ID: 977799775

View in Genome Browser
Species Human (GRCh38)
Location 4:101213142-101213164
Sequence ATGACTTTGATTAAAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 470}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977799775_977799777 4 Left 977799775 4:101213142-101213164 CCAGAAATTTTAATCAAAGTCAT 0: 1
1: 0
2: 0
3: 48
4: 470
Right 977799777 4:101213169-101213191 ATGATAGTTTTTTTAAGGAAAGG 0: 1
1: 0
2: 7
3: 68
4: 734
977799775_977799776 -1 Left 977799775 4:101213142-101213164 CCAGAAATTTTAATCAAAGTCAT 0: 1
1: 0
2: 0
3: 48
4: 470
Right 977799776 4:101213164-101213186 TAAATATGATAGTTTTTTTAAGG 0: 1
1: 0
2: 4
3: 89
4: 915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977799775 Original CRISPR ATGACTTTGATTAAAATTTC TGG (reversed) Intronic
900521030 1:3105605-3105627 ATGACTGTGATTAGTATTGCGGG + Intronic
903277185 1:22229570-22229592 ATGTCTAAGAGTAAAATTTCAGG + Intergenic
903713379 1:25343690-25343712 CTGACTCTGCTGAAAATTTCTGG - Intronic
903814775 1:26057076-26057098 ATGAGTTTGATTGATATTTGGGG + Intronic
904751966 1:32746497-32746519 AAGACTTTGATGAAAATGCCTGG - Intronic
905237891 1:36562611-36562633 AAGACTTTGATAAACATTCCAGG - Intergenic
906723212 1:48024199-48024221 ATTACTTTGATCAAACTTTTTGG + Intergenic
906855589 1:49300967-49300989 ATGACTGTGATTTAACTGTCTGG + Intronic
907953930 1:59210285-59210307 ATGACAATCATTAAAATGTCAGG + Intergenic
908441563 1:64160174-64160196 ATCACTTTTAATAAAATTTTAGG + Intronic
908953356 1:69589667-69589689 ATCACTAGGATTAAAAGTTCAGG - Intronic
909482217 1:76138435-76138457 ATGCCTTTGTTTAAATTTCCTGG - Intronic
909636332 1:77820667-77820689 AAGACGTTCTTTAAAATTTCTGG + Intronic
909863912 1:80641708-80641730 ATGACTTTGCTTAAAACATATGG - Intergenic
910252938 1:85217365-85217387 AGGAGGTTGATTATAATTTCTGG - Intergenic
910585688 1:88877094-88877116 ATGACCTACATTAGAATTTCTGG + Intronic
910785557 1:90994309-90994331 ATTACTTTAATTAAATTTTAGGG - Intronic
911921864 1:103773610-103773632 ATGAGTTTGAATAAATTTTAGGG + Intergenic
911961372 1:104307413-104307435 ATCACTTTTATTCAAATGTCAGG + Intergenic
911977532 1:104518803-104518825 ATGACTTTTATCAAAATTACAGG + Intergenic
912050743 1:105525383-105525405 ATAAATCTGATTAAAATTTAGGG - Intergenic
912165022 1:107032816-107032838 ATGACTTTCATGCAAATATCTGG - Intergenic
913220402 1:116655446-116655468 ATGACTTTCTTTAAAACCTCTGG - Intronic
914249181 1:145907717-145907739 ATGTCTGTGAATGAAATTTCAGG - Intronic
914432273 1:147629599-147629621 GTGACTTTGAAAAAAATTACAGG - Intergenic
915099185 1:153486248-153486270 ATGTCTCTGGTGAAAATTTCTGG - Intergenic
915791692 1:158679013-158679035 ATGATTTTGCATAAAATTTCAGG + Intronic
917594433 1:176514735-176514757 TTGACTTTGAATCAAATTTTAGG + Intronic
917876941 1:179294352-179294374 ATGAGCTTGATTAAAGGTTCTGG - Intronic
918481274 1:184979139-184979161 TTGACTTTTATTTTAATTTCAGG - Intergenic
918840334 1:189527654-189527676 ATAACTTTGTATAAAATTACAGG - Intergenic
919162534 1:193850131-193850153 AATATTTTGCTTAAAATTTCTGG - Intergenic
919214079 1:194529246-194529268 AACACATTAATTAAAATTTCAGG + Intergenic
919587178 1:199453169-199453191 ATGACATAGAATAAAATTACAGG - Intergenic
919735773 1:200949543-200949565 AAGACCTTGATTCAAAGTTCTGG + Intergenic
920156495 1:203956254-203956276 ATCATTTTGATTAAAATTTGGGG + Intergenic
920320196 1:205115194-205115216 ATAACTTTGTATAAACTTTCTGG + Intronic
920691737 1:208152242-208152264 ATGACTTCTTTTAAAATCTCTGG - Intronic
920728802 1:208463160-208463182 ATGAATTTGATTAATATCACAGG + Intergenic
921730361 1:218571152-218571174 ATGACTATTTTTAAAATCTCAGG - Intergenic
922077372 1:222260239-222260261 ATGACTAAAATTAAAATTACTGG + Intergenic
922681239 1:227598045-227598067 ATGACTCTAGTTAAAATTTTTGG - Intronic
923911644 1:238453055-238453077 ATCATTTTGATTAAAATGTGGGG - Intergenic
924443647 1:244107930-244107952 ATTACTATTATTCAAATTTCAGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063505427 10:6593743-6593765 ATGACTCTGTTTTAAATTTCAGG + Intergenic
1065198990 10:23296064-23296086 ATGCCTTTGAATACAATTTATGG - Intronic
1065264794 10:23963784-23963806 ATGGCTATGATTAAAAAGTCAGG - Intronic
1065771537 10:29082789-29082811 ATGGCTCTGGTTAAAAATTCCGG + Intergenic
1065905971 10:30252361-30252383 ATGACTTTGATTTTAGTATCAGG + Intergenic
1066225141 10:33375269-33375291 AAACCTTTGATTACAATTTCTGG - Intergenic
1066670508 10:37832900-37832922 ATGAATTTGAAAAATATTTCGGG - Exonic
1067420411 10:46140527-46140549 ATGACTTTGAATAGAATTGGAGG + Intergenic
1067425610 10:46208992-46209014 ATGACTTTGAATAGAATTGGAGG - Intergenic
1067505755 10:46847010-46847032 ATGACTTTGAATAGAATTGGAGG + Intergenic
1067867073 10:49920092-49920114 GTGATTTTTTTTAAAATTTCAGG - Intronic
1069287801 10:66738146-66738168 ATGACTTTGATTATTCTTTTTGG + Intronic
1069651041 10:70049057-70049079 AAGACTATGCTTATAATTTCTGG - Intergenic
1069872914 10:71544077-71544099 ATAACTCTGATTAAAAGCTCAGG - Intronic
1070201029 10:74206770-74206792 ATCACTGTTTTTAAAATTTCAGG + Intronic
1070351580 10:75597705-75597727 ATAACTTTGAATAAAAATTCAGG - Intronic
1071169768 10:82850323-82850345 ATGTCTTTGATTGACATTTCTGG + Intronic
1071373443 10:84977417-84977439 ATGGCGATCATTAAAATTTCAGG + Intergenic
1072454752 10:95566016-95566038 ATGACTATGGTCAATATTTCGGG - Intergenic
1073380243 10:103072675-103072697 CTGTCTTTAATTAAAATTGCTGG + Intronic
1073575580 10:104620076-104620098 ATTACTTTAATTAAAATTTAGGG - Intergenic
1074109837 10:110414987-110415009 CTGACGTTGATTAGAATTGCTGG + Intergenic
1075793258 10:125100983-125101005 ATTACTTTTATTAAAAGTTCTGG - Intronic
1076264139 10:129095985-129096007 TTGAATTTGATTAAAATTGTAGG - Intergenic
1077812648 11:5654126-5654148 ATGATTTTGAATAATTTTTCAGG + Intergenic
1078376667 11:10800535-10800557 ATTACTTTGCTTAACATCTCAGG + Exonic
1079544354 11:21614658-21614680 ATCATTTTCATTAAAATTGCTGG + Intergenic
1079779228 11:24578409-24578431 ATGACTATGGATAAGATTTCTGG - Intronic
1080309300 11:30870720-30870742 GTGACTTTGATTACAATATCAGG - Intronic
1083194610 11:61077934-61077956 ATGACCTTTGTTAAAAATTCAGG - Intergenic
1083385672 11:62307561-62307583 ATGACTATTATTAAAACATCAGG - Intergenic
1085870325 11:80341920-80341942 ATGAATTTGATTATAAGTTAAGG + Intergenic
1085987379 11:81802864-81802886 ATGACTTTGAATAGAATTTGAGG + Intergenic
1086212279 11:84335092-84335114 AGGACTTTAATTAAAATATAAGG - Intronic
1086795429 11:91095621-91095643 ATGACATTCATTAAAAAATCAGG + Intergenic
1086859700 11:91910578-91910600 AAGAATTTGAATAGAATTTCAGG - Intergenic
1086997931 11:93379982-93380004 ATGACTTTCATTTAAATTAGTGG + Intronic
1087582522 11:100076275-100076297 ATGACTTTGTTTTATGTTTCTGG + Intronic
1087805429 11:102550498-102550520 ATGATATTGTTTAGAATTTCTGG + Intergenic
1087991913 11:104754846-104754868 ATGGCTTTATTTAAAATTTCTGG + Intergenic
1088041812 11:105394605-105394627 ATTACTTCAATAAAAATTTCTGG - Intergenic
1088191729 11:107234958-107234980 ATAAATCTGATTAAAATTTGGGG - Intergenic
1088987457 11:114922239-114922261 AGGACAATGACTAAAATTTCTGG + Intergenic
1089052452 11:115557557-115557579 ATGACATGGATTAAAGTTTCTGG - Intergenic
1092018906 12:5183750-5183772 AAAGCTTTGATTAAAAATTCTGG + Intergenic
1092138897 12:6169151-6169173 ATGACTTTGCCTAAGAGTTCAGG - Intergenic
1092679739 12:10965875-10965897 ATGACTTTGATTAAAAAGTTTGG - Intronic
1093233199 12:16574210-16574232 ATCACATTGATTTAAATTACAGG + Intronic
1093417872 12:18941431-18941453 ATGATTCTAATTAAAATTCCGGG + Intergenic
1094231692 12:28112373-28112395 CAGACTTTGCTTAATATTTCTGG - Intergenic
1094259662 12:28478935-28478957 ATGACATTCATTAAAATATCGGG + Intronic
1094788693 12:33883192-33883214 ATGACAATTATTAAAAATTCAGG + Intergenic
1096110470 12:49026229-49026251 ATGACTTTGATTACAAACTCCGG + Exonic
1096160473 12:49372619-49372641 CTGCCTTTGATTGAAATTTAGGG + Intronic
1097650761 12:62294710-62294732 ATGACATTTTTTAAAATTTGAGG + Intronic
1097740322 12:63234088-63234110 ATGACTTTGAATAAAATGGAAGG + Intergenic
1097781362 12:63708844-63708866 ATTACACTGATTGAAATTTCTGG - Intergenic
1098683663 12:73391829-73391851 GTGAAATTTATTAAAATTTCAGG - Intergenic
1098723275 12:73929028-73929050 ATGACTATCATTAAAAAGTCAGG + Intergenic
1098981264 12:76959074-76959096 ATGACTTTTATTATAATAACTGG + Intergenic
1099080025 12:78166048-78166070 ATGACTTTGTTGAAATATTCTGG - Intronic
1099240238 12:80129732-80129754 GTGACTATGAATAAAATTTCAGG - Intergenic
1099362498 12:81722455-81722477 TTGACCTTTATTAAAATTACAGG + Intronic
1099517894 12:83621580-83621602 ATTACTTTTATGAAAACTTCTGG - Intergenic
1100755486 12:97746846-97746868 ATGACTTTCTCTAAAATATCAGG - Intergenic
1101704487 12:107209297-107209319 AGGACTTTTATTATAATATCTGG + Intergenic
1103171093 12:118820641-118820663 TTGACTTTGTTTAGAATTACTGG + Intergenic
1103211324 12:119168830-119168852 ATCTCTTTCATAAAAATTTCTGG - Intergenic
1104316580 12:127708788-127708810 ATTATTTTGATTAGAATTTCAGG - Intergenic
1104455044 12:128904026-128904048 ATTTCTTTAATTAAAAGTTCTGG - Intronic
1106265635 13:28107238-28107260 ATGATTTTGAAGAAAATCTCTGG - Intergenic
1106280911 13:28269815-28269837 ATGGCTTGGAATAAAATTTCTGG - Intronic
1107647425 13:42509472-42509494 ATCATTTTGAATATAATTTCAGG + Intergenic
1107723939 13:43278075-43278097 ATGATTTTGCTTAGAATTGCTGG - Intronic
1107831914 13:44382136-44382158 ATTACTTCTATTAAAATTTTAGG + Intronic
1108564451 13:51681391-51681413 GTGAATTTGAAGAAAATTTCAGG + Intronic
1108687650 13:52834831-52834853 ATGACTTTAATGATAATTTTAGG - Intergenic
1108940096 13:55941967-55941989 AAGACATTAATTAAAATTTTTGG - Intergenic
1109270937 13:60254295-60254317 ATGACGATCATTAAAATGTCAGG + Intergenic
1109691302 13:65893663-65893685 ATGGGTTTGATTAAAATCTGGGG + Intergenic
1110280618 13:73689340-73689362 AGGACTGTGATTAAACATTCAGG - Exonic
1110384658 13:74894851-74894873 ATTACTGACATTAAAATTTCAGG - Intergenic
1111329771 13:86749501-86749523 ATGACTATAATTAAAATTTATGG + Intergenic
1111356621 13:87114593-87114615 ATGATCTTCATTAAACTTTCTGG + Intergenic
1111594978 13:90399895-90399917 ATAGCTTTGTTTAAAATTTTGGG - Intergenic
1111804446 13:93021601-93021623 AGGACTTTGATTAAAAGATGAGG + Intergenic
1112572172 13:100602922-100602944 ATTAATTTGATTGATATTTCAGG - Intergenic
1112753073 13:102601298-102601320 ATGAGTTGACTTAAAATTTCAGG - Intronic
1112920644 13:104607754-104607776 ATGACTGAGAGTAAAATCTCAGG + Intergenic
1113033568 13:106022790-106022812 AGCACTTTGATTAATATTTTTGG + Intergenic
1114329426 14:21621502-21621524 ATCACTTGGATTAAAATGTGTGG + Intergenic
1115198060 14:30823080-30823102 ATGGCTAAGATTTAAATTTCAGG - Intergenic
1115375026 14:32665282-32665304 GGCACTTTGATTAGAATTTCTGG - Intronic
1115756510 14:36531858-36531880 ATGACTTTATTTTAGATTTCAGG + Intergenic
1116337975 14:43683383-43683405 ATAACTTATATTAAAATTCCTGG - Intergenic
1116389049 14:44369947-44369969 ATGACTCAGATTTACATTTCTGG + Intergenic
1117198983 14:53369261-53369283 ATGACTTTCACTAAATTTTCAGG - Intergenic
1117838918 14:59836941-59836963 AAGCATTTGATTAAAATTTCAGG - Intronic
1118521642 14:66592623-66592645 ATGGCTATCATTAAAATGTCAGG + Intronic
1118522658 14:66603434-66603456 ATGACTTTGAACTAAATTTTTGG - Intronic
1119135732 14:72217245-72217267 ATCACCTTGATTAAAGTTTTGGG - Intronic
1119963675 14:78888652-78888674 ATAACTTTGAATAAACTTTGTGG - Intronic
1120053191 14:79892270-79892292 ATGACTTTGAATAGAATGTTAGG + Intergenic
1120377039 14:83722013-83722035 ATGACTTTAATTTAAAATTATGG + Intergenic
1120494239 14:85214653-85214675 ATGACTCTTATTAAAAAGTCAGG + Intergenic
1120606817 14:86589496-86589518 ATGATTCTGAATAAAATTCCAGG - Intergenic
1121190274 14:92021506-92021528 AAAACTTTGAGTAAAATTACTGG - Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1124018195 15:25896364-25896386 ATGACCTTGATTTAAATTGTTGG - Intergenic
1124875280 15:33586215-33586237 TTGACTTTGATAAAAATCTTGGG + Intronic
1125067929 15:35513911-35513933 AAGACTTTTATGAAAATTTAAGG - Intronic
1125357272 15:38829585-38829607 ATTACTTTGATTACAATTATTGG + Intergenic
1125818774 15:42609737-42609759 TTCACTTAAATTAAAATTTCAGG - Intronic
1125971781 15:43917683-43917705 ACCACTATGTTTAAAATTTCAGG - Intronic
1126293417 15:47109107-47109129 ATGATGATGATTAAAATGTCAGG - Intergenic
1126313767 15:47346130-47346152 AAGACTTAGTTTAAAAATTCTGG + Intronic
1126946192 15:53823202-53823224 ATGACTTTGAATAGAATGGCAGG + Intergenic
1127045333 15:55019294-55019316 AACACTTTGATTAAAAGTTTGGG - Intergenic
1129128487 15:73467254-73467276 CTGACATTGATTAGAATTACTGG + Intronic
1130216673 15:81978238-81978260 ATACTTTTGATTAAAATTACTGG - Intergenic
1130678608 15:85976448-85976470 ATGGCTTTGAGGAAATTTTCAGG + Intergenic
1130992459 15:88884150-88884172 ATGACTTTGCTTACATATTCAGG + Intronic
1131640275 15:94284964-94284986 AAAATTTTGATTAATATTTCAGG + Intronic
1132616436 16:843202-843224 ATGACCCTGATTAATATTTAAGG - Intergenic
1132767263 16:1540741-1540763 ATGACTTGCCTTGAAATTTCAGG - Intronic
1133674210 16:8054965-8054987 ATGAGATTGATTTAAATTTGTGG - Intergenic
1133820340 16:9230571-9230593 ATGAGTTTGATGAAAATCTTGGG - Intergenic
1133909743 16:10054525-10054547 ATGCCTGTAAGTAAAATTTCTGG - Intronic
1134859764 16:17550769-17550791 ATGACTTTGAATAAAATGGGAGG - Intergenic
1134903515 16:17959782-17959804 ATGCCTTGGATTAAAGTTTATGG - Intergenic
1135333246 16:21579117-21579139 ATGTCTTTGATTAAAGTATCAGG - Intergenic
1135693728 16:24567616-24567638 ATGGCTTTGGTTTAAATTTTAGG - Intronic
1137312326 16:47276235-47276257 ATGACTATTATTGAAATTTAAGG - Intronic
1139035360 16:62939409-62939431 ATTACTTTTTTAAAAATTTCTGG + Intergenic
1140492744 16:75353408-75353430 ATGATTTTGAAGCAAATTTCAGG - Intronic
1140637482 16:76932297-76932319 AGGACTTTCAGTAAAATATCAGG - Intergenic
1140733568 16:77877859-77877881 ATGGCTATGATTGAAATTACTGG - Intronic
1141143343 16:81512204-81512226 TTGATTTGGATTAAAATTTTCGG + Intronic
1142335159 16:89484149-89484171 ATGATTTTGACTAAGATGTCTGG - Intronic
1146438701 17:32875590-32875612 ATCATTTTGATTAATATTTGGGG + Intronic
1146477022 17:33171226-33171248 ATGGCTTTGATAAAATTTCCTGG - Intronic
1147434393 17:40399159-40399181 ATGATTTTGAGTAATATTTTAGG + Intronic
1148498533 17:48070938-48070960 ATCATTTTGATTAACATTTGGGG - Exonic
1148569470 17:48656699-48656721 CTGACCTTGATTTATATTTCTGG + Intergenic
1150546728 17:66166331-66166353 AAAACTTTGATTAAAAGTTAGGG - Intronic
1155214131 18:23628021-23628043 ATTACATTGATTACAATGTCTGG + Intronic
1156254949 18:35386004-35386026 ATGACTTGTATTCAAATTTGCGG - Intergenic
1156994481 18:43449040-43449062 ATGACGATGATTAAAAAGTCAGG + Intergenic
1157500320 18:48185942-48185964 ATGCCTTAGTTTTAAATTTCAGG + Intronic
1157976912 18:52338511-52338533 ATCACTTTTCATAAAATTTCAGG + Intergenic
1158274968 18:55757190-55757212 CTGACTTTGAATAAGAATTCAGG + Intergenic
1159080992 18:63735866-63735888 ATTGCTTTTATTAAAAATTCAGG + Intergenic
1159311257 18:66713268-66713290 ATGAATTTTATTGAAATTTATGG - Intergenic
1159401403 18:67940599-67940621 ATGATTTTGATTTATATTTCTGG - Intergenic
1159626172 18:70697253-70697275 ATGGCTATTATTAAAAATTCAGG - Intergenic
1159732017 18:72039369-72039391 ATGTGTTTTATTAAAATTTGTGG - Intergenic
1159857219 18:73603561-73603583 ATGACTTTGGTTTAAATGACTGG - Intergenic
1160028597 18:75239305-75239327 TTTATTTTGATTAAAATCTCAGG + Intronic
1162123882 19:8489082-8489104 ATGACTTTGATAATAAATACCGG + Exonic
1163773606 19:19205322-19205344 ATGAATTTGAATAAAATATGTGG + Intergenic
926576834 2:14591900-14591922 ACTACTTTGACAAAAATTTCAGG + Intergenic
926810897 2:16754675-16754697 CTGACTCTGCCTAAAATTTCAGG + Intergenic
928663671 2:33529184-33529206 AGGATTTTCAATAAAATTTCAGG + Intronic
928880816 2:36094431-36094453 ATTACTTTAATTTAAATTTATGG + Intergenic
929266727 2:39926691-39926713 GTGACTTTAATTAGAATATCAGG + Intergenic
929326669 2:40620264-40620286 ATGACCTTGCTAAAAATTCCAGG - Intergenic
930265962 2:49199377-49199399 ATGATTTTGAATAATATCTCTGG + Intergenic
930419317 2:51130948-51130970 CTGACATTGATTAGAATTGCTGG - Intergenic
930666533 2:54104783-54104805 ATTAATTACATTAAAATTTCTGG + Intronic
930704968 2:54495823-54495845 ATAATTTTGTTTAAAAATTCTGG + Intronic
931304417 2:61014757-61014779 ATGAACTTGCTTAAAATTTGTGG + Intronic
931476133 2:62589538-62589560 ATGATTTTAATTCATATTTCAGG + Intergenic
931541457 2:63334097-63334119 ATTACTTTGTTTACAATTGCCGG + Intronic
931642444 2:64393710-64393732 ATAACTTTGATTAAATTAACAGG + Intergenic
932190573 2:69738662-69738684 ATGTCTTGGAGTAAACTTTCTGG + Intronic
934878983 2:97956454-97956476 ATTACTTTGATCAAAGTTTCAGG + Intronic
935950114 2:108321000-108321022 ATGACTATGATTTGAATTGCTGG - Intergenic
937566963 2:123305734-123305756 GAGACGTTGATTAAAATTACAGG - Intergenic
937867668 2:126766245-126766267 ATGCATGTGATTAAATTTTCTGG - Intergenic
939075710 2:137600197-137600219 ATGAATTTCATTAAAACTTATGG + Intronic
939088645 2:137752557-137752579 AACACTCTGATGAAAATTTCTGG + Intergenic
939299970 2:140322993-140323015 AAGACTTTGGATAAAATTTCAGG + Intronic
939588024 2:144029003-144029025 TTGCCTTGGACTAAAATTTCAGG + Intronic
939724575 2:145700696-145700718 ATGACTTTTATTCAAAAGTCAGG - Intergenic
939767923 2:146276365-146276387 AAGAAAGTGATTAAAATTTCAGG + Intergenic
940440638 2:153712079-153712101 AGGAATATGATTACAATTTCAGG - Intergenic
940728721 2:157364765-157364787 ATGACTTAGATTACCATTGCAGG + Intergenic
941548739 2:166888176-166888198 ATGACTTTGAATTAAATATTAGG + Intergenic
942623539 2:177874875-177874897 ATAACTTGGATTCAAAGTTCAGG + Intronic
942910682 2:181240417-181240439 ATGACCCTGATTAGATTTTCAGG + Intergenic
943143475 2:184012780-184012802 ATGACTTTAGTTTATATTTCAGG + Intergenic
943367704 2:186981570-186981592 ATGACTTTGCCTAAAAATCCTGG + Intergenic
943455443 2:188102136-188102158 AGGACTTTGATTTAATTTTTTGG - Intergenic
943474220 2:188334468-188334490 ATAAATTTGATTAAAATCTCTGG + Intronic
943925292 2:193769379-193769401 ATGACAATTTTTAAAATTTCAGG + Intergenic
944617718 2:201479467-201479489 ATAACTTTCTTAAAAATTTCAGG + Exonic
945109248 2:206347009-206347031 ATGATTTTGATTTATATTTTGGG + Intergenic
945503951 2:210614568-210614590 ATGGCTGTCATTAAAAATTCAGG - Intronic
946343487 2:219088326-219088348 ATGAATTTCATTAATATTTCGGG + Intronic
947581573 2:231322795-231322817 AGGAATTTGACTAAAATTACTGG - Intronic
1168869381 20:1115476-1115498 ATGAAGTTGATTCAAATTGCTGG - Intronic
1169579063 20:6998331-6998353 GTGACTTTGATTGACATTCCAGG + Intergenic
1169634375 20:7671717-7671739 ATGACTTTGAATAACACTTTTGG + Intergenic
1170038518 20:12016002-12016024 TTCAGTTTGATTAAAATGTCTGG + Intergenic
1170586806 20:17741033-17741055 ATGATTTTGATTAGGATTTATGG + Intergenic
1172495212 20:35377084-35377106 ATGACTTTGATTTTGATATCAGG - Intronic
1172542089 20:35726471-35726493 ATGACTATGATTAAACTGTCAGG - Intronic
1173260324 20:41429248-41429270 AAGATTTTGTTTACAATTTCAGG + Intronic
1173758396 20:45538426-45538448 ATGATTGAGATTAACATTTCTGG + Intronic
1174618223 20:51852979-51853001 ATGACTTTGCCTACACTTTCAGG - Intergenic
1177516388 21:22156822-22156844 AAAACTTTGATTATAATTTCTGG + Intergenic
1177535109 21:22415655-22415677 TTGACTTTGAGCAAAATTTCAGG - Intergenic
1178386350 21:32153829-32153851 ATCCATTTGATAAAAATTTCTGG + Intergenic
1178599971 21:33986664-33986686 AGGGCCTTGATTAAAATTTGAGG + Intergenic
1178975135 21:37214728-37214750 ATGACTTTTAACAAAATTTATGG - Intergenic
1179493038 21:41753862-41753884 ATAACTTGGTTTAAAATCTCAGG - Intronic
1179649436 21:42797565-42797587 ATGACTTTGAATAAAATGAGAGG - Intergenic
1180821931 22:18835702-18835724 ATGACTTTCTTTAAAACCTCTGG - Intergenic
1181191044 22:21140345-21140367 ATGACTTTCTTTAAAACCTCTGG + Intergenic
1181208156 22:21270153-21270175 ATGACTTTCTTTAAAACCTCTGG - Intergenic
1182544526 22:31067054-31067076 CTGCCTTAGATTAAAATTGCAGG - Intronic
1184627055 22:45743465-45743487 ATGACTTTGGTTATAGTTTTGGG + Intronic
1203218769 22_KI270731v1_random:25249-25271 ATGACTTTCTTTAAAACCTCTGG + Intergenic
1203272058 22_KI270734v1_random:61577-61599 ATGACTTTCTTTAAAACCTCTGG - Intergenic
949310539 3:2692566-2692588 ATTTCTTTGACTAAAATATCCGG + Intronic
951356469 3:21672870-21672892 CTAACTTTGATGACAATTTCTGG + Intronic
951408798 3:22336209-22336231 GCGGCTTTGTTTAAAATTTCTGG - Intronic
951421588 3:22492524-22492546 CTGACATTGTTTAAAATTGCTGG - Intergenic
951755854 3:26090392-26090414 ATCACTTAGATTATAATTTGAGG + Intergenic
952002717 3:28805315-28805337 ATGACTAGTATTACAATTTCTGG - Intergenic
952423479 3:33152078-33152100 ATGACTATTTATAAAATTTCAGG + Exonic
953085372 3:39660330-39660352 ATAACTAAGAGTAAAATTTCTGG - Intergenic
953428309 3:42814807-42814829 AGTACTTTGAATGAAATTTCAGG + Intronic
954049654 3:47963495-47963517 ATGAATTTGTTTAAATTTTGAGG - Intronic
954851256 3:53602624-53602646 ATGACTTTTATCAAAAATACAGG - Intronic
955636100 3:61031191-61031213 ATGACTTTGTTTACAAGTTTTGG + Intronic
956978340 3:74608751-74608773 AAGACTTTGGTAAATATTTCTGG - Intergenic
957565080 3:81875185-81875207 GTGAACTTGACTAAAATTTCAGG + Intergenic
958154298 3:89733362-89733384 ATGACTAGGAATAGAATTTCTGG - Intergenic
958688145 3:97425989-97426011 ATGGCTTTGATCAAAATGTATGG - Intronic
958703696 3:97626159-97626181 ATAACTTTGATGAAGATTTTTGG - Intronic
958749625 3:98179557-98179579 ATGACGATCATTAAAATGTCAGG + Intronic
958974349 3:100649632-100649654 TTGACTTTCATTAACACTTCAGG + Intronic
959295925 3:104533815-104533837 ATGATTTTGAGTAAATTTTTGGG - Intergenic
959304635 3:104645618-104645640 ATAATTCTGATTACAATTTCTGG - Intergenic
959458283 3:106591436-106591458 ATTGCTTTGGTTCAAATTTCTGG - Intergenic
959690242 3:109190388-109190410 ATGACTTTGAATAAAATGGGAGG - Intergenic
960174668 3:114502550-114502572 ATGAGTTTAATGAAAATTTTAGG + Intronic
960351385 3:116597483-116597505 ATCAATTTGCTTTAAATTTCAGG - Intronic
960428555 3:117539762-117539784 AAGTCTTTGATAAATATTTCTGG + Intergenic
960588306 3:119341983-119342005 ATGATTTTGATCAACATTTTAGG - Intronic
960759608 3:121058644-121058666 ATGGCTATGATTAAAAAGTCAGG - Intronic
962050724 3:131812116-131812138 ATGATTTTGACTAAAAGTTAGGG - Intronic
962742783 3:138374585-138374607 ATCTCATTGATTAAAATCTCTGG + Intronic
963493593 3:146032283-146032305 ATGACTTTGATTTGAATATTGGG - Intergenic
964756078 3:160091923-160091945 ATGACTTTGCCTAAAAATGCTGG + Intergenic
965417267 3:168412405-168412427 ATGACTGTGAGTACAATTTCAGG - Intergenic
966186784 3:177234479-177234501 AGGAATGTAATTAAAATTTCAGG - Intergenic
966960463 3:184932310-184932332 ATGATTCTGTTTAAAGTTTCAGG + Intronic
967798401 3:193625532-193625554 ATACATTTGATTAAAATTTGGGG - Intronic
968162055 3:196434682-196434704 ATGATTTTGATTAACAGTGCAGG + Intergenic
970489384 4:16556858-16556880 ATTACTTTGGTTCAAATTTGGGG + Intronic
970528822 4:16961289-16961311 ATGATTTTAACTAAATTTTCTGG - Intergenic
971602924 4:28618712-28618734 ATAACTTTTCTTAAAATTTGAGG + Intergenic
972061363 4:34877744-34877766 ATGACTATCATTAAAAAGTCAGG + Intergenic
972483123 4:39516710-39516732 ATTAGTTTGATTAAAATAACAGG + Intronic
973535183 4:51873985-51874007 ATGACTTAGATTAGTATTTTTGG + Intronic
974166014 4:58203114-58203136 ATCACTCTGAGTCAAATTTCAGG - Intergenic
974552111 4:63390076-63390098 ATAATTTTGAATAAAATGTCAGG - Intergenic
975183881 4:71378732-71378754 TTTACTTTGATGAAAATTGCTGG + Intronic
975499095 4:75065513-75065535 ATGACATTGATTAAGATGTTAGG + Intergenic
976461532 4:85318464-85318486 AAGAAATTGATTAAAATTGCTGG - Intergenic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
976981126 4:91230837-91230859 ATGACTTTAAGTATAATTTTTGG - Intronic
977119448 4:93079532-93079554 CTGACTTAGATTAGAATGTCTGG - Intronic
977128648 4:93204065-93204087 TTGACTTTGCTTAAAAATTGAGG + Intronic
977646057 4:99413936-99413958 ATGACTGAGATAAAAATTACTGG + Intronic
977732483 4:100370572-100370594 ATCACTTTAATTCTAATTTCAGG + Intergenic
977799775 4:101213142-101213164 ATGACTTTGATTAAAATTTCTGG - Intronic
978123848 4:105111575-105111597 GTAACTGTGAATAAAATTTCTGG + Intergenic
978849049 4:113310857-113310879 ATGAGTTTTATTAACATTTCAGG - Intronic
978994665 4:115135626-115135648 ATGACTTTAGTAAAAGTTTCAGG + Intergenic
979539787 4:121868937-121868959 ATGACTTTAATACAATTTTCTGG - Intronic
980015888 4:127650171-127650193 ATGGATTTAATTAGAATTTCAGG + Intronic
980543635 4:134228832-134228854 ATGACATTTTTTAAAATGTCAGG + Intergenic
981815192 4:148823137-148823159 ATAAGTTTGATTAAGTTTTCTGG - Intergenic
982387333 4:154824194-154824216 ATGGGTATGATTAAAATTGCTGG + Intronic
983187786 4:164720435-164720457 ATGACTCCAATTAAACTTTCAGG - Intergenic
983193019 4:164774259-164774281 ATGTCTTTGTTTTAAATATCTGG + Intergenic
983268969 4:165538898-165538920 GTGACTTTGACTAAAATTCTAGG - Intergenic
983394227 4:167172888-167172910 ATTACTTTAAATAATATTTCAGG + Intronic
984257930 4:177409517-177409539 ATGAGTTTGATGATAATTGCGGG + Intergenic
987686276 5:21207467-21207489 AAAACTTAGATTAAAATTTCAGG + Intergenic
988204130 5:28112776-28112798 ATACCTTTGATTAAACTTTAAGG - Intergenic
988276264 5:29084532-29084554 GCAACCTTGATTAAAATTTCTGG - Intergenic
988681135 5:33485266-33485288 ATGACTTAAATAAAAACTTCAGG + Intergenic
988910845 5:35840778-35840800 ATGACTTTGATTAAAATGGGAGG + Intergenic
988910909 5:35842206-35842228 ATGACTTTGATTAGAATGGGAGG + Intergenic
989974748 5:50571512-50571534 ATGGCTTTTATTCAAATGTCAGG + Intergenic
990090652 5:52043138-52043160 GTGACTTTGATCAAAATCTTTGG + Intronic
990113386 5:52356624-52356646 ATGACTGTGATGAATATTACAGG - Intergenic
990136706 5:52653816-52653838 ATGATTTTAATGAAAATTTATGG - Intergenic
990206159 5:53431707-53431729 ATCCCTATGATTAAAAATTCAGG - Intergenic
990577410 5:57136552-57136574 CAGACTTTGATGAAAATTTTGGG - Intergenic
992545301 5:77808863-77808885 ATTTCATTGAATAAAATTTCAGG - Intronic
993625018 5:90213667-90213689 ATGGCTATCATTAAAAATTCAGG + Intergenic
993821010 5:92617041-92617063 CAGACTTTTATTAAAATTTCAGG + Intergenic
993822355 5:92634191-92634213 TTGACTTTCATTAATATTTAAGG - Intergenic
993891303 5:93477777-93477799 ATGATTTTCATTAAAGTTTTTGG - Intergenic
994011574 5:94910031-94910053 AAGTCTTTGATTAAAGCTTCGGG + Intronic
994388115 5:99157154-99157176 ATAATTTTGTTTATAATTTCAGG + Intergenic
994619918 5:102150785-102150807 ATGACTTTGAATAAAATGGGAGG - Intergenic
994654462 5:102573096-102573118 ATGACTTTTATCAAAAAATCTGG + Intergenic
995917560 5:117267148-117267170 GTTTCTTTGATTAATATTTCTGG - Intergenic
995955114 5:117768520-117768542 AAGAGTTTGATTGAAATTTGAGG + Intergenic
995968119 5:117934236-117934258 ATGTATTTGTTTATAATTTCAGG + Intergenic
996688601 5:126312337-126312359 ATTACTTTAATTTAAAATTCTGG + Intergenic
997140732 5:131377467-131377489 ATGACTATTATTAAAAAGTCAGG - Intronic
998068564 5:139178583-139178605 AGGACGTTGAGGAAAATTTCAGG - Intronic
998701308 5:144703055-144703077 ATGAATCAGATTAAAATTTGGGG + Intergenic
999932404 5:156447798-156447820 ATGACTTTTATTTTAAGTTCTGG - Intronic
1000944310 5:167401581-167401603 GTGGCTTTGATTAAAATTCACGG - Intronic
1001375717 5:171255756-171255778 TTGACTGTGATTAAAATGTGGGG + Intronic
1002544668 5:179932076-179932098 TTCACTTTAGTTAAAATTTCAGG + Intronic
1002985368 6:2185421-2185443 ATTATTTTGATTAAAATATTTGG - Intronic
1003338997 6:5201786-5201808 ATGAATTTTATTAAAATTTTAGG - Intronic
1003598370 6:7495268-7495290 ATCAATTTTATTAAAACTTCTGG + Intergenic
1003696955 6:8416904-8416926 CTGGCTTTGATTAAAATTTTTGG - Exonic
1003707370 6:8547870-8547892 ATGACTTTTAGTCAGATTTCAGG - Intergenic
1004218842 6:13727527-13727549 AGGATTCTGATTTAAATTTCTGG + Intergenic
1004483873 6:16047350-16047372 GTGAGTTTGATAAAAAATTCTGG + Intergenic
1005103862 6:22202271-22202293 ATGCATTTTATTAAAATTTTTGG + Intergenic
1005130478 6:22501690-22501712 ATAACCTTGATGAAGATTTCAGG - Intergenic
1005164639 6:22905777-22905799 ATGACTTTTTGTGAAATTTCAGG - Intergenic
1005712841 6:28518671-28518693 GTGACTTTTATTAATATCTCAGG + Intronic
1008073930 6:47126446-47126468 ATAACTATGATTAAAATGTCAGG - Intergenic
1008168039 6:48165237-48165259 AAGAGTTTCTTTAAAATTTCTGG - Intergenic
1008829529 6:55740995-55741017 ATGACTATCATTAAAAAGTCAGG + Intergenic
1008980949 6:57483262-57483284 ATGGCTTTGATTAAAGCCTCAGG + Intronic
1009058359 6:58366428-58366450 ATGACTTTAATTGAGTTTTCTGG - Intergenic
1009169042 6:60376224-60376246 ATGGCTTTGATTAAAGCCTCAGG + Intergenic
1009232470 6:61080691-61080713 ATGACTTTAATTGAGTTTTCTGG + Intergenic
1009372787 6:62928634-62928656 ATGGCGATCATTAAAATTTCAGG + Intergenic
1009478754 6:64129292-64129314 ATGACGATCATTAAAATGTCAGG - Intronic
1009482301 6:64174158-64174180 ATGTCTTTAAATAAAATATCTGG + Intronic
1009513808 6:64588151-64588173 ATCACTGTGATGAAAATTTTAGG + Intronic
1010212683 6:73374507-73374529 ATGTGTTTGACTACAATTTCAGG - Intronic
1010338674 6:74721977-74721999 ATGGCGATGATTAAAAATTCAGG - Intergenic
1011290082 6:85767924-85767946 ATAACTTTAAATATAATTTCAGG + Intergenic
1012101643 6:95095757-95095779 AGGAATTTGATATAAATTTCAGG + Intergenic
1012596452 6:101046841-101046863 ATGGCATTCATTAAAAATTCAGG - Intergenic
1012596641 6:101048852-101048874 ATGGCGTTGATTAAAAATTCAGG - Intergenic
1013921548 6:115411069-115411091 ATGACAATGCTTAAACTTTCAGG + Intergenic
1014068768 6:117157298-117157320 ATGCCTTTAATTAAGCTTTCTGG + Intergenic
1014159112 6:118146844-118146866 ATGAATTTGATTAAACTCTTTGG - Intronic
1014308762 6:119772428-119772450 AAGAATTTTATTAAAATTTTAGG - Intergenic
1014496737 6:122134071-122134093 ATGACTTTGGTTAAACTATTTGG + Intergenic
1014549737 6:122776835-122776857 TTGACTTTTTCTAAAATTTCTGG + Intergenic
1015408104 6:132860031-132860053 TTAACTCTGATTTAAATTTCGGG - Intergenic
1015829636 6:137354250-137354272 GTGACTTTGATTAAGAGTTGTGG + Intergenic
1016138029 6:140570789-140570811 TTGACCTTGTTTAAAATCTCAGG - Intergenic
1016899961 6:149091728-149091750 AACACTTTAAATAAAATTTCAGG + Intergenic
1016985555 6:149892376-149892398 ATGACGTTCATTAAAAAGTCAGG - Intronic
1018649549 6:165981389-165981411 GTGACTTTGATTATGATTTTGGG - Intronic
1018766914 6:166941200-166941222 ATGACTTACTTTAAATTTTCAGG - Intronic
1019755399 7:2765105-2765127 ATCACTTGGATTAAAATCTAAGG + Intronic
1021277203 7:18666498-18666520 ATGACTTTAATTACAAATCCTGG - Intronic
1021367461 7:19797540-19797562 ATGACTTTGCTTAGAAATCCTGG + Intergenic
1022103700 7:27184043-27184065 ATGGCTTTTATAAAAATCTCCGG + Intronic
1022616350 7:31934742-31934764 CTGACCTTGAGTAAAATTTCTGG - Intronic
1022939961 7:35224965-35224987 ATTACACTGATTGAAATTTCTGG - Intronic
1022988641 7:35685674-35685696 ATGAATTTAATTTAAATATCAGG + Intronic
1024407943 7:49004275-49004297 ATGGCGTTGATTAAAAAGTCAGG - Intergenic
1024491894 7:49995080-49995102 ATAAATCTGATTAAAATTTGGGG - Intronic
1024858936 7:53815176-53815198 ATGAATTTGATTTCAATTTATGG + Intergenic
1025770121 7:64496676-64496698 ATAATTTTGATTAAAATATTTGG - Intergenic
1025848927 7:65229479-65229501 ATGGCTATGATTAAAAAATCAGG - Intergenic
1026424018 7:70271596-70271618 ATGTTTTTGATTAGTATTTCTGG - Intronic
1026646143 7:72170721-72170743 ATGACTTTGCTCAAAAAATCTGG - Intronic
1026777656 7:73240722-73240744 AGGACTTTGATAAAAATGACAGG - Intergenic
1027018509 7:74794094-74794116 AGGACTTTGATAAAAATGACAGG - Intergenic
1027069518 7:75151824-75151846 AGGACTTTGATAAAAATGACAGG + Intergenic
1027733453 7:81904089-81904111 ATGACTTTGAATAGAATTGGAGG + Intergenic
1027741768 7:82016957-82016979 AACACTTGGAATAAAATTTCAGG - Intronic
1027805341 7:82813889-82813911 ATCACTTTCATTCAAATTTGAGG - Intronic
1028017347 7:85732477-85732499 ATGACGTGGATGAAAATTTTTGG - Intergenic
1028280743 7:88924978-88925000 ATAACTTGTATTAAAACTTCTGG + Intronic
1028680866 7:93529677-93529699 ACAACTTTGATTAAAATATTGGG + Intronic
1029656432 7:101928135-101928157 ATGTTTTTGACTAAAATTCCAGG - Intronic
1029944153 7:104514038-104514060 ATGAAATTGATTAACATTTTTGG + Intronic
1030440808 7:109586807-109586829 ATGAATATGATTAAAATCTATGG + Intergenic
1030749183 7:113209231-113209253 ATGTCTTTGAATAAAATGCCAGG + Intergenic
1030934872 7:115572921-115572943 ATGATTTCTATTAAAATTTGAGG - Intergenic
1031305751 7:120124591-120124613 ATGACTTTGAATAAAATGGGAGG - Intergenic
1031590790 7:123589988-123590010 ATGACAATCATTAAAAATTCAGG - Intronic
1031780121 7:125951342-125951364 ATGACCTAGATTCAAAATTCAGG - Intergenic
1033010833 7:137620858-137620880 ATCACTGTGATTAAAATTTAAGG - Intronic
1033088481 7:138363998-138364020 ATAATTTTGTTTAAAATTTTTGG + Intergenic
1033563418 7:142555844-142555866 ATGATAGTGATTATAATTTCAGG + Intergenic
1034181581 7:149142815-149142837 CTGACTTTGAGAAAAATTTGTGG + Intronic
1034373240 7:150619685-150619707 AAGACTTTAATTAATATTTGTGG + Intergenic
1034758821 7:153651237-153651259 CTGACTTTGCAAAAAATTTCAGG - Intergenic
1035827871 8:2663825-2663847 ATGGCTATGATTAAAAAGTCAGG - Intergenic
1036012683 8:4745114-4745136 ATGAATTTGATTTAAATGTATGG - Intronic
1037156370 8:15704425-15704447 ATCACTTAGATTAAAATTCAAGG - Intronic
1037254066 8:16931677-16931699 ATCACTCTAAGTAAAATTTCTGG + Intergenic
1039292976 8:36118448-36118470 ATGAATTTGATTATTTTTTCAGG + Intergenic
1039443889 8:37614872-37614894 AAGACTTTTATTCAAATCTCTGG - Intergenic
1040687347 8:49890777-49890799 ATCACTTTCATTAACATATCAGG + Intergenic
1041130873 8:54698359-54698381 ATGACGATCATTAAAATGTCAGG + Intergenic
1042610320 8:70591817-70591839 ATGACATTGATTGAAGTTTTCGG - Intronic
1042783854 8:72524114-72524136 ATCATTTTAATTAAAATTCCAGG - Intergenic
1043219092 8:77636240-77636262 ATGGCATTCATTAAAATGTCAGG - Intergenic
1043292576 8:78621371-78621393 ATGAATTTTTTTAACATTTCTGG + Intergenic
1043467173 8:80522195-80522217 CTGACTTACAGTAAAATTTCAGG + Exonic
1045270661 8:100658351-100658373 AAGACTTTGAATAAAATCTCAGG - Intronic
1045824721 8:106383538-106383560 ATGTGTTTGATTAAAATGTAGGG + Intronic
1046006495 8:108492581-108492603 ATCACTTTAATTATATTTTCAGG + Intergenic
1046587768 8:116168536-116168558 ATGACCTTGAATAAAATATCAGG + Intergenic
1046880781 8:119306105-119306127 ATGACAATAATTAAAAATTCAGG - Intergenic
1047016541 8:120729282-120729304 ATGACTATTATTAAAACGTCAGG - Intronic
1047386557 8:124415545-124415567 TGGACTTTGCCTAAAATTTCAGG - Intergenic
1047576690 8:126163566-126163588 TTAACCATGATTAAAATTTCAGG - Intergenic
1048190877 8:132287399-132287421 ATATCTATGAGTAAAATTTCTGG - Intronic
1048453306 8:134553604-134553626 ATGACTTTGTTTAAGATTCTTGG - Intronic
1049448372 8:142642368-142642390 ATGACTTTGAATAAAATGGGAGG + Intergenic
1051241107 9:15056916-15056938 ATGGCATTCATTAAAATGTCAGG + Intergenic
1051323766 9:15941334-15941356 ATTACTTTGTTTAACACTTCTGG + Intronic
1051728005 9:20108170-20108192 ATGGCAATCATTAAAATTTCAGG + Intergenic
1053704199 9:40733266-40733288 ATGGCTATCATTAAAAATTCAGG - Intergenic
1054414283 9:64856872-64856894 ATGGCTATCATTAAAAATTCAGG - Intergenic
1055204163 9:73707556-73707578 ATTAATTTGAATAAAATTGCAGG - Intergenic
1056422050 9:86438122-86438144 ATGACTTTGAATAGAATGGCAGG - Intergenic
1056721083 9:89072692-89072714 ATGACATTGAAGTAAATTTCCGG + Intronic
1056726555 9:89124162-89124184 ATGGCTTTCATTAAAAAGTCTGG + Intronic
1056824750 9:89869092-89869114 GTCACTTTGTTTAAATTTTCAGG + Intergenic
1059182748 9:112234177-112234199 ATGAATTTGATTATAATTTAAGG - Intronic
1059843879 9:118249331-118249353 ATGACCTTGAATACAACTTCTGG + Intergenic
1059932629 9:119276142-119276164 ATGACTGTGATAGATATTTCAGG - Intronic
1187051293 X:15698167-15698189 CTGACTTACATGAAAATTTCTGG - Intronic
1187197214 X:17099278-17099300 ATCATTTTGATTAAAATTTGGGG - Intronic
1187268139 X:17756114-17756136 ATGAAGTAGGTTAAAATTTCTGG + Intergenic
1187321099 X:18238169-18238191 ATGAAGTAGGTTAAAATTTCTGG - Intergenic
1188827946 X:34859872-34859894 ATGACTTTGAGAAAATTTTCTGG + Intergenic
1189087159 X:38037545-38037567 ATGACTGTGATAAAAATTGTTGG - Intronic
1191609164 X:63092924-63092946 ATGACAATCATTAAAATGTCAGG - Intergenic
1192693406 X:73388987-73389009 ATGACTATAATTGAAATCTCAGG + Intergenic
1193423961 X:81318086-81318108 ATGACTTTCATCCAAATGTCAGG - Intergenic
1193974511 X:88100558-88100580 ATGACTTTGAATAGAATGTGAGG + Intergenic
1194004205 X:88470458-88470480 ATGACTTTGAATAGAATGTGAGG - Intergenic
1194056227 X:89136136-89136158 AACACTTGCATTAAAATTTCTGG + Intergenic
1194111022 X:89835095-89835117 ATAAACTTGATTAAAATTTTCGG + Intergenic
1194304562 X:92226990-92227012 TTTACTGTGATTATAATTTCAGG + Intronic
1194485392 X:94479854-94479876 ATGACTTTGATTAGAATGGGAGG - Intergenic
1194754650 X:97723917-97723939 ATGGCTATCATTAAAATGTCAGG - Intergenic
1194759097 X:97772841-97772863 ATGGCTTACATTAAAATTACTGG - Intergenic
1194903191 X:99540696-99540718 ATTTGTTTGAATAAAATTTCTGG - Intergenic
1195154887 X:102112976-102112998 ATGACTTTCACTAAAATCTTGGG + Intergenic
1196338341 X:114565859-114565881 ATTGCTTTCATTAAAATCTCTGG + Intergenic
1196342499 X:114611995-114612017 ATAACTTGGATTAAAACTTTGGG - Intronic
1196708369 X:118737288-118737310 CTGACATTGATTGAAATTTATGG + Intronic
1197083347 X:122444650-122444672 ATTACTATGATTAAAATACCTGG + Intergenic
1197368579 X:125598228-125598250 ATGACTTTGCTTGAAAATTCTGG - Intergenic
1197964444 X:132043251-132043273 ATGCCTTTGGTTAGAATTTAAGG - Intergenic
1198050353 X:132946094-132946116 ATGGCGATCATTAAAATTTCAGG + Intronic
1198430332 X:136559448-136559470 ATGACTTTTATCAAAAAGTCAGG - Intergenic
1199116947 X:144003903-144003925 ATGATATTGAATACAATTTCTGG - Intergenic
1200014125 X:153146446-153146468 CTGACTTTGATTAAATGTTGTGG - Intergenic
1200025475 X:153253506-153253528 CTGACTTTGATTAAATGTTGTGG + Intergenic
1200463682 Y:3489839-3489861 ATAAACTTGATTAAAATTTTCGG + Intergenic
1201080210 Y:10236759-10236781 ATGACAATCATTAAAATGTCAGG - Intergenic
1201561035 Y:15316971-15316993 ATGACTTTCATTAAAAAGTCAGG - Intergenic
1201672463 Y:16539346-16539368 ATGGCATTCATTAAAATGTCAGG - Intergenic
1202022789 Y:20483503-20483525 ATGGCTCTTATTAAAATTTGAGG - Intergenic