ID: 977797050

View in Genome Browser
Species Human (GRCh38)
Location 4:101178930-101178952
Sequence CTGCTGACTAAGAGTGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977797050_977797052 0 Left 977797050 4:101178930-101178952 CCCTGGTCACTCTTAGTCAGCAG 0: 1
1: 0
2: 1
3: 18
4: 139
Right 977797052 4:101178953-101178975 ATAATTATTTCTATGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977797050 Original CRISPR CTGCTGACTAAGAGTGACCA GGG (reversed) Intronic
900730815 1:4258396-4258418 GTGCTGACTAAAAGGGACCAAGG + Intergenic
904289568 1:29475432-29475454 CTCCTGACCAAGAGTGTCCGAGG - Intergenic
906914577 1:49994979-49995001 CTGGGGACCAAGAGTGCCCACGG - Intronic
909772451 1:79440947-79440969 ATGCTAACTAACAGTGACCATGG - Intergenic
910095715 1:83519442-83519464 CTGCTGACAATGAGGGGCCAGGG + Intergenic
912006662 1:104911486-104911508 CTGGTGACCAAGAGTGACCAAGG + Intergenic
915315885 1:155029082-155029104 CTGCTGAGTAACAGTGACATGGG + Intronic
916573292 1:166045820-166045842 CTTCTCACTCAGAGTGAGCAGGG - Intergenic
917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG + Exonic
922940681 1:229462678-229462700 CTCCTGAATAAGTGTGGCCATGG + Intronic
923281412 1:232446291-232446313 CTGCTGAGTAACTGTGAACAAGG - Intronic
924946715 1:248851391-248851413 CTGCTGCCACACAGTGACCATGG - Intronic
1062939106 10:1408769-1408791 CTGTGGACTGAGAGAGACCACGG + Intronic
1063056364 10:2509202-2509224 CTGCTGACTCAGAGGGTCCAGGG + Intergenic
1063309832 10:4941682-4941704 TTGCTGACTCACAGTGACTAGGG - Intronic
1063317457 10:5020420-5020442 TTGCTGACTCACAGTGACTAGGG + Intronic
1063456286 10:6184956-6184978 CTGATGGCTAAGTCTGACCATGG - Intronic
1067717281 10:48699226-48699248 CTGCTGTCTCAGAGTGGCTATGG - Intronic
1071127402 10:82351193-82351215 CTACTTACTAAGAGTTAACACGG - Intronic
1071703698 10:87972862-87972884 CTGCTGACTAACAGTGGCATTGG + Intergenic
1074299744 10:112223000-112223022 CTGCTGACCAGGAGTGGCCTGGG - Intergenic
1080463308 11:32474504-32474526 CTGCTGATTCAGAATGACTAGGG + Intergenic
1081413321 11:42785238-42785260 CTGGGGGCAAAGAGTGACCAGGG + Intergenic
1085350611 11:75795942-75795964 CTCCAGTCTAAGAGTGACAAGGG + Intronic
1095501203 12:42840156-42840178 CTGGGGACTAAGAGTGCCTACGG + Intergenic
1097408082 12:59215825-59215847 ATGATGAGTAAGAGTGAGCAAGG + Intergenic
1098636657 12:72792506-72792528 TTGATGACTAAGAGTGAAAAAGG - Intergenic
1099218655 12:79884902-79884924 CTGCTAACAAAGAGTTAACAAGG + Intronic
1099798354 12:87426085-87426107 CTGGTGACTAAGGATGACTAAGG - Intergenic
1101326656 12:103721635-103721657 ATGCTGACCAAGAAAGACCAGGG + Intronic
1102438001 12:112940232-112940254 CTGCTGACAAAGTGGGAACAGGG - Intronic
1103820782 12:123696625-123696647 CTGCTGAATAACAGTGATGATGG + Intronic
1104423459 12:128655976-128655998 CTGATGACTAATAGTGGTCATGG - Intronic
1105225886 13:18431204-18431226 CAGGTGACTAAGAATGACTAAGG - Intergenic
1107716040 13:43200308-43200330 GTGCAGACTCAGAGTGGCCAAGG + Intergenic
1109783475 13:67143496-67143518 CTTCTGAGTAAAAGTGAACAAGG - Intronic
1118970862 14:70636374-70636396 CAGATGACTAAGAATGACTAAGG + Intergenic
1119617987 14:76111469-76111491 CTGCTGAGTCAGAATGGCCAGGG + Intergenic
1121616134 14:95315027-95315049 CTGCTGGATAACGGTGACCATGG + Intronic
1122033773 14:98932983-98933005 CTGCTGATGAAGAATGCCCAGGG - Intergenic
1122282929 14:100634853-100634875 CTGCTGACTGAGGGTCAGCAAGG + Intergenic
1122283714 14:100638830-100638852 CTGGAGACAAACAGTGACCAAGG - Intergenic
1124497717 15:30196401-30196423 CGGCTGACTGAGGGCGACCATGG - Intergenic
1124745869 15:32342290-32342312 CGGCTGACTGAGGGCGACCATGG + Intergenic
1125005685 15:34814033-34814055 CTGCTGAAGAAGAGTGTCCGTGG + Intergenic
1126884150 15:53131385-53131407 CTGCTGAGAAAGATGGACCAAGG - Intergenic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1132186746 15:99807134-99807156 CCGCTGACTGAGGGCGACCATGG - Intergenic
1132428941 15:101745577-101745599 CCGCTGACTGAGGGCGACCATGG + Intronic
1133239976 16:4408440-4408462 CTGCTGACCCAGGGTGGCCAAGG + Intronic
1133742987 16:8665375-8665397 CTCCTGACTTGGAGTCACCAGGG - Intergenic
1136132886 16:28235104-28235126 CTGCTGAGAAAGGGGGACCAAGG + Intergenic
1142132077 16:88435735-88435757 CTGGGGACCAAGAGAGACCAAGG + Exonic
1145230188 17:21168325-21168347 CTGCTAACAAAGAATGACCATGG - Intronic
1147981860 17:44279861-44279883 CAGCCGACTAAGACTGACCTTGG + Intergenic
1148907436 17:50920150-50920172 CTGCTGCCTAAGAATCACCTGGG + Intergenic
1150489391 17:65563878-65563900 CTGGTGGCTAAGAGGGTCCATGG - Intronic
1151179635 17:72317602-72317624 CTTCTGACTCAGAGTGAGGAGGG + Intergenic
1152631413 17:81412193-81412215 CTGCTGGCCTGGAGTGACCAGGG - Intronic
1154527491 18:15308315-15308337 CAGGTGACTAAGAATGACTAAGG + Intergenic
1156069407 18:33188027-33188049 TTGCTGGCTAAGAGTGACCTGGG + Intronic
1160734993 19:658349-658371 CAGATGACTGACAGTGACCAGGG + Intronic
1167026063 19:46919267-46919289 GTCCTGACTAAGTGTGACGAAGG + Exonic
924999380 2:392892-392914 CAGCTGCCCAAGAGTGAGCAGGG - Intergenic
925357649 2:3253393-3253415 GAGCTGAATATGAGTGACCACGG - Intronic
929876408 2:45800473-45800495 CTGCTGACTAAAACTGCCCTTGG - Intronic
931213748 2:60222498-60222520 CTGTTGACTAGGAGTGCCCATGG - Intergenic
932695303 2:73951323-73951345 CTGCTGACTGGTAGTGACCTTGG + Intronic
933838360 2:86264294-86264316 CTGCGGACCAAGAGTGACCCAGG + Intronic
937049245 2:118875190-118875212 CTGCTGTTTAAGAGTGGCAAGGG + Intergenic
938526586 2:132139773-132139795 CAGGTGACTAAGAATGACTAAGG + Intergenic
939756562 2:146119535-146119557 CTTCTGACAAAGAGTAGCCACGG - Intergenic
943757031 2:191567631-191567653 CTGCTGACTTAGAATGATCCTGG - Intergenic
946634160 2:221706144-221706166 CTGCTTTCTAACAGAGACCATGG - Intergenic
947569199 2:231218028-231218050 CTGTTGAGTGAGAGTGACCTGGG - Intronic
947750004 2:232526945-232526967 CTCCTGACTGCGAGTGATCAGGG + Intronic
948828853 2:240587580-240587602 CTGCTGAATAAGACTGCCCAGGG + Intronic
1172960526 20:38795948-38795970 CTGCTGAATCAGAATGGCCAAGG + Intergenic
1173157590 20:40627688-40627710 CTACTGACTTAGGGTGAGCAGGG + Intergenic
1176255820 20:64152414-64152436 CTGCAGACTCAGAGGGTCCAAGG + Intronic
1183578786 22:38709953-38709975 TTGCTAACTAGGAGTGACCAGGG - Intronic
1184893393 22:47393079-47393101 ATGCTGACTGAGAGTGAGCCAGG + Intergenic
949549365 3:5099528-5099550 TTGTTACCTAAGAGTGACCAGGG + Intergenic
950638002 3:14329634-14329656 CTGCTGACTCAGAGGAACAAGGG + Intergenic
950835771 3:15917806-15917828 CTGCTGACACAGGGTGACCTTGG - Intergenic
955645206 3:61130221-61130243 CTGCTACCTAAGAATGTCCAGGG + Intronic
955761103 3:62283620-62283642 CTGCTGACCAAGAGCTACCTTGG - Intronic
957268256 3:77995650-77995672 CTGGTGGATAAGAGTGGCCACGG - Intergenic
957901918 3:86505450-86505472 CTGATGGCCAAGAGTGGCCATGG - Intergenic
959104979 3:102055231-102055253 CTGTTGACTAAGAATAAACAGGG + Intergenic
962846650 3:139279475-139279497 CTGCTGATGAAGAGTGCCCAGGG + Intronic
967522708 3:190453239-190453261 CTGCTGATTATTAGTGACCAAGG - Intergenic
971175524 4:24278898-24278920 CTGGTGAGTAAGAGTGACCTAGG - Intergenic
971481953 4:27122910-27122932 GAGCTGAATATGAGTGACCATGG - Intergenic
973863863 4:55092443-55092465 CTGCTGAGTAAGAGTGGTTAAGG - Intronic
975126563 4:70788903-70788925 CTGCTGCCGAAGAGATACCAGGG - Exonic
977797050 4:101178930-101178952 CTGCTGACTAAGAGTGACCAGGG - Intronic
980735169 4:136875917-136875939 CTGCTGATTATTGGTGACCATGG + Intergenic
983729973 4:170980419-170980441 ATGCTGAGTAAGAGTGATGAAGG + Intergenic
990968005 5:61470840-61470862 TTGCTGACTAAGAATGATCAAGG + Intronic
995006338 5:107200427-107200449 CTCCTGAGAAAGAGTGAACAAGG + Intergenic
998179494 5:139926563-139926585 CTGCTGAGTAAGAATGAGCAGGG + Intronic
998934194 5:147216641-147216663 CAGCAGTCTAAGAGTGACCTGGG + Intergenic
998987527 5:147777131-147777153 CAGCAGACAAAGAATGACCAAGG + Intronic
1004313527 6:14566301-14566323 CTAATGACTAAGAAAGACCATGG + Intergenic
1006612491 6:35302741-35302763 CTACTGACTCAGAGTTTCCAGGG - Intronic
1008254979 6:49287072-49287094 CTGCTCACTAACAGTGAACCTGG - Intergenic
1016166844 6:140956340-140956362 CTTCTGGATAACAGTGACCATGG - Intergenic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016776122 6:147906576-147906598 CTGCTGACTAAGCATCAACAGGG - Intergenic
1017941276 6:159055431-159055453 CTGGGGTCTAGGAGTGACCAAGG + Intergenic
1018296810 6:162356169-162356191 CTGCTAAGTAGTAGTGACCAAGG - Intronic
1018807471 6:167272468-167272490 GAGCTGAGTATGAGTGACCATGG + Intronic
1020110857 7:5446993-5447015 CTGCTGACCAGGAATGGCCAAGG + Intronic
1020745639 7:12075068-12075090 CAGGTGACTAAGGGTGACTAAGG - Intergenic
1021114727 7:16734572-16734594 TTGATGACTAAGTGTGAGCATGG + Intergenic
1021791777 7:24213240-24213262 CTGCTGCCTCAGAATCACCAAGG + Intergenic
1023189909 7:37569413-37569435 CTGCACACCAAAAGTGACCAAGG + Intergenic
1023578128 7:41651992-41652014 CTGCTTCCTAAAACTGACCATGG - Intergenic
1024587316 7:50853453-50853475 CTGCTGGCCAAGAGTGCCCCAGG + Intergenic
1024705010 7:51947538-51947560 CTGCTGAGTTAGAGTGGTCAAGG + Intergenic
1025242247 7:57286914-57286936 CTCATTACTAAGAGTGAACATGG - Intergenic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026167064 7:67919667-67919689 CTCATTACTAAGAGTGAACATGG - Intergenic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1030841297 7:114357648-114357670 CTGCTCACTGAGAGTGATGAAGG - Intronic
1033046099 7:137963270-137963292 GTGCTGACTAAGTGGGAACAGGG - Intronic
1034549829 7:151813399-151813421 CTGGTGATTAGGAGTGACCTGGG - Intronic
1036188669 8:6649097-6649119 CAGGTGACTAAGGGTGACTAAGG + Intergenic
1036188677 8:6649174-6649196 CAGGTGACTAAGAATGACTAAGG + Intergenic
1036188694 8:6649366-6649388 CAGGTGACTAAGGGTGACTAAGG + Intergenic
1036654400 8:10667598-10667620 CTACCTACTAAGAATGACCAAGG - Intronic
1037760825 8:21740417-21740439 CTTCTGTGTAAGAGTCACCAAGG + Intronic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1039318118 8:36395536-36395558 CTGCTGACTATGTGTAACCTTGG + Intergenic
1041534028 8:58905501-58905523 ATGCTGTCAGAGAGTGACCATGG + Intronic
1045807913 8:106187022-106187044 CTCCTGATTTAGAGTGACAAAGG + Intergenic
1049990037 9:981838-981860 CTGCTTCCTGACAGTGACCAAGG - Intronic
1052578335 9:30319624-30319646 CTTCTGACTGACAATGACCAGGG - Intergenic
1053354374 9:37433805-37433827 CTCCAGACTAAGAGTGATCAGGG + Intronic
1054806756 9:69403155-69403177 CTGCTACCTTAGAGTGACCATGG + Intergenic
1055351224 9:75390466-75390488 CTCCTTATTAAGAGTAACCAAGG + Intergenic
1057604671 9:96490363-96490385 CTGCTTCCTAAGAGTCTCCATGG - Exonic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061289896 9:129644736-129644758 CTGCAGACTACGAGGGCCCACGG + Intergenic
1061760411 9:132847293-132847315 TTGCTGACTAAGACAGACCGTGG + Intronic
1062492200 9:136811121-136811143 GAGCTGAATATGAGTGACCATGG + Intronic
1186428815 X:9486762-9486784 GAGCTGAATATGAGTGACCATGG - Intronic
1187430080 X:19214580-19214602 CTGATGACTAAGAGCAAGCAGGG - Intergenic
1188434117 X:30140947-30140969 CTGCTGACCCACAGTGACCTTGG - Intergenic
1189005643 X:36991589-36991611 CAGCTGGCTAAGTGCGACCATGG - Intergenic
1189662922 X:43322348-43322370 CTGCACACCAACAGTGACCAAGG - Intergenic
1190321490 X:49182468-49182490 CTGCTGGCGCAGAGTGAGCAAGG - Intronic
1192754428 X:74031811-74031833 CTGCTGCTGAAAAGTGACCAAGG + Intergenic
1194104576 X:89753093-89753115 GAGCTGAATATGAGTGACCATGG + Intergenic
1194758234 X:97763083-97763105 CTCATGACAAGGAGTGACCAAGG + Intergenic
1198041374 X:132856186-132856208 TTCCTGACTGTGAGTGACCATGG - Intronic
1199310876 X:146318100-146318122 CTGCTGACCCACAGAGACCATGG - Intergenic
1201583115 Y:15532014-15532036 CTGCTGGCTAGCAGTGAGCAAGG + Intergenic