ID: 977798456

View in Genome Browser
Species Human (GRCh38)
Location 4:101196709-101196731
Sequence CTGATCTTTCACTTTTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977798456_977798461 -1 Left 977798456 4:101196709-101196731 CCTCCTTAAAAGTGAAAGATCAG 0: 1
1: 0
2: 1
3: 13
4: 216
Right 977798461 4:101196731-101196753 GGATGTCAGGGACGAGATACAGG 0: 1
1: 0
2: 0
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977798456 Original CRISPR CTGATCTTTCACTTTTAAGG AGG (reversed) Intronic
900990310 1:6095614-6095636 CTGTTCCTTCACCTTCAAGGAGG - Exonic
903957496 1:27035391-27035413 CTGACCTTTCCCTCTAAAGGGGG + Intergenic
905984717 1:42269283-42269305 CTCATCTTGAACTTTTAAGCTGG - Intronic
906167494 1:43697742-43697764 CTTATCTTTCCCTGATAAGGAGG + Intronic
909666858 1:78143792-78143814 CTGTTTTTTCATTTTTAAAGTGG - Intergenic
910657653 1:89633950-89633972 CTGATCTTTCCCTTTCCAGCTGG + Intronic
912991799 1:114494819-114494841 CTGATTAGTCATTTTTAAGGTGG - Intronic
915671863 1:157496162-157496184 ATGATGTTTCACTTTTAACAGGG + Intergenic
915852300 1:159338256-159338278 CTTGGCTTTCACTTTTAATGAGG + Intergenic
917262939 1:173189353-173189375 CTGGTCTTTCACTTTAACGCAGG + Intronic
917525612 1:175785676-175785698 CTGATCTTTCACATTTGTGCAGG - Intergenic
919095458 1:193029138-193029160 CTGATATTTCACTTTTGACAGGG - Intronic
919723891 1:200869754-200869776 CTGCTCTTTCACCCTTCAGGAGG - Intergenic
920235811 1:204503867-204503889 CTATTCTTGCCCTTTTAAGGAGG + Intergenic
920568847 1:207000955-207000977 CTGATTTTTCACTCTTCAGCTGG - Intergenic
920827637 1:209436584-209436606 CTGATATTTCTGTTTTATGGAGG + Intergenic
921842397 1:219842085-219842107 CTGATCTTTTACATTTGATGAGG - Intronic
921972434 1:221164908-221164930 TTCATGTTTCACTTGTAAGGAGG + Intergenic
922004606 1:221517024-221517046 CTGCTCTCTCACTTTTCTGGAGG - Intergenic
1064295969 10:14079411-14079433 CTTTTCTTTCACTTTTGAGATGG - Intronic
1068239890 10:54291082-54291104 CTGTTCTTTCACATTTACTGAGG - Intronic
1069892450 10:71660690-71660712 CTGATTTTTTTTTTTTAAGGTGG - Intronic
1070004275 10:72407837-72407859 CTTATCTTTTACTGTTCAGGAGG + Intronic
1070391429 10:75974059-75974081 CACATTTTTCACTTTTAAAGGGG + Intronic
1070438432 10:76416378-76416400 CAGATCTATCACTTATAATGCGG + Intronic
1070813480 10:79309950-79309972 CCGGCCTTTCACTTTGAAGGAGG + Intronic
1072115146 10:92363788-92363810 CTGAATTTTCACTTATAAGTGGG + Intergenic
1072547685 10:96452563-96452585 CTGTTATTCCTCTTTTAAGGAGG + Intronic
1072620891 10:97078547-97078569 CTGAACTTTCACTTCAAAGCAGG - Intronic
1073560215 10:104489809-104489831 CTGATTTGTGACTTTTCAGGAGG + Intergenic
1073768420 10:106708780-106708802 CTGCTTCTCCACTTTTAAGGTGG + Intronic
1076215247 10:128688020-128688042 CTTATCTCTGACTTTTTAGGCGG - Intergenic
1079551112 11:21698473-21698495 CTGTTCTTACCCTTTTAAAGTGG - Intergenic
1079865658 11:25730189-25730211 CTTATCTTTCACTTTTTATAGGG - Intergenic
1080364632 11:31558696-31558718 CTGATATTTCATTTTTAATTTGG - Intronic
1081256409 11:40901796-40901818 TTGATTTTTCTCTTTTAAAGGGG + Intronic
1081419930 11:42863930-42863952 CTGATTTTTGCCTTTTAAGCTGG - Intergenic
1082750930 11:57016279-57016301 CTGAACTTTCACTTTTATAATGG - Intergenic
1083252994 11:61480503-61480525 CTGATCTGTCACCTTTGATGAGG - Intronic
1086163511 11:83750016-83750038 GTTACCTTTCACTTTTAGGGAGG + Intronic
1087008453 11:93491515-93491537 CTCATTTCTCACTTCTAAGGTGG - Intronic
1087335803 11:96842816-96842838 CTGATCTGTCACTTCATAGGTGG + Intergenic
1089233485 11:117001898-117001920 CTGATTTTTCTTTTTTTAGGTGG - Intronic
1090014294 11:123072114-123072136 CTCATTTTTCACTTTTAGGAGGG + Exonic
1090549822 11:127807806-127807828 CTGATCTTCCCCTTTTAATAAGG + Intergenic
1090681585 11:129064930-129064952 CTGATCTTTTTCTTTTCAGTCGG - Exonic
1090943125 11:131406145-131406167 CTGATCTTTAAGACTTAAGGTGG + Intronic
1096077161 12:48813131-48813153 CTGATATTTCTATTTTAAAGTGG + Intergenic
1096791729 12:54049148-54049170 CTGATGTTTCATTTTTATGCTGG - Intronic
1097625190 12:61991320-61991342 CTTTTCTTTTACATTTAAGGGGG + Intronic
1101119174 12:101561473-101561495 CTGATACTTTACTTTAAAGGTGG + Intergenic
1105901432 13:24757823-24757845 CTGATGTTTCACTTTTTATATGG + Intergenic
1107167103 13:37295418-37295440 CTGATCTTTCACTATAAACCTGG + Intergenic
1109036838 13:57273882-57273904 TTGATATTTCACCTTTAAGGAGG + Intergenic
1109328905 13:60903081-60903103 CTGTTCTTTCACATTTACTGAGG - Intergenic
1109406000 13:61901158-61901180 CTGATCCCTCACTGCTAAGGTGG + Intergenic
1110754631 13:79158004-79158026 CTGAACTTTCTTTTTTAAGGGGG - Intergenic
1111488089 13:88930493-88930515 TTGTTTTTTCACTTTTAAGGTGG + Intergenic
1111859647 13:93685759-93685781 CTGACATTTCACAGTTAAGGGGG + Intronic
1113054745 13:106256034-106256056 CTGTTTTCTCACTTTAAAGGAGG + Intergenic
1113064095 13:106356717-106356739 CTGATATTGGCCTTTTAAGGAGG + Intergenic
1116355996 14:43930880-43930902 CTGTTCTTTAGCTTTTATGGTGG - Intergenic
1116467140 14:45247113-45247135 ATGGTCATTCAATTTTAAGGAGG + Exonic
1116689281 14:48084100-48084122 CTGCTCTTTCCTTTGTAAGGAGG + Intergenic
1117248215 14:53908604-53908626 TTGATCTTTCACTTTAAACTTGG - Intergenic
1117301387 14:54432000-54432022 CTGATCTTCCATTTTTATGTAGG + Intronic
1117323551 14:54647724-54647746 CTCATGTTTCAATTTTAAGGAGG - Intronic
1118093424 14:62508995-62509017 CAGAACTTTGACTTTTAAGATGG - Intergenic
1118938884 14:70314389-70314411 CTGATCTTTCATGTTTAGGATGG - Intergenic
1119142467 14:72279904-72279926 TTGATCTCTCACTTTTTAGCTGG - Intronic
1119906506 14:78308232-78308254 CTGTTCTTTCACTCTTAAATAGG - Intronic
1120176347 14:81297503-81297525 CTGTTTCCTCACTTTTAAGGAGG + Intronic
1125161439 15:36649050-36649072 CTGATCTGTCACTTTGATGTGGG - Intronic
1125161663 15:36651478-36651500 CTGATCTGTCACTTTGATGTGGG + Intronic
1125210029 15:37203698-37203720 CTTATTTTTCTCTTTTGAGGCGG - Intergenic
1127887089 15:63211131-63211153 CTGGTCTTTCACTTTTATTTGGG - Intronic
1128623575 15:69175220-69175242 CTTATTTTTCATTTTTAAAGTGG - Intronic
1129979042 15:79849446-79849468 CTGAGCTGTCACCTTTGAGGAGG - Intronic
1130747453 15:86671061-86671083 CTTACCTGTCTCTTTTAAGGAGG + Intronic
1132066619 15:98736431-98736453 CTTCTCTTTCAGTTTTATGGGGG + Intronic
1132277999 15:100586322-100586344 CTGTTCTTTCAGTTTTAACAAGG - Intronic
1133570175 16:7033216-7033238 CTGTTTTTGGACTTTTAAGGAGG - Intronic
1135121354 16:19769129-19769151 CAAATCTTTCACTCTGAAGGAGG - Intronic
1149784143 17:59421336-59421358 CTGACCTGTTTCTTTTAAGGGGG + Intergenic
1150449427 17:65253919-65253941 CAGATCTTTCAGTTTTCAAGAGG - Intergenic
1153386887 18:4508977-4508999 CTGAGCTTTTCTTTTTAAGGGGG - Intergenic
1156151409 18:34248265-34248287 CTGAGCTTTTACATTTAAAGTGG + Intergenic
1157007884 18:43607709-43607731 TTAATCTTTCACTTTTCTGGAGG - Intergenic
1157028951 18:43881118-43881140 TTGATCTTCCACTTTAAAGTTGG + Intergenic
1159428427 18:68319965-68319987 CTGATCTTTCACCTTTTACTTGG - Intergenic
1163256882 19:16161323-16161345 CCCATCTTCCAGTTTTAAGGTGG + Intergenic
1164111690 19:22167995-22168017 CTGATCACTCACTTATAATGTGG + Intergenic
1168577388 19:57524527-57524549 CTGATTGTTCACTTTAAAGCTGG + Intergenic
925395029 2:3527176-3527198 GTGATTTTTCTCTTTTGAGGGGG - Intergenic
925803097 2:7621340-7621362 CTCATATTTCATTTCTAAGGTGG + Intergenic
928255724 2:29720552-29720574 TTGATCCTTGACTTTTCAGGTGG - Intronic
929389066 2:41447488-41447510 CTGGTTTTTCTCTTTTTAGGTGG - Intergenic
929906592 2:46051352-46051374 CTGATCTGTGACTGTGAAGGTGG + Intronic
930973172 2:57421324-57421346 CTGTTCTTTCACATTTACTGAGG - Intergenic
931569684 2:63655527-63655549 CTTATTTTTCATTTTTAAGAGGG + Intronic
935388255 2:102523807-102523829 CTGTTCTCTCACCTCTAAGGTGG + Intronic
935728063 2:106041006-106041028 GTTATTTTTCACTTTTAATGAGG + Intergenic
936177366 2:110235446-110235468 CTCATCTCTCTCTTTAAAGGAGG - Intergenic
936702963 2:115035935-115035957 CTGATCTCTCCCTTTTATGTGGG - Intronic
936771020 2:115913485-115913507 CTGATCTTTTCCTTTTGAGATGG - Intergenic
937962528 2:127471651-127471673 CTGATCTTTGAGTTTGCAGGGGG - Intronic
939597406 2:144143294-144143316 TTGATCTATCATTTTTAGGGTGG - Intronic
940092765 2:149939516-149939538 ATAATCTTTCGCTTTTATGGAGG + Intergenic
941031079 2:160512382-160512404 ATCATCTTTCACTATTGAGGTGG - Intergenic
941451087 2:165661165-165661187 TTGAAATTTCACTTTTAATGTGG + Intronic
942700959 2:178710034-178710056 CTGTTCTTTGACTTACAAGGTGG + Intronic
944978053 2:205080154-205080176 CTGTTTTTACATTTTTAAGGTGG + Intronic
946986479 2:225279586-225279608 CTGATCTTGGACTTTCTAGGTGG + Intergenic
947261367 2:228226981-228227003 GTGATCTCTCAATTTTCAGGTGG + Intergenic
948833409 2:240612098-240612120 CTGTTCCTTCACTTTCACGGTGG + Intronic
1169281681 20:4273021-4273043 CTGTTCTTTTTCTTTTGAGGTGG + Intergenic
1170564350 20:17588360-17588382 CTGATTTTACACATTTTAGGTGG - Intronic
1170830425 20:19834541-19834563 TTGCTCCTCCACTTTTAAGGGGG - Intergenic
1171942065 20:31340362-31340384 CTCATCTTTTCCTTTTAAGAAGG - Intergenic
1172414364 20:34752156-34752178 CTTATTTTTCACTTTTAAATGGG + Intronic
1177625240 21:23651099-23651121 ATGGTCTCTGACTTTTAAGGGGG - Intergenic
1180761833 22:18216400-18216422 GTGGTCCTTCCCTTTTAAGGGGG - Intergenic
1180773834 22:18408210-18408232 GTGGTCCTTCCCTTTTAAGGGGG + Intergenic
1180805560 22:18711654-18711676 GTGGTCCTTCCCTTTTAAGGGGG - Intergenic
1180941437 22:19661889-19661911 CTGATCTTTTATTTATAAAGAGG - Intergenic
1181069893 22:20326924-20326946 GTGGTCCTTCCCTTTTAAGGGGG + Intergenic
1181192936 22:21155135-21155157 GTGGTCCTTCCCTTTTAAGGGGG + Intergenic
1181278760 22:21703636-21703658 CTGATCTTTCCCATTGATGGTGG - Intronic
1181924500 22:26347699-26347721 CTGACGTTTCTCTTTTAAAGAGG + Exonic
1184025595 22:41853618-41853640 CAAAGCTTTCACTTTTAGGGAGG - Intronic
1184990140 22:48161959-48161981 CAGACCCTTCATTTTTAAGGTGG + Intergenic
1203235666 22_KI270731v1_random:149184-149206 GTGGTCCTTCCCTTTTAAGGGGG + Intergenic
952249826 3:31641796-31641818 CTGATTTTTCTCCTTTAATGTGG + Intergenic
952668126 3:35932522-35932544 CTGATTTTCCATTTTAAAGGTGG + Intergenic
953490066 3:43342042-43342064 ATGATTTTTCACTTTTGAGTGGG + Intronic
956047257 3:65208917-65208939 CCGGTCTTTCACTTATCAGGGGG + Intergenic
956727358 3:72167514-72167536 CTGGTCTTTCAGTTTTTTGGGGG - Intergenic
957791485 3:84946960-84946982 ATGATCTTTCAATTTCTAGGTGG + Intergenic
958673448 3:97234201-97234223 CTGATCTTTCAATTTTCTGTTGG + Intronic
959512449 3:107229387-107229409 CTGATCATTCTCATTTAGGGTGG - Intergenic
959515078 3:107256728-107256750 CTGAACTTGCCCTTTTATGGTGG + Intergenic
960065158 3:113364049-113364071 CATATCTTTCTCTTTCAAGGAGG - Intronic
961351250 3:126305763-126305785 CAAATCTTTCACCTTTAAGATGG - Intergenic
966987577 3:185196027-185196049 CTGATCTATTTCTCTTAAGGAGG - Intronic
967659217 3:192085085-192085107 CAGATTTTTCACTTTTGAAGTGG - Intergenic
969685216 4:8668466-8668488 CTGATCTTTATCTTTTAATTGGG - Intergenic
970013886 4:11490936-11490958 CTGATTTATCCCTTTTTAGGGGG + Intergenic
970065874 4:12092729-12092751 CTGATCTTTTACATTTGATGAGG - Intergenic
970092681 4:12427826-12427848 CTGATCTTTCGTTTTTAATGTGG + Intergenic
972062461 4:34894216-34894238 CTGATATTTTACTTTTTAAGAGG + Intergenic
972945564 4:44250467-44250489 CTGCTCTTTCACCTGTAAAGTGG - Intronic
974611397 4:64222893-64222915 CTGATCTTTCTCAGTTCAGGAGG - Intergenic
977798456 4:101196709-101196731 CTGATCTTTCACTTTTAAGGAGG - Intronic
978633495 4:110776119-110776141 GTGATTTTGCAATTTTAAGGTGG - Intergenic
981117357 4:141007306-141007328 GTGGCCTTTCACTTTCAAGGAGG - Intronic
982070353 4:151688797-151688819 CTGATCTTTCATTTTTGGGGAGG - Intronic
982932551 4:161427902-161427924 CTGATTTTTGACTTTTAAAAGGG - Intronic
983517282 4:168671229-168671251 CTGATCTTTAACTTTTAATGTGG + Intronic
984867163 4:184291174-184291196 CTAATCTATTGCTTTTAAGGTGG + Intergenic
985096221 4:186415518-186415540 CTGATCTTTTAGTTTATAGGAGG - Intergenic
985435130 4:189921850-189921872 CTTTTCTTTCACTTTGAAGACGG - Intergenic
987664846 5:20923771-20923793 ATGATCTCTCACCTTTGAGGTGG + Intergenic
988185736 5:27859260-27859282 CTGATCTTTCATGTTTAGGATGG + Intergenic
990284284 5:54284553-54284575 ATGAGCTTTATCTTTTAAGGAGG + Intronic
991379071 5:65999583-65999605 ATGATCTTTAACTTGTAAGGAGG - Intronic
993245098 5:85440920-85440942 GTTATCTTTCACTTTGAAGGGGG - Intergenic
993365833 5:87033330-87033352 GTGATCTTTATCCTTTAAGGAGG + Intergenic
995169937 5:109096129-109096151 CTGTTCTTTCAGTATTAATGGGG - Intronic
996434133 5:123415413-123415435 CTGAGCTTTCCTTTTAAAGGTGG - Intronic
997895126 5:137709404-137709426 CTGATCTCTCACTTTGCAGATGG - Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1001190083 5:169621647-169621669 CTGATCTTTTACTTTTGCTGAGG - Intergenic
1003952515 6:11129008-11129030 CTGATTTTTGATTTTTATGGAGG + Intronic
1005233247 6:23729334-23729356 TCAATCTTTCACTTTTAAGTTGG - Intergenic
1006395315 6:33783311-33783333 CTCATCTCTCACTTTCAAGAGGG + Intronic
1007071991 6:39044779-39044801 CAGATCTTTCACTTGAGAGGAGG - Intergenic
1008457514 6:51727840-51727862 CCAATCTGTCACTTTTAGGGAGG + Intronic
1009452832 6:63821711-63821733 GTGATCTTTGTCTCTTAAGGTGG - Intronic
1009515845 6:64616615-64616637 CTGATCTTTCACTTCTGAGAAGG + Intronic
1011317754 6:86055194-86055216 CTGATCTTTTACATTTGATGAGG + Intergenic
1011393080 6:86875579-86875601 CTGATCTTTTACATTTACTGAGG - Intergenic
1011612435 6:89166658-89166680 CTGAGGTTTCTCTTTTAAGGTGG - Intergenic
1012011889 6:93798931-93798953 CTGATCTTTCTGTATAAAGGAGG + Intergenic
1013357438 6:109358852-109358874 CTTATCTTTCATTTTGGAGGGGG - Intergenic
1013617862 6:111861398-111861420 GTGATCTCCCACATTTAAGGTGG + Intronic
1013807189 6:114009250-114009272 CAGTTCTTTCACTTTTAACCTGG + Intronic
1014161826 6:118178507-118178529 CCTATCATTTACTTTTAAGGGGG + Intronic
1015155321 6:130088400-130088422 CTCATCTTTCTTTTTTAAGAAGG + Intronic
1015339981 6:132087265-132087287 CTTAACTTTCACATTTAAAGTGG - Intergenic
1015365307 6:132390945-132390967 ATGTTCTTTCACTATTTAGGAGG + Intronic
1018239449 6:161758713-161758735 CTGATCTATCATCTTTAAGTGGG - Intronic
1018244588 6:161810471-161810493 CTTATCTCTAAATTTTAAGGAGG - Intronic
1023192601 7:37598734-37598756 CTTATTTTTCCCTTTTAAGGAGG + Intergenic
1024864520 7:53889556-53889578 CTGGTGATTCACTGTTAAGGTGG - Intergenic
1026508339 7:71006032-71006054 GTGATCTGTCTATTTTAAGGGGG - Intergenic
1027394579 7:77741299-77741321 CTCATCTTACACTTTTGAAGGGG + Intronic
1027900743 7:84111347-84111369 CTGAGCTTTCACTTGAAAAGTGG - Intronic
1028966660 7:96809658-96809680 TTCATCTCTCACTTTTATGGTGG + Intergenic
1029325518 7:99804439-99804461 CAGATCTGTGACTGTTAAGGAGG + Intergenic
1030777681 7:113554728-113554750 ATGATTTTTCTCTTTTAAGGTGG - Intergenic
1030782434 7:113618000-113618022 CTGATCTTTCATGGTTAAGAAGG + Intergenic
1030963292 7:115954351-115954373 TTGATCATTCACTTCCAAGGAGG - Intronic
1031112555 7:117629976-117629998 CTGTTCTTCCACCTTTAAAGAGG - Intronic
1031946245 7:127844233-127844255 CTGATCTTTCACAGTTGAGCAGG + Intronic
1032465409 7:132141352-132141374 CTGATTTTTCATTTCTAAGCTGG + Intronic
1034777172 7:153838876-153838898 CTAATTTTTCAATTTTAAGTGGG - Intergenic
1034868879 7:154665087-154665109 ATGACCTTGCACTTTTGAGGAGG + Intronic
1036391252 8:8326043-8326065 CTGACCTTTCTGTTTTGAGGAGG - Intronic
1036731306 8:11267865-11267887 CTGATCTTTCACTTTTTTTCAGG - Intergenic
1038043159 8:23743829-23743851 CTGGTCTTTCACTTTCAATCTGG - Intergenic
1043198614 8:77332981-77333003 ATGATAGTTCACTTTTAATGAGG + Intergenic
1044859009 8:96503836-96503858 CTGTTCTTTCTCATTTTAGGAGG + Intronic
1045425408 8:102061075-102061097 CTGAGTTTTCACTTTTAGGGAGG - Intronic
1046302948 8:112321924-112321946 CTGAACTTATACTTTAAAGGGGG + Intronic
1052911179 9:33883408-33883430 TTGATCTTATTCTTTTAAGGGGG - Intronic
1053258938 9:36644367-36644389 CTGTTCTTTAACTTGCAAGGTGG + Intronic
1054334291 9:63789810-63789832 CTGTTCTTTTACTTTTGATGAGG - Intergenic
1054935940 9:70687756-70687778 CAGATTTCTGACTTTTAAGGGGG - Intronic
1055934813 9:81594910-81594932 CTGATATTTTGCTTTTATGGAGG - Intronic
1057176897 9:93007026-93007048 CTGATCTTTTAACTTTATGGTGG + Intronic
1058190828 9:101912874-101912896 CTGATCTCTCTCATTTAATGAGG + Intergenic
1186796923 X:13056029-13056051 CTGATCTGCTGCTTTTAAGGAGG - Intergenic
1188885934 X:35548696-35548718 GTGATATTTCACATTTAAGACGG - Intergenic
1193321588 X:80128925-80128947 CTACTCTTTCACTATTGAGGTGG + Intergenic
1194350752 X:92823064-92823086 CTTAATTTTTACTTTTAAGGAGG + Intergenic
1194369382 X:93052824-93052846 CAGGTTTTTCACTATTAAGGTGG + Intergenic
1196615239 X:117760561-117760583 CTGATCTTTTACATTTACTGAGG + Intergenic
1200206621 X:154320949-154320971 CTAATCTTTCTCTGTGAAGGAGG - Intronic
1200659079 Y:5939744-5939766 CTTAATTTTTACTTTTAAGGAGG + Intergenic
1200677572 Y:6169051-6169073 CAGGTTTTTCACTATTAAGGTGG + Intergenic
1201919309 Y:19217333-19217355 CTGATCTTTCACATTTGCTGAGG + Intergenic