398804 3:126619070-126619092 CTGGTGAGGATGTGGAAAAAAGG + Intronic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
963325734 3:143861021-143861043 CTGCTGATGATGTGAGAAAAAGG - Intergenic
963850531 3:150206467-150206489 CAGGCAAGGATGAGGGAAGATGG - Intergenic
964223612 3:154372053-154372075 CTGCTGATGAGGGGCGAAGAAGG - Intronic
964262818 3:154859011-154859033 CTGGTGAGGATGTGGAAAAAAGG - Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
966570532 3:181437768-181437790 GTAGTGATGATGAGGGAACTGGG - Intergenic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
967701128 3:192593320-192593342 CGTATGATCATGAGGGAAGAGGG - Intronic
967750598 3:193110669-193110691 CTGGTGAGGATGTGGAGAGAGGG - Intergenic
967805999 3:193715095-193715117 CTGGTGGAGCTGGGGGAAGAGGG + Intergenic
967872876 3:194246734-194246756 CTGGTGATGGTGATGGTGGAGGG - Intergenic
968781876 4:2588511-2588533 CAGGTGATGGTGATGGATGAGGG + Intronic
969085748 4:4655195-4655217 CTGATGAGGAGGAGGCAAGAAGG + Intergenic
969542373 4:7800921-7800943 CTGGTGTTGATGTGGGACTATGG + Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
970326770 4:14933658-14933680 CTTGTGAGGCTGAGGCAAGAGGG + Intergenic
971650382 4:29263766-29263788 CTGGTGCTGGAGAGGGATGAGGG + Intergenic
971939304 4:33193579-33193601 GTGGTGATGATGAAGGCAGAAGG + Intergenic
971948714 4:33315540-33315562 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
972186075 4:36529734-36529756 CTGGTGATGATGAATGAGGTTGG + Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972671651 4:41217751-41217773 CTGGGGAGGCTGAGGCAAGAGGG + Intergenic
972691500 4:41403202-41403224 CTGGGGGTGGTGGGGGAAGATGG + Intronic
973611330 4:52638283-52638305 CTGGCCTTGAAGAGGGAAGAAGG + Intronic
973968905 4:56191327-56191349 CTGGTTTTGAAGAGGGAGGAAGG - Intronic
974352469 4:60767217-60767239 CTGGTGAGGATGTGGAGAGAAGG - Intergenic
975079984 4:70265552-70265574 CTGGTGAGGATGTGGAAAAAAGG + Intergenic
975244463 4:72103399-72103421 CTTGTGATGACACGGGAAGAAGG + Intronic
975424045 4:74205822-74205844 GTGGTGGTGATGGGGGAACAAGG + Intronic
975521964 4:75311091-75311113 CTAGTGAAGTTGTGGGAAGAGGG + Intergenic
975707788 4:77128134-77128156 ATGGGGATGGTGCGGGAAGAAGG + Intergenic
976071977 4:81251874-81251896 CTGGTGAGGATGTGGAAAAAAGG - Intergenic
977771650 4:100868094-100868116 CTGGTGATGCTCAGGGAAACAGG - Intronic
977780561 4:100976466-100976488 CATGTTATGATGAGGTAAGAAGG - Intergenic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978491482 4:109315809-109315831 ATGGTCATGCTAAGGGAAGAAGG - Intergenic
979452619 4:120890602-120890624 CTGGTGAGGTTGTGGGAAAAAGG - Intronic
979856159 4:125637034-125637056 CTGGTGGAGATGTGAGAAGAGGG - Intergenic
979892346 4:126114468-126114490 CTGGTGAGGATGAGGAGAAAGGG - Intergenic
980737635 4:136911966-136911988 CTTGTGTTGGTGAGGGAAGGCGG - Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981453330 4:144924722-144924744 CTGGTGAGGATGTGGAGAGAAGG - Intergenic
981469851 4:145120132-145120154 ATGGTGATGCTGGGGGAAAATGG + Exonic
981813203 4:148798891-148798913 TTGGTGATGAGGAGGGTAAAGGG + Intergenic
982259160 4:153479322-153479344 ATGGGGATGAAGAGGAAAGAGGG - Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982565030 4:156975310-156975332 CTGCTGAGGCTGAGGGTAGAGGG + Intergenic
982659591 4:158191216-158191238 ATGGTGATTATGTGGGAAGAAGG + Intergenic
983089495 4:163487104-163487126 CTAGTGATGCTGTGAGAAGAGGG - Intergenic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
986057484 5:4153116-4153138 TTGATGATGGTGAGGCAAGAAGG + Intergenic
986105812 5:4658373-4658395 CAGGTGAAGATCAGGGAAGGAGG + Intergenic
986693273 5:10331364-10331386 TTGGAGATGGTGAGGGAAGGAGG - Intergenic
987123788 5:14792406-14792428 CTGGTGATGATGGGACAGGAGGG + Intronic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
989111566 5:37911762-37911784 CTGGTGAGGATGTGGAGAGAAGG + Intergenic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989553707 5:42766271-42766293 CTGGTGAGGATGTGGAGAGAAGG + Intronic
989638160 5:43557300-43557322 CTGGGGGGGATGAGGGATGAGGG + Intronic
989705707 5:44327813-44327835 CTGGTGATGATGAAAGAGGAAGG - Intronic
989966906 5:50475404-50475426 CTGGTGAAGCTGTGAGAAGAAGG + Intergenic
991029046 5:62063481-62063503 CTGGTGATGATGATGGTAAAGGG + Intergenic
991354271 5:65751344-65751366 CTTGTGATGATGAGGGAAGATGG + Intronic
992012449 5:72542068-72542090 CTAGTGATGAGGTGGGGAGATGG + Intergenic
992553879 5:77884833-77884855 TTGATGCTGATGAGAGAAGAGGG + Intergenic
993204830 5:84865113-84865135 CTGGTGATGGAGAGGGGAGAGGG - Intergenic
993341054 5:86725539-86725561 CTGGTGAGGATGAGAGAAACAGG - Intergenic
994045222 5:95301386-95301408 CTGGTGAGGATGAGGAGAAACGG - Intergenic
994777417 5:104051597-104051619 CTGATGATGATGATGGAGGTGGG - Intergenic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
995678298 5:114688235-114688257 ATGATGATGATGGGGGAGGACGG - Intergenic
996273304 5:121635119-121635141 TGGGTGATTATGGGGGAAGATGG + Intergenic
998031342 5:138871546-138871568 CTGCTGCTGAAAAGGGAAGAGGG - Exonic
998163653 5:139828044-139828066 CTGGTGATGATGGGTGATGACGG + Intronic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
998714785 5:144870522-144870544 GTGATTAGGATGAGGGAAGATGG + Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999495029 5:152088531-152088553 CTGGAGTTGATGTGGCAAGATGG + Intergenic
999589569 5:153130360-153130382 TTGGTGAGGAAAAGGGAAGATGG - Intergenic
1000049756 5:157552231-157552253 CTGGTGAGGATGTGGGGAAAAGG + Intronic
1000953779 5:167517837-167517859 CTGGTGATGAGGGGGGTTGATGG + Intronic
1001961216 5:175881146-175881168 GTGGGGATGGTGAGGGAAGAGGG + Exonic
1002607545 5:180391914-180391936 ATGGTGATGATGATGTAATAAGG - Intergenic
1003032067 6:2610216-2610238 GTGGTGATGATGTGTGAATATGG - Intergenic
1004909374 6:20268228-20268250 CTGGTGGTGAGAAGAGAAGAAGG + Intergenic
1005309980 6:24549818-24549840 ATGGTAATGACGAGGAAAGAGGG + Intronic
1005511290 6:26513820-26513842 CTGCTATTGATTAGGGAAGAGGG - Intergenic
1005864867 6:29929573-29929595 CAGGTCAGCATGAGGGAAGAGGG - Intergenic
1007187019 6:39980551-39980573 CTGCTGATAGTGAGGGGAGACGG + Intergenic
1007307134 6:40915838-40915860 CTGGTGATGATGGTGGCTGAGGG - Intergenic
1008173256 6:48234827-48234849 CTGGTGATGAGCAGGGAGGGTGG - Intergenic
1008211476 6:48729751-48729773 CTGGTGATGATCAGGGTGGGTGG - Intergenic
1010174503 6:73011975-73011997 TTGGTGAGGATGTGGGAAAATGG + Intronic
1010346895 6:74821713-74821735 CTGGAGAGGATGAGGAAAAAGGG + Intergenic
1010594554 6:77748155-77748177 CTAGTGAAGCTGAGAGAAGAGGG - Intronic
1010839315 6:80629505-80629527 CTGGTGAGGATGTGGAAAAAGGG + Intergenic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1011696084 6:89914130-89914152 CTGGTGAGGATGTGGAAAAAAGG - Intergenic
1012130535 6:95485670-95485692 CTGATGAGGATGTGGGAAAAAGG + Intergenic
1012172844 6:96041004-96041026 CAGCTGATGATGAGGAAAGGGGG - Intronic
1012706137 6:102534224-102534246 CTGGTGAGAATGTGGGAAAAAGG + Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1014801037 6:125778177-125778199 TTGGTGATAATTAGGGTAGAAGG - Intergenic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016809580 6:148247006-148247028 CTGCTGAAAATAAGGGAAGAAGG + Intergenic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1017860521 6:158393370-158393392 CTGGTGAAGCTGTGAGAAGAGGG - Intronic
1018258174 6:161942923-161942945 AAGATGATGATTAGGGAAGATGG + Intronic
1018566810 6:165163180-165163202 CAGGGCATGATGATGGAAGAAGG + Intergenic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1019353778 7:568535-568557 CTGATGATGTTGAGTGAAGCCGG - Intronic
1019422947 7:959456-959478 CCGGTGAGGATGGGGGAAGCTGG + Intronic
1019454048 7:1115448-1115470 TTGGTGATGAGGAGGGTGGATGG - Intronic
1019812185 7:3172930-3172952 CTGCTCATGATGATGGCAGAAGG + Intronic
1020661050 7:10982972-10982994 ATGATGAAGATGAGGGAAGCGGG + Exonic
1022274648 7:28843283-28843305 CTGTAGATGATGGAGGAAGATGG - Intergenic
1023660576 7:42467366-42467388 CTGGGGAAGATGAGTTAAGAAGG - Intergenic
1024855608 7:53774992-53775014 CAGGTGATGATGCAGGAACAAGG + Intergenic
1024961823 7:54984621-54984643 CTGGTGAGGATGCGGGGAAAAGG - Intergenic
1025228676 7:57184266-57184288 CTGGTCTTGAAGACGGAAGAAGG + Intergenic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1026972350 7:74476079-74476101 CTGGTGGTGGTGAGGGATGGGGG + Intronic
1029412457 7:100423647-100423669 TTGGTGATGATGAGTTAAAATGG - Intronic
1029449724 7:100634018-100634040 CTGGTGGTGATGGGAGAAAATGG - Intronic
1029788456 7:102817240-102817262 CTGGTGAGGATGTGGAAAAAAGG - Intronic
1030370039 7:108688822-108688844 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1030408898 7:109149243-109149265 CTGGTGAGAATGAGGAAAAAGGG - Intergenic
1031534352 7:122915061-122915083 CTGATAATGAGAAGGGAAGATGG + Intergenic
1031608266 7:123794843-123794865 CTGGTGAAGCTGTGAGAAGAGGG + Intergenic
1031723457 7:125206819-125206841 CTGGTGATTAGGCAGGAAGATGG + Intergenic
1031759007 7:125686787-125686809 CTGGTGAAGATGTGGAGAGAAGG + Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032116184 7:129119364-129119386 CTGGTGAGGATGTGGAAAAATGG - Intergenic
1032936941 7:136743945-136743967 CTTGTGCTGCTGAGTGAAGAAGG - Intergenic
1033772088 7:144564011-144564033 CTGGCACTGCTGAGGGAAGAAGG + Intronic
1034698215 7:153073922-153073944 CTGGTGGTGATAAGGGATGCTGG + Intergenic
1035013754 7:155744965-155744987 CTGATGAAGATGAGGAAACAAGG + Exonic
1035577566 8:717565-717587 CTGGTGATGAGCAGAGGAGATGG + Intronic
1036122403 8:6032738-6032760 CATGTTATGATGTGGGAAGAAGG - Intergenic
1036940956 8:13051300-13051322 CTAGTGGTCATGATGGAAGAGGG + Intergenic
1038698205 8:29825232-29825254 CCAGTGAGGATAAGGGAAGAAGG - Intergenic
1039062892 8:33585776-33585798 CTGGAGGTGATAAGGGAAGAAGG + Intergenic
1039637677 8:39183548-39183570 TGAGTGATGATGAGGAAAGATGG - Intronic
1041655994 8:60351173-60351195 TGAGTGATGATGTGGGAAGAGGG - Intergenic
1041656571 8:60356901-60356923 GTGGTGGAGATGGGGGAAGAAGG + Intergenic
1042018442 8:64343286-64343308 CTGATGATGATCAGGGAATGGGG - Intergenic
1042032893 8:64496498-64496520 CTGGTGAGGATGTGGAAAGAAGG + Intergenic
1043015485 8:74934881-74934903 CTGGTGAGGATGTGGGGAAAAGG - Intergenic
1043523796 8:81074313-81074335 GTGAGGATCATGAGGGAAGAGGG + Intronic
1044301006 8:90582806-90582828 CAGCTGTTGATGAGGGAAAAAGG - Intergenic
1044647935 8:94464306-94464328 CTGGCTATGAAGACGGAAGAAGG + Intronic
1046085423 8:109428059-109428081 CTGGTGATGATGAGAGTGCAAGG + Intronic
1046276939 8:111973910-111973932 CTGGTGAAGATGTGGGAAAGAGG + Intergenic
1046589971 8:116194470-116194492 CTGGCCATCATGAGGGAAGGGGG - Intergenic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047152489 8:122279923-122279945 CTGGGAAGGATGGGGGAAGAAGG + Intergenic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047219993 8:122911382-122911404 CACTTGATGATGGGGGAAGAGGG - Intronic
1047403498 8:124565686-124565708 ATGGTGGTGCTGGGGGAAGAGGG + Exonic
1048210532 8:132450791-132450813 ACGGTGATGATGAGGAAAGGAGG - Intronic
1048661690 8:136610941-136610963 CATGTGAGGATGAGGCAAGAAGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048949495 8:139483593-139483615 CAGGTGATGATGAGAGAAACAGG - Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049522846 8:143103207-143103229 CAGGTGATTACGAGGGGAGAGGG - Intergenic
1049867034 8:144946015-144946037 CTGCTGATAGTGAGGGCAGATGG + Exonic
1051515053 9:17921263-17921285 CTGGTGCTGTTGAAAGAAGAGGG - Intergenic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1051971552 9:22893791-22893813 CTGGAGTTGATGATGGATGAAGG - Intergenic
1052342265 9:27375365-27375387 CTGGGGATGATGAAGGCACATGG + Intronic
1052609307 9:30750319-30750341 CTGGTTATGAGCAGGGCAGAGGG + Intergenic
1052844250 9:33321152-33321174 CTGTTGGTGATGAGAGAAGAAGG + Intronic
1052876126 9:33565878-33565900 GGAATGATGATGAGGGAAGAGGG + Intronic
1053499888 9:38578467-38578489 GGAATGATGATGAGGGAAGAGGG - Intergenic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1055945083 9:81686845-81686867 TTGGTGATGGTGAGGGAGGTGGG - Intronic
1057237076 9:93369954-93369976 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1057679312 9:97163165-97163187 GGAATGATGATGAGGGAAGAGGG - Intergenic
1057876072 9:98755496-98755518 GCGGGAATGATGAGGGAAGATGG - Intronic
1057926389 9:99154649-99154671 CTGGTTTTGATGATGGAGGAGGG - Intergenic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058540049 9:106002464-106002486 GTGGTGCTGATGAGGGATCATGG + Intergenic
1059821953 9:117983390-117983412 CAGATGGTGATGAGGGCAGAGGG + Intergenic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1061244082 9:129392347-129392369 CTGGTGCTGATGAGGCTTGAAGG - Intergenic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061752932 9:132793188-132793210 CAGGTGAGGATGAAGCAAGAAGG - Intronic
1061805950 9:133137890-133137912 CTGGTGAGGATGGGGGATGGGGG + Intronic
1062229375 9:135472934-135472956 CTGGTGGTCATGAAGGGAGATGG - Intergenic
1062296786 9:135834902-135834924 CTGGTGACCGCGAGGGAAGATGG - Intronic
1203367448 Un_KI270442v1:271159-271181 TTGATGAAGATGAGTGAAGACGG - Intergenic
1186054402 X:5633390-5633412 CTGTTGATGATGATGGCAGTGGG - Intergenic
1186131967 X:6477669-6477691 CTGGTGAGGATGTGGAAAAAGGG - Intergenic
1186238186 X:7536422-7536444 CTGGCGAGGATGTGGGAAAAAGG - Intergenic
1186310006 X:8307570-8307592 CTGGTGAGGATGTGGAAAAAAGG + Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186844489 X:13517242-13517264 CAGGAGACCATGAGGGAAGAGGG + Intergenic
1187346985 X:18474438-18474460 TTGTTGAGGATGAGGGAAAATGG - Intronic
1188140537 X:26545096-26545118 CTGCTGATGATAAGTAAAGAAGG + Intergenic
1188265782 X:28072259-28072281 CTGGCGATGATGTGGAGAGATGG + Intergenic
1188831626 X:34905383-34905405 CTGGTGATGATGTGGAGAAAGGG + Intergenic
1189238437 X:39506991-39507013 GAGCTGATAATGAGGGAAGAGGG + Intergenic
1189541080 X:41990356-41990378 CTGGTGAGGATGTGGAAAAAGGG - Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1190462707 X:50694342-50694364 CTGGTAAGGATGTGGGAAAATGG - Intronic
1193761222 X:85468631-85468653 CTGGTGAGGATGTGGCAAAAAGG + Intergenic
1193877922 X:86884803-86884825 CTGGTGAGGATGTGGAAAAAAGG + Intergenic
1193957473 X:87879707-87879729 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1193960993 X:87924602-87924624 CTGGTGATGAACAGGGAAACAGG - Intergenic
1194431932 X:93819026-93819048 CTGGTGATGATGAGGAGAAAAGG + Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195583584 X:106535994-106536016 CTGGCTTTGATGATGGAAGAAGG + Intergenic
1195592237 X:106642885-106642907 CTGGTGATGATGTGGAGAAAAGG - Intronic
1195630265 X:107048653-107048675 CAGGTGGTGATGAGACAAGATGG + Intergenic
1196254579 X:113501327-113501349 CTGGTGAGGATGTGGAAAAAAGG - Intergenic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1196581075 X:117379745-117379767 CATGTGATGATGTGGAAAGAAGG - Intergenic
1196630438 X:117932847-117932869 CTGGTGATGATGTGGAGAAAAGG - Intronic
1197518303 X:127464671-127464693 CTGGTGAAGATGTGGAAAAAAGG + Intergenic
1197926584 X:131653098-131653120 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1198872855 X:141194062-141194084 CTAGTGAAGATGTGAGAAGAGGG + Intergenic
1198931174 X:141862290-141862312 CTGGTGAGGATGTGGGAAAAAGG + Intronic
1199066122 X:143420624-143420646 TTGGTGAGGATGAGGAAAAAAGG - Intergenic
1199074024 X:143510038-143510060 CTGGAGAAGATGAGAGAATAGGG - Intronic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic
1200298497 X:154947391-154947413 CTGGTGAGGATGTGGCAAAAGGG + Intronic
1200397380 X:155999137-155999159 CCTGTGATGGGGAGGGAAGATGG + Intronic
1200687684 Y:6271929-6271951 CTGGTGAGGATGAGGAGAAAAGG - Intergenic
1201047586 Y:9902774-9902796 CTGGTGAGGATGAGGAGAAAAGG + Intergenic
1201226467 Y:11823562-11823584 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
1201931515 Y:19354669-19354691 CTGGTGGAGCTGTGGGAAGAGGG - Intergenic