ID: 977799538

View in Genome Browser
Species Human (GRCh38)
Location 4:101210199-101210221
Sequence GGGAACTTGGAGAAATAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977799538_977799547 25 Left 977799538 4:101210199-101210221 CCAGACTATTTCTCCAAGTTCCC 0: 1
1: 0
2: 0
3: 15
4: 264
Right 977799547 4:101210247-101210269 GATCCTCAAACTCTATGGTCCGG No data
977799538_977799545 20 Left 977799538 4:101210199-101210221 CCAGACTATTTCTCCAAGTTCCC 0: 1
1: 0
2: 0
3: 15
4: 264
Right 977799545 4:101210242-101210264 CACCTGATCCTCAAACTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977799538 Original CRISPR GGGAACTTGGAGAAATAGTC TGG (reversed) Intronic
900039638 1:447637-447659 GGGAATTTGAAGGAATAGTGAGG + Intergenic
900061070 1:682613-682635 GGGAATTTGAAGGAATAGTGAGG + Intergenic
901024952 1:6274232-6274254 GGGAACTTGGGGTAACAGCCTGG + Intronic
904947918 1:34212888-34212910 GGGAACTTGGTGGAAAAGTGTGG - Intronic
906436627 1:45802285-45802307 GGCAGATTGGAGAAATAGTGAGG + Intronic
907621115 1:55981767-55981789 ATAAACTTGGAGAAATAATCAGG - Intergenic
907830989 1:58064098-58064120 GGGGATTTGGAGAAACAGTCAGG + Intronic
910464810 1:87487075-87487097 GGGAACATTGAGAATTAATCAGG - Intergenic
911445432 1:97986140-97986162 AGAAACTTGGAGAATAAGTCAGG + Intergenic
911959403 1:104281367-104281389 GGCAACTGGGAGATGTAGTCTGG - Intergenic
913434604 1:118833624-118833646 GGCAAATTGGATAAAGAGTCAGG + Intergenic
913588738 1:120302342-120302364 GTGAAGTAGGAGAAAAAGTCTGG + Intergenic
913619447 1:120596027-120596049 GTGAAGTAGGAGAAAAAGTCTGG - Intergenic
914204036 1:145511429-145511451 TGGAACTTGAAGAAATAGAGGGG + Intergenic
914483160 1:148084583-148084605 TGGAACTTGAAGAAATAGAGGGG + Intergenic
914570761 1:148914213-148914235 GTGAAGTAGGAGAAAAAGTCTGG + Intronic
914602069 1:149216050-149216072 GTGAAGTAGGAGAAAAAGTCTGG - Intergenic
916454291 1:164954505-164954527 AGGAACTTGGAAATATACTCTGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917295463 1:173514580-173514602 GGCAAATTGGATAAAGAGTCAGG - Intronic
917398488 1:174619842-174619864 GGCAAATTGGATAAAGAGTCAGG + Intronic
917399516 1:174631832-174631854 GGCAAATTGGATAAAGAGTCAGG - Intronic
918187291 1:182139552-182139574 GGGCACTTGTAGAGACAGTCAGG - Intergenic
918360160 1:183749499-183749521 GGAAAATTGGATAAAGAGTCAGG - Intronic
921378884 1:214503970-214503992 GAGAAGTGTGAGAAATAGTCAGG + Intronic
1062953712 10:1526189-1526211 GGGAAGTTGGAGAGATGGCCTGG + Intronic
1066170827 10:32842928-32842950 GGGGACTTGGGGAAAGAGTAGGG + Intronic
1067561708 10:47309088-47309110 TGGACCTTGGAGATTTAGTCAGG + Intronic
1067743390 10:48913938-48913960 TGGAACTTGGAGATGGAGTCAGG + Exonic
1072187430 10:93053694-93053716 GGAAACTTGGAATAATGGTCTGG + Intronic
1072315953 10:94203304-94203326 GCTAACTTGGATAAATATTCAGG - Intronic
1074646618 10:115460327-115460349 TGGAACTTGGGGAAATAATTAGG - Intronic
1074970551 10:118532981-118533003 GGGAGCTTGGAGAGATGGCCTGG - Intergenic
1076965862 11:83549-83571 GGGAATTTGAAGGAATAGTGAGG + Intergenic
1078703274 11:13711606-13711628 TGGGACTGGTAGAAATAGTCTGG + Intronic
1079803282 11:24896771-24896793 GGGAACTTGGAGAACTTTTGTGG + Intronic
1079842997 11:25427198-25427220 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1081094736 11:38919269-38919291 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1081346912 11:41999129-41999151 GGGAAATAGGAAAAGTAGTCTGG - Intergenic
1082742528 11:56926442-56926464 GGGCATTTGGAGATATTGTCAGG + Intergenic
1082758778 11:57105859-57105881 GGGACCTTTGAGAAATAATTAGG + Intergenic
1084258229 11:67956725-67956747 GGAGACGTGGAGAAATATTCTGG + Intergenic
1085800920 11:79588292-79588314 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1086979315 11:93176387-93176409 GGCAAATTGGATAAAGAGTCAGG - Intronic
1087105937 11:94406885-94406907 GGGAACTTGGGGGAAGAGTGGGG - Intergenic
1087445367 11:98244297-98244319 GGGGACTTGGAGAACTTTTCTGG - Intergenic
1090460289 11:126885395-126885417 GGACACTTGGAGAAATTTTCAGG + Intronic
1090659729 11:128873064-128873086 TGGAACTTGTAGTATTAGTCTGG - Intergenic
1091933578 12:4416929-4416951 GGGGACTTGGAGAACTTTTCTGG - Intergenic
1093680722 12:21999180-21999202 GTGAGCTGGGAGAAATAGTGTGG - Intergenic
1094114867 12:26900018-26900040 GGCAAATTGGACAAACAGTCAGG + Intergenic
1095054384 12:37582265-37582287 GGGAACATGGAGAATGTGTCAGG + Intergenic
1095674461 12:44899814-44899836 GGCAAATTGGATAAAGAGTCAGG + Intronic
1097520258 12:60659302-60659324 TGGAACTTTGAAAAATAGCCTGG + Intergenic
1101361247 12:104029359-104029381 GGGAAATTGGGGAAATATTATGG + Intronic
1102423351 12:112821474-112821496 GGTAAGTTGGAGAAATGGTAAGG - Intronic
1104183164 12:126402261-126402283 GGGAACTTGGGGAAAGGGTGGGG - Intergenic
1105599310 13:21871763-21871785 GGGAACCTTAAGAAATAGACGGG - Intergenic
1105731475 13:23221828-23221850 GGGAACCTGTGGAAATAGTCAGG + Intronic
1106953907 13:34914509-34914531 TGAAGCTTGGAGAATTAGTCGGG + Intergenic
1109657098 13:65407392-65407414 GGGAAATTGGTAGAATAGTCAGG - Intergenic
1111081109 13:83308880-83308902 GGGAACTAGGAAAAATATTAAGG - Intergenic
1112256850 13:97841966-97841988 TGAAAATTGGAGAAATAGGCTGG - Intergenic
1112809561 13:103201838-103201860 GGAAATTTGGAGAAATAAGCAGG - Intergenic
1113973425 13:114208107-114208129 GTGACCTTGGACAAATTGTCAGG + Intergenic
1116488984 14:45484571-45484593 GGAAAATTGGATAAAGAGTCAGG - Intergenic
1116696163 14:48181199-48181221 GGGGACTTGGAGAACTTTTCTGG - Intergenic
1117635062 14:57734129-57734151 GGGAACATTGAGATATAGGCTGG + Intronic
1118521389 14:66589438-66589460 GGTAAATTGGATAAAGAGTCAGG + Intronic
1122195890 14:100085448-100085470 AGGGACATGGAGAAATAGGCTGG + Intronic
1124561982 15:30782725-30782747 GGGGACTTGGAGAACTTGTGTGG - Intergenic
1126645355 15:50869911-50869933 GGGGACTGGGAGAAATTTTCAGG + Intergenic
1127735842 15:61838540-61838562 GGGAACTTGGAGGAACAGAAGGG + Intergenic
1129240657 15:74250169-74250191 GAGCAGTTGGAGAAATAGTGCGG - Intronic
1129267529 15:74401942-74401964 GGGAGCTTGGAGGAATAGGCTGG - Intergenic
1130138049 15:81197972-81197994 GGGAAACTGGAGAAATAGGAAGG - Intronic
1130321364 15:82845181-82845203 GGGAAGTGGGAGAAACAGTAAGG - Intronic
1130357710 15:83149512-83149534 GGTAACCTGGAGGAAAAGTCAGG + Intronic
1131925302 15:97376426-97376448 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1132188947 15:99831893-99831915 GGCAAATTGGAGAAAGAGTCAGG - Intergenic
1132442270 15:101879976-101879998 GGGAATTTGAAGGAATAGTGAGG - Intergenic
1132535337 16:476409-476431 AGGAACTTGGTGAAATAAGCAGG + Intronic
1132986996 16:2772418-2772440 GGGAACAAGGAGATATATTCTGG - Intronic
1134263672 16:12674493-12674515 TGGAACTAGGAGAAATATTTCGG - Intronic
1138258066 16:55587085-55587107 GGGGACTTGGAGAACTTTTCTGG - Intergenic
1138332394 16:56225481-56225503 GGGAACTAGCAGAAATTGTTTGG + Intronic
1138720577 16:59074440-59074462 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1139698879 16:68695048-68695070 GGGGACTTGGAGGCATAGGCTGG + Intronic
1140980268 16:80102081-80102103 GGGAACTTGAAGCAATTATCTGG + Intergenic
1141719238 16:85746473-85746495 GGGGACCTGGAGAACTAGACAGG + Intronic
1142592171 17:1011042-1011064 GGGAACAGGGAGAGATAGCCTGG + Intronic
1145214995 17:21044116-21044138 GGGAACTTGGATAAGGTGTCAGG + Intergenic
1145374924 17:22338328-22338350 GGGAACATGGAGAATGTGTCAGG + Intergenic
1146084017 17:29810586-29810608 GGGAAAATGGATAAATAGCCAGG - Intronic
1146506865 17:33413438-33413460 GGCAGCTTGGAGAGATAGTTAGG - Intronic
1150949921 17:69791850-69791872 TGAAAATTGGAGAAATAGTGAGG + Intergenic
1151337371 17:73447835-73447857 GGGGACTGGGAGATATGGTCGGG - Intronic
1152413774 17:80146122-80146144 GGGATTTTGGAGAGCTAGTCGGG - Intronic
1157025507 18:43837671-43837693 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1160451367 18:78968593-78968615 GGCAACTTAGAGAAATGGGCTGG + Intergenic
1160642666 19:153179-153201 GGGAATTTGAAGGAATAGTGAGG + Intergenic
1161983801 19:7643546-7643568 GGGACCTTGGAGAGGTAGGCAGG + Intronic
1164112763 19:22184781-22184803 AGGAACCTGGAGATACAGTCTGG - Intronic
1164333445 19:24283721-24283743 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1164601229 19:29564944-29564966 GGGAATTTGGAGAGAAAGTAGGG + Intergenic
1164812226 19:31166380-31166402 GGGAGCCTGGAGAAAGAGTAGGG + Intergenic
1165632305 19:37312287-37312309 GGGAACATGGAGAATGTGTCAGG - Intergenic
1166112280 19:40629832-40629854 GTAGACTTGGAGAAATAGACAGG - Intergenic
1166368620 19:42289780-42289802 GGGACCCAGGAGAAACAGTCTGG - Intronic
1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG + Intronic
925130756 2:1492606-1492628 CAGAACTGGGAGAAATAGCCAGG - Intronic
926006809 2:9378945-9378967 GGGAACCTGGATAAACAGACAGG + Exonic
927029647 2:19107162-19107184 GGGAACACAGAGAAATGGTCTGG + Intergenic
927286509 2:21362686-21362708 GGGAACTTCAAGAAAAAATCTGG - Intergenic
927636659 2:24821650-24821672 GGGACCGTGGAGAAAGTGTCAGG + Exonic
928354853 2:30602391-30602413 GAGAACTTTGAGAAATTTTCAGG + Intronic
928909884 2:36408813-36408835 GGGAAGTTCAAGAAAGAGTCTGG + Intronic
931442896 2:62303963-62303985 GGAAACTTTCAGAAATACTCGGG - Intergenic
933317909 2:80737235-80737257 GGGAACTTAGAGAAGAAGTCAGG - Intergenic
934582246 2:95452459-95452481 GAGAATTTGGAGAATTAGTTGGG - Intergenic
934597204 2:95624255-95624277 GAGAATTTGGAGAATTAGTTGGG + Intergenic
934842680 2:97638749-97638771 GAGAATTTGGAGAATTAGTTGGG - Intergenic
938153111 2:128903649-128903671 GGGGACTTGGAGAACTTTTCTGG - Intergenic
939253384 2:139712432-139712454 AGGCACTTTGGGAAATAGTCTGG - Intergenic
939892636 2:147755755-147755777 AGGAACTTGGAGACAGAGCCTGG - Intergenic
939937535 2:148311587-148311609 GGCAAATTGGAGAAAGAGTCAGG - Intronic
940407828 2:153326424-153326446 GGCAAATTGGATAAACAGTCAGG - Intergenic
941518493 2:166509507-166509529 GGCAAATTGGATAAAAAGTCAGG - Intergenic
941663516 2:168219612-168219634 GACCACTTGGAGAAAAAGTCAGG - Intronic
941852316 2:170196185-170196207 AGGAAGTAGGAGAAATAATCAGG - Intronic
943883288 2:193176423-193176445 GGGAAGATGGAGAAATAGCAGGG - Intergenic
944742866 2:202629267-202629289 GGGAGCTTGGAGAAGTAGGGTGG + Intergenic
945192949 2:207208820-207208842 GGAAACTGGGAGAAAGTGTCAGG + Intergenic
948348939 2:237322584-237322606 TGGAACTTGGGGGAGTAGTCAGG - Intergenic
1169033311 20:2430160-2430182 GGGCTCTTGGAGAAATTATCTGG + Intronic
1174273090 20:49383878-49383900 GGGAAATAGGGGAAATGGTCAGG - Intronic
1176057972 20:63158769-63158791 AGGTACTTTGGGAAATAGTCTGG + Intergenic
1177477322 21:21640695-21640717 GGGAATTTAGAGAAAAAGTATGG - Intergenic
1180060452 21:45382364-45382386 GGGAACTTGAAGACACAGTCAGG - Intergenic
1181845055 22:25700110-25700132 AGGCACTTGGAGAAGGAGTCTGG + Intronic
949640822 3:6034352-6034374 GGAAAATTGGATAAAGAGTCAGG - Intergenic
953854284 3:46489055-46489077 GGGAGCTTGGAGAGGAAGTCTGG - Intergenic
954176382 3:48848721-48848743 GGGCAATTTGGGAAATAGTCTGG - Intergenic
955392330 3:58530777-58530799 GGGCACTTGGGGAAATGGCCTGG - Intronic
955453953 3:59100236-59100258 AGGAATCTAGAGAAATAGTCTGG + Intergenic
957696615 3:83648097-83648119 GGCAAGTTGGATAAAGAGTCAGG - Intergenic
957950481 3:87119855-87119877 AAGAACTTGGACAAATAGGCTGG - Intergenic
958167972 3:89901589-89901611 GGCAAATTGGACAAAGAGTCAGG + Intergenic
959985606 3:112567624-112567646 GGGACATTGGATTAATAGTCGGG + Intronic
960448775 3:117780169-117780191 GGCAAATTGGATAAAGAGTCAGG + Intergenic
963695600 3:148563039-148563061 GGAAAATTGGATAAAGAGTCAGG + Intergenic
965090856 3:164161388-164161410 GGCAAATTGGATAAAAAGTCAGG - Intergenic
966275131 3:178156336-178156358 GGGAATTTGGAGGAACAGACTGG - Intergenic
966979802 3:185121665-185121687 GTGAAGTTGGAGAAGTAGTAAGG + Intronic
967040506 3:185687996-185688018 GTGAACTTGGAGGAAAAGCCAGG + Intronic
967780253 3:193430755-193430777 GTGAAGTTGGTGAAGTAGTCAGG + Intronic
971621117 4:28855444-28855466 GGCAAATTGGATAAAGAGTCAGG - Intergenic
973150971 4:46887807-46887829 GGGAGTTTGGGGGAATAGTCAGG - Intronic
974278840 4:59763118-59763140 GGGACCTTGGAGAAGTAATTAGG + Intergenic
974594223 4:63996000-63996022 GGGAACCAGGAGAAATGTTCAGG + Intergenic
974946396 4:68534381-68534403 GGAAAATTGGATAAAGAGTCAGG - Intergenic
975039512 4:69727545-69727567 GAGCACTTGGATCAATAGTCAGG + Intronic
975083306 4:70306545-70306567 TGGAGCTACGAGAAATAGTCGGG + Intergenic
975104348 4:70550795-70550817 GGAAAATTGGATAAAGAGTCAGG + Intergenic
975824476 4:78305801-78305823 GGCAAATTGGATAAAGAGTCAGG - Intronic
976106905 4:81628912-81628934 AGAAACTTGAAGAAATAGTGGGG - Intronic
976339974 4:83935943-83935965 GTGAGCTTAGAGAAATAGTAAGG - Intergenic
977799538 4:101210199-101210221 GGGAACTTGGAGAAATAGTCTGG - Intronic
978464749 4:108996171-108996193 GGCAAATTGGATAAAGAGTCAGG + Intronic
979581600 4:122367005-122367027 GGGAAATTGGATAAAGAGTCAGG + Intergenic
982091644 4:151884732-151884754 GGGCACTTGGAGGAAGAGGCAGG + Intergenic
982240707 4:153296605-153296627 GGAAACTTGGAGAAAGAATGGGG + Intronic
983422700 4:167540127-167540149 GGGAACTTGGGGGAAGAGTGGGG + Intergenic
984062982 4:175014890-175014912 GGGAAGTTGGTGTAATAGTAAGG + Intergenic
986111961 5:4728225-4728247 GGGAAGATGGAGAAATAGGCTGG + Intergenic
989517013 5:42355373-42355395 GGCAAATTGGATAAAGAGTCAGG + Intergenic
993875504 5:93302318-93302340 GGGATCTTTGAGAAATACTGTGG - Intergenic
995699510 5:114918601-114918623 GGCAAATTGGATAAAAAGTCAGG - Intergenic
997038021 5:130216406-130216428 GAGAACTTGGAGAAAAAGAATGG + Intergenic
997078627 5:130711509-130711531 GGGAACTTTGATATGTAGTCAGG + Intergenic
998264648 5:140658862-140658884 GAGAATCTGGAGAAATGGTCAGG + Intronic
998587158 5:143439087-143439109 GGGTATTTGGAGAAATACTCTGG + Intergenic
999612372 5:153383577-153383599 GGCAAATTGGATAAACAGTCAGG + Intergenic
1002581213 5:180210380-180210402 GGGGACTTGGAGAACTTTTCTGG - Intergenic
1002734209 5:181371306-181371328 GGGAATTTGAAGGAATAGTGAGG - Intergenic
1002750333 6:102819-102841 GGGAATTTGAAGGAATAGTGAGG + Intergenic
1003087411 6:3071135-3071157 AGGAAGTTGGAGAAATCCTCTGG + Intronic
1004324803 6:14665042-14665064 GGAAACCTGGAGAAACAGGCTGG - Intergenic
1006077759 6:31545372-31545394 GGGAACTGGCAGAAGGAGTCAGG + Exonic
1006839127 6:37016943-37016965 GGGAACTAGGGGATAGAGTCGGG - Intronic
1008577423 6:52874323-52874345 GGGAACATGGAGAAAGATCCGGG - Intronic
1010848804 6:80746422-80746444 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1010856777 6:80849808-80849830 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1012036383 6:94146350-94146372 GAGAACTTGGAGATATTCTCTGG + Intergenic
1012168721 6:95991267-95991289 GGGATCTGGTAGAAATAGTGGGG + Intergenic
1012872196 6:104685393-104685415 GGGAAATTGTAGAAAGAGCCAGG + Intergenic
1016905667 6:149148267-149148289 CGGAATTTGGGGAAATAGTTTGG + Intergenic
1018003243 6:159597870-159597892 GGAGACATGGAGAAAGAGTCAGG + Intergenic
1018695520 6:166388285-166388307 GGGAGCAGGGAGAAATAGTGAGG + Intergenic
1019238457 6:170643621-170643643 GGGAATTTGAAGGAATAGTGAGG - Intergenic
1019557407 7:1639528-1639550 GTTAACTTGGAGAATTTGTCCGG - Intergenic
1022314859 7:29236303-29236325 GGGAACTTGTAAGAATAGTCAGG - Intronic
1022425473 7:30264877-30264899 GGGGACTTGGAGAAAAAGGGGGG - Intergenic
1022900092 7:34799769-34799791 GGCAAATTGGATAAAGAGTCAGG + Intronic
1022901627 7:34816119-34816141 GGCAAATTGGATAAAGAGTCAGG + Intronic
1024364944 7:48509805-48509827 GGGATCTTGGAGAGATAATTAGG + Intronic
1024635944 7:51290636-51290658 GGGAAGCTGGAGAGAAAGTCAGG - Intronic
1025296996 7:57783187-57783209 GGGAACATGGAGAAAGTTTCAGG + Intergenic
1026601772 7:71783414-71783436 GGGCCTTTGGAGAAATAGTGTGG + Exonic
1027703218 7:81495044-81495066 GGAAACTTGGAGAATTAGTATGG - Intergenic
1028562143 7:92187680-92187702 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1028637197 7:93002796-93002818 GGGAGGATGGAGAAATAGTGAGG + Intergenic
1029951477 7:104591052-104591074 GGCAAATTGGATAAAGAGTCAGG - Intronic
1031566172 7:123299425-123299447 GAGGATGTGGAGAAATAGTCAGG - Intergenic
1032392383 7:131564021-131564043 GGGGAATGGGAGGAATAGTCAGG - Intergenic
1032846799 7:135758240-135758262 GGGACTCAGGAGAAATAGTCAGG + Intergenic
1035509311 8:162986-163008 GGGAATTTGAAGGAATAGTGAGG + Intergenic
1038140704 8:24841762-24841784 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1038525025 8:28265560-28265582 GGGAACCAGGAGAACTAGACTGG + Intergenic
1038887642 8:31682594-31682616 GGAAAGTTGGAGAAATAGTATGG - Intronic
1040544699 8:48389561-48389583 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1041780359 8:61572361-61572383 TGGAACTTGGAGGAAAAGCCAGG - Intronic
1041836852 8:62225606-62225628 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1041845192 8:62320271-62320293 GGCAAATTGGATAAAGAGTCAGG - Intronic
1043471370 8:80566223-80566245 GGGCACTTTGAGAACTGGTCGGG + Intergenic
1044169035 8:89026239-89026261 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1045752250 8:105498774-105498796 GTGAAGTTGGAGAGATGGTCAGG + Intronic
1045975224 8:108123599-108123621 GGCAAATTGGATAAAAAGTCAGG + Intergenic
1047773965 8:128053853-128053875 GGGCACTTGGAGATACAGGCTGG - Intergenic
1047826247 8:128579403-128579425 GGGCACTTGGAGGCATAGTTAGG + Intergenic
1048180611 8:132191070-132191092 GTGAACTTGGAGAGACAGGCTGG + Intronic
1051477385 9:17522872-17522894 TGGTACTTGGAGAAGTAGACAGG - Intergenic
1052052483 9:23864544-23864566 GGAAAATTGGATAAAGAGTCAGG - Intergenic
1052056886 9:23916951-23916973 GGGGACTTGGAGAACTTTTCTGG - Intergenic
1052058209 9:23926374-23926396 GGGGACTTGGAGAACTTTTCTGG - Intergenic
1052255015 9:26445747-26445769 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1052441011 9:28496597-28496619 GGCAAATTGGATAAAGAGTCAGG - Intronic
1052745481 9:32436125-32436147 GGAGACTTAGAGAAATAGCCAGG + Intronic
1053192716 9:36086716-36086738 GGGGACTTGGAGAACTTTTCTGG - Intronic
1053352546 9:37423046-37423068 GGGAGCGTGGAGAATTAGCCTGG - Intronic
1053458071 9:38246555-38246577 AGGTACGTGGAGAAAAAGTCAGG - Intergenic
1053795839 9:41726230-41726252 GGGAACATGGAGAATGTGTCAGG - Intergenic
1054149341 9:61588643-61588665 GGGAACATGGAGAATGTGTCAGG + Intergenic
1054184246 9:61938301-61938323 GGGAACATGGAGAATGTGTCAGG - Intergenic
1054469101 9:65519754-65519776 GGGAACATGGAGAATGTGTCAGG + Intergenic
1054654260 9:67650194-67650216 GGGAACATGGAGAATGTGTCAGG + Intergenic
1056077147 9:83053483-83053505 GGCAAATTGGATAAAGAGTCAGG - Intronic
1056844668 9:90026773-90026795 GAGAATTTGCAGAAATAGGCTGG - Intergenic
1057909065 9:99004252-99004274 GCAAACTTGGAGAAAGAGGCCGG + Intronic
1060647883 9:125297628-125297650 AGGAAATTGGAGAAGTAGCCAGG + Intronic
1062758660 9:138323913-138323935 GGGAATTTGAAGGAATAGTGAGG - Intergenic
1203758034 Un_GL000218v1:154326-154348 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1186700993 X:12089988-12090010 AGGAATTTGAAGAAGTAGTCTGG + Intergenic
1187749282 X:22444223-22444245 GGGAATTTGGAAAAATATTAAGG + Intergenic
1188299497 X:28489978-28490000 TGGAACTTGGACAAATAGTTGGG - Intergenic
1188623547 X:32256450-32256472 GGCAAATTGGATAAAGAGTCAGG - Intronic
1189083828 X:37999780-37999802 GAGAACTTAGAAAAAAAGTCTGG - Intronic
1190555051 X:51625325-51625347 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1190602162 X:52104515-52104537 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1191637995 X:63398727-63398749 TGGAACTTGGATAAAAAGACTGG - Intergenic
1192636936 X:72829058-72829080 GGCAAATTGGATAAAGAGTCAGG - Intronic
1192644778 X:72891756-72891778 GGCAAATTGGATAAAGAGTCAGG + Intronic
1192949856 X:76005763-76005785 GGCAAGTTGGATAAAGAGTCAGG - Intergenic
1193137507 X:77988572-77988594 GGGACACTGGAGAAAAAGTCAGG + Exonic
1193398044 X:81009462-81009484 GGGAAACTGGATAAAGAGTCAGG - Intergenic
1193579779 X:83250757-83250779 GCGAATTTGGAGAAATAATCTGG + Intergenic
1193605696 X:83565656-83565678 GGCAAGTTGGATAAACAGTCAGG - Intergenic
1193778005 X:85667819-85667841 GGGAAGTTGTAAAAATAGTACGG + Intergenic
1194399567 X:93426591-93426613 GGGTACTTGGAAAAATTGTTAGG - Intergenic
1195261248 X:103133583-103133605 GGAAAATTGGATAAAGAGTCAGG + Intergenic
1195658480 X:107355855-107355877 GGAGACTTGCAGAAATAGTTGGG + Intergenic
1196600466 X:117596296-117596318 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1197565957 X:128086907-128086929 GGGATTTTGGAGACTTAGTCTGG - Intergenic
1197880541 X:131162346-131162368 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1198002032 X:132449590-132449612 GGCAAATTGGATAAAGAGTCAGG - Intronic
1198490164 X:137131646-137131668 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1199946983 X:152678425-152678447 GGCAAATTGGATAAAGAGTCAGG - Intergenic
1201413466 Y:13724140-13724162 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1201431943 Y:13911457-13911479 GGCAAATTGGATAAAGAGTCAGG + Intergenic
1201493308 Y:14566224-14566246 GGCAAATTGGATAAAGAGTCAGG + Intronic