ID: 977802457

View in Genome Browser
Species Human (GRCh38)
Location 4:101252722-101252744
Sequence TTCTTTACACATTTGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977802455_977802457 27 Left 977802455 4:101252672-101252694 CCTGCTTTATGGATACTTGAAAG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 977802457 4:101252722-101252744 TTCTTTACACATTTGCAGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 258
977802454_977802457 28 Left 977802454 4:101252671-101252693 CCCTGCTTTATGGATACTTGAAA 0: 1
1: 0
2: 1
3: 18
4: 227
Right 977802457 4:101252722-101252744 TTCTTTACACATTTGCAGCCTGG 0: 1
1: 0
2: 2
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977802457 Original CRISPR TTCTTTACACATTTGCAGCC TGG Intronic
900817279 1:4858267-4858289 AACTTCACAAATTTGCAGCCAGG + Intergenic
901215987 1:7555665-7555687 CTCTGGTCACATTTGCAGCCTGG + Intronic
902605337 1:17566002-17566024 TTCTTTAGATACTTGTAGCCTGG + Intronic
903980157 1:27180530-27180552 CTCTTTTCACAATAGCAGCCTGG + Intergenic
904015766 1:27419403-27419425 ATTTCTACACATTTCCAGCCTGG + Intronic
905927601 1:41762947-41762969 TTAATTTCACATGTGCAGCCAGG + Intronic
906010380 1:42518562-42518584 TGCTGTACAGATTTGTAGCCTGG + Intronic
906561582 1:46761917-46761939 TTAGTCACACAGTTGCAGCCTGG - Intronic
907605782 1:55816029-55816051 TGCTTTGCACAGTTGCAGCTTGG + Intergenic
907725293 1:57015088-57015110 TTCTTTGCCCATTTTCTGCCTGG + Exonic
907873555 1:58465048-58465070 TTCTGCACACATTCTCAGCCTGG + Intronic
907884719 1:58582155-58582177 TTCTATATACATTTGCAGTCAGG - Intergenic
908934653 1:69360100-69360122 CTCTTTTCACAATGGCAGCCTGG - Intergenic
910572646 1:88723089-88723111 TTCTTTGAATATTTGAAGCCAGG + Intronic
911457560 1:98145767-98145789 TTCTATAAACATTTGCATACAGG - Intergenic
914430593 1:147617678-147617700 TTGTTTACATATTTGCACACAGG + Intronic
914890329 1:151616145-151616167 TTCTTTACTCATTAGCCTCCAGG - Intronic
917977576 1:180250372-180250394 TTATGTTCACATTTGCACCCGGG - Intronic
918928770 1:190825060-190825082 ATCTATACACATTTGCATGCAGG - Intergenic
918952487 1:191157447-191157469 TTCTTTACAGATTTTCTGTCTGG - Intergenic
920400425 1:205672818-205672840 TTCTTTACATCTGTGCAACCAGG + Intronic
920851593 1:209631786-209631808 CTCTGTACACCTCTGCAGCCTGG + Intronic
922954203 1:229585751-229585773 TTCTTTAGAAATTTCCGGCCAGG + Intergenic
923462408 1:234218670-234218692 GTCTTGCAACATTTGCAGCCAGG - Intronic
923647434 1:235838257-235838279 TTAGTTACTCATTGGCAGCCTGG - Intronic
924072324 1:240294181-240294203 TTCTTTACGCATTTGTTGCCTGG - Intronic
924522578 1:244817700-244817722 CTCTTTCCACAGTGGCAGCCTGG + Intergenic
1063611374 10:7564541-7564563 TGCTGTACAGGTTTGCAGCCCGG + Intronic
1065095990 10:22281447-22281469 TTATTTACAGATTTTCAGCTGGG - Intergenic
1065471437 10:26086017-26086039 TTGTTTACTCATTTGCAGGTAGG + Intronic
1066481530 10:35799872-35799894 TTCTGAACACATTTGCAGGCCGG + Intergenic
1068871694 10:61952029-61952051 TTCTTTATACATTTGTAGGGGGG + Intronic
1069414659 10:68187425-68187447 TACTTTACAAAAGTGCAGCCTGG + Intronic
1069663381 10:70138652-70138674 TTCTTTAAGCATCTGCTGCCAGG + Exonic
1071389608 10:85158744-85158766 TTCTTTACAGACTTGTACCCAGG - Intergenic
1074786628 10:116847899-116847921 CTCTTTCCCCATTTGCAGCCTGG - Intergenic
1075133041 10:119756959-119756981 TTCCTCAGACATTTGCAGGCAGG + Intronic
1077128981 11:960031-960053 ATGTTTACAGATTTGCAACCTGG + Intronic
1077605720 11:3610264-3610286 ATCCTAACACAGTTGCAGCCAGG + Intergenic
1077871591 11:6266900-6266922 TACTGTACAGGTTTGCAGCCTGG - Intronic
1079235362 11:18684701-18684723 GTCTTTTCACAATGGCAGCCTGG + Intergenic
1080810705 11:35701562-35701584 CTCTTTCCACAATGGCAGCCTGG - Intronic
1081373747 11:42335031-42335053 TTCTTTACAGAGTGGCAGCATGG + Intergenic
1081393191 11:42554054-42554076 TACTTTACTCCTTTGCATCCAGG - Intergenic
1081688758 11:45060909-45060931 TGCTGTACAGGTTTGCAGCCTGG - Intergenic
1083599667 11:63939049-63939071 TTCTTCACACACTTGCCGGCAGG - Exonic
1084488556 11:69465158-69465180 TCCTTTTCACATTGGCTGCCGGG - Intergenic
1085837085 11:79968506-79968528 TCCTTGACACAATTACAGCCAGG + Intergenic
1087116758 11:94533776-94533798 TTATTTTCAGATTTGCTGCCTGG + Intergenic
1089944390 11:122452937-122452959 TTCTATAAACATTTGCATGCGGG - Intergenic
1090088908 11:123676534-123676556 ATCTTTACAACTTTGCAACCTGG + Intergenic
1091083964 11:132702384-132702406 TTCTAAGCAGATTTGCAGCCAGG - Intronic
1092621090 12:10269460-10269482 TTCTTTAAAAATTATCAGCCAGG + Intergenic
1093987163 12:25548304-25548326 TTCTGTGCCCATTTACAGCCTGG - Intronic
1094688218 12:32741780-32741802 TGCTGTACATGTTTGCAGCCTGG + Intronic
1096588425 12:52641263-52641285 TTCTTTACTCATTTGTAAACAGG - Intergenic
1098147749 12:67515337-67515359 TTGTTTACACACTTGCTTCCAGG + Intergenic
1098327074 12:69313936-69313958 TTTTTTACAGTTTTGTAGCCTGG - Intergenic
1099425679 12:82520134-82520156 TTCTTTTCACATTCTAAGCCTGG - Intergenic
1100320170 12:93483433-93483455 TGCTGTATACGTTTGCAGCCTGG - Intronic
1100516835 12:95336217-95336239 TTTTATACACATGTGCATCCAGG - Intergenic
1100703492 12:97175069-97175091 TCCTGTACAAGTTTGCAGCCTGG - Intergenic
1101122539 12:101597984-101598006 TTCTTTACACAGTAGGAACCGGG - Intronic
1101346033 12:103886964-103886986 TTATTTAAACATTTGCAGCCGGG + Intergenic
1101574466 12:105984659-105984681 TGCTATACAGATTAGCAGCCTGG - Intergenic
1101599437 12:106196231-106196253 TTTTTTACACATTTCTAGTCTGG - Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106801705 13:33262802-33262824 TTCTTTACTCATTAGGATCCAGG - Intronic
1107519240 13:41162846-41162868 TTCTTTAGAAATTTGTAGCCAGG - Intergenic
1108098786 13:46933352-46933374 TTGTTTCCACATTTGTAGACTGG - Intergenic
1108414796 13:50186433-50186455 TTCTTTATAGACTTTCAGCCAGG + Intronic
1108507996 13:51129950-51129972 CTCTTTTCACAATGGCAGCCCGG + Intergenic
1108733167 13:53256263-53256285 TTCTTTCTACATTACCAGCCTGG + Intergenic
1108763896 13:53603460-53603482 TTCTTTACCCATTTGGGACCTGG + Intergenic
1108812394 13:54244038-54244060 TGCTATACAGATTTGTAGCCTGG - Intergenic
1110379365 13:74832721-74832743 TTCTTCACACATTTGTAGATTGG - Intergenic
1111575756 13:90152458-90152480 TTCTTTAAAGATTTGAAGCCAGG + Intergenic
1112854908 13:103756715-103756737 ATCTTTACATGTTTGAAGCCAGG - Intergenic
1114207269 14:20584050-20584072 TTCTGTACAAACTTGCAGCTGGG + Exonic
1114392063 14:22320325-22320347 TTCTTTACACATTTTCAGGAGGG - Intergenic
1118575265 14:67235749-67235771 TTCTTGACACATCTCCAGACTGG + Intergenic
1119068443 14:71555125-71555147 TTCTTTGAACCTTTGAAGCCAGG + Intronic
1119102697 14:71895070-71895092 TACTTTTCAAATTTGCTGCCAGG + Intergenic
1119667597 14:76496443-76496465 TTCTTTCCCCATTTCCTGCCTGG - Intronic
1119868913 14:77996500-77996522 TTCTATACACATTTGTATTCAGG + Intergenic
1120413142 14:84183955-84183977 TTCTTTATAAATTCCCAGCCTGG - Intergenic
1122473611 14:101989994-101990016 TGCTGTACAGATTTGTAGCCTGG + Intronic
1124926060 15:34071727-34071749 TTCTTTACTGTTTTCCAGCCTGG - Intergenic
1126417232 15:48430431-48430453 TTCTTGACCCATTTGCTGCCAGG - Intronic
1128389429 15:67173231-67173253 AGCACTACACATTTGCAGCCTGG + Intronic
1129637743 15:77340163-77340185 TTCTATAAACATTTGCATGCAGG - Intronic
1130156728 15:81357029-81357051 TTCTTTAGATATTTGAAGGCAGG + Intronic
1130642085 15:85686657-85686679 GTATTTACATATTGGCAGCCAGG + Intronic
1131176744 15:90214021-90214043 TTCCTTCCCCATTTGCTGCCAGG + Intronic
1134344397 16:13376417-13376439 TTCTCAGCACATTTACAGCCAGG + Intergenic
1135743382 16:24995761-24995783 TTTTTTTTACATTTGCTGCCTGG - Intronic
1135808991 16:25570261-25570283 TTTTTTTCACATGTGCAGGCAGG + Intergenic
1138142270 16:54578899-54578921 TTATTTACCCATTTGGATCCTGG - Intergenic
1138531382 16:57636148-57636170 TTCTTTGCACATCTGCTACCTGG + Intronic
1138834201 16:60413383-60413405 TTCTTCACAGATTTGGAGACTGG - Intergenic
1140102466 16:71929790-71929812 TTCTTTAATAATTTGCAGTCAGG + Exonic
1140212442 16:72981213-72981235 TCTTTTAAACATTAGCAGCCTGG - Intronic
1140573179 16:76132528-76132550 TGCTGTACAGATTTGCAGCCTGG + Intergenic
1140763238 16:78130988-78131010 TGCTATACAAGTTTGCAGCCTGG - Intronic
1141386784 16:83628626-83628648 TTATTTGCACATTTGCAGGCTGG + Intronic
1145049046 17:19645444-19645466 TTCTAAACACATTCCCAGCCCGG - Intergenic
1148833026 17:50448167-50448189 TGCTGTACAGCTTTGCAGCCTGG - Intronic
1151046451 17:70925357-70925379 TTCTATAGACATTTGCAGAAAGG + Intergenic
1152876955 17:82791917-82791939 TGCTGTACAGGTTTGCAGCCTGG - Intronic
1153158696 18:2178755-2178777 TACTTTACACATGGGAAGCCTGG + Intergenic
1153969124 18:10208704-10208726 TGCTGTACAGATTTGTAGCCAGG - Intergenic
1158062107 18:53356882-53356904 CTCTTTTCTCTTTTGCAGCCTGG + Intronic
1158860817 18:61590407-61590429 ATCTTTACACATTTAAAGACAGG - Intergenic
1160272702 18:77402334-77402356 TTCTTTGCAGAATTGCAGCAAGG - Intergenic
1162564817 19:11439912-11439934 TTTTTAACAAATTTTCAGCCGGG - Intronic
1162637785 19:11983992-11984014 TATTTTAAACATTTTCAGCCGGG - Intergenic
1163731520 19:18952304-18952326 GTGTTTAAATATTTGCAGCCGGG + Intergenic
1163788264 19:19289165-19289187 TACTTTACAGGTTTGTAGCCTGG - Intronic
1164510208 19:28890345-28890367 TTCTTTGCACATTTGCTGCCTGG - Intergenic
1165219999 19:34307966-34307988 ATCTTTACACAGTTGCATCTTGG + Intronic
1166562641 19:43743481-43743503 TTTTACACACATTTGCAGTCAGG - Intronic
1167423929 19:49420052-49420074 TTTTTTAAAGATTTGGAGCCTGG + Intergenic
926579124 2:14615393-14615415 TTATTGAGACAGTTGCAGCCAGG - Intergenic
928054458 2:28038201-28038223 TTCTTTAGACTTTTCCTGCCTGG + Intronic
930630569 2:53749489-53749511 TCCTATAAACATTTGCAGACAGG - Intronic
931899664 2:66773346-66773368 CTCTTTTCACATTTGCATCTGGG + Intergenic
934567457 2:95348428-95348450 TTCTTTCCCCATCTGGAGCCTGG + Intronic
935761457 2:106324583-106324605 GTTTTTACACATTTGCAGAGGGG - Intergenic
937725184 2:125156176-125156198 TTCTTTTCACTTTTGCAGATTGG - Intergenic
937979166 2:127603736-127603758 TCCTTTAAAGATTTGAAGCCAGG + Intronic
939337945 2:140855365-140855387 TTCTTTAAAAATTTGGGGCCAGG + Intronic
940313058 2:152298863-152298885 TGCTATACACATTTGCATGCAGG + Intergenic
940689312 2:156895413-156895435 TTCTTTGTACATTTGGATCCTGG + Intergenic
942779454 2:179623974-179623996 TTTTTTAAAAATTGGCAGCCTGG + Intronic
945211586 2:207388951-207388973 TTCTTTTCACATTTTCTACCTGG - Intergenic
946179570 2:217941513-217941535 TTCCTTACACATTGGCAGGAAGG + Intronic
946291180 2:218746624-218746646 CTCTTTACACATATTCAGCTTGG - Intronic
948343091 2:237270746-237270768 ATCTTTAGAGCTTTGCAGCCTGG + Intergenic
1169012566 20:2262812-2262834 TTCATCTCAAATTTGCAGCCAGG - Intergenic
1169639068 20:7728243-7728265 GTCTTTTCAACTTTGCAGCCTGG + Intergenic
1170755797 20:19205992-19206014 TTCTTTCCACATTTCCAGTCAGG - Intergenic
1172510644 20:35498546-35498568 TTCTTTTCATAGTGGCAGCCAGG + Intronic
1173200094 20:40948121-40948143 TCCCTTACAAGTTTGCAGCCAGG + Intergenic
1174427927 20:50446413-50446435 TGCTGTACAGGTTTGCAGCCCGG + Intergenic
1174716416 20:52763658-52763680 TTCTTAACACAATTACAGTCCGG - Intergenic
1176864867 21:14042010-14042032 TTCTTTCTTAATTTGCAGCCTGG - Intergenic
1176919778 21:14674054-14674076 ATATTTAAACATTTGCAACCTGG + Intergenic
1177404561 21:20648122-20648144 TTCTTTAAAGCTTTGAAGCCAGG - Intergenic
1177899793 21:26900764-26900786 ATCTTTATACATTATCAGCCAGG - Intergenic
1178542402 21:33464493-33464515 TTTTTTAAACATTTACGGCCGGG - Intronic
1179912678 21:44458590-44458612 CTCTTTTCACCTTTGCTGCCAGG + Exonic
1180702398 22:17788779-17788801 TTCTTTGCTCCTTTGCAGCTGGG + Exonic
1181910207 22:26232643-26232665 TGCTGTACAGGTTTGCAGCCAGG + Intronic
1183944249 22:41315591-41315613 TTCTTTACAGTTTTGGAGACTGG + Intronic
949625253 3:5858884-5858906 TTGTTTACACATTTGCTAACAGG + Intergenic
950298351 3:11851439-11851461 TCCTTTCCTCATCTGCAGCCTGG + Intergenic
951567923 3:24030403-24030425 TGATTTACTCATTTGCAGCATGG + Intergenic
951908075 3:27722732-27722754 TGCTTTATATATTTGCGGCCAGG + Intergenic
953416241 3:42719740-42719762 CTCTTTTCACAATGGCAGCCTGG + Intronic
955604197 3:60682360-60682382 TTCTTTGAAGATTTGAAGCCAGG - Intronic
956283544 3:67584776-67584798 TTCTTTACACAGTGGCAGGAAGG + Intronic
957518612 3:81289397-81289419 TTCTTTGAACCTTTGAAGCCAGG + Intergenic
958130216 3:89409637-89409659 TACTTTATGCCTTTGCAGCCAGG - Intronic
958494439 3:94826200-94826222 TTCTTTGAAGATTTGAAGCCAGG + Intergenic
961047813 3:123721538-123721560 GTTTTTACACATCAGCAGCCTGG - Intronic
961270143 3:125682026-125682048 GTTTTTACACATCAGCAGCCTGG + Intergenic
961316234 3:126037711-126037733 TTTTTGAAAAATTTGCAGCCTGG + Intronic
962245861 3:133791751-133791773 CTCTTTTCACAGTGGCAGCCTGG + Intronic
964731499 3:159871692-159871714 GTCTTAAAACATTGGCAGCCAGG - Intronic
964811632 3:160670670-160670692 TTCTGTACAAATTTGCAGCATGG - Intergenic
966562328 3:181336793-181336815 TTCTATAAATATTTGCTGCCTGG + Intergenic
967282808 3:187838291-187838313 TTCTGTATAAATCTGCAGCCTGG - Intergenic
968083837 3:195865409-195865431 TTCTTAACTGATTTGCACCCGGG - Intronic
968177423 3:196563051-196563073 TTATTTAAATATTTGGAGCCTGG - Intronic
971510960 4:27422744-27422766 TTCATTTCAAATTTGAAGCCCGG - Intergenic
971985582 4:33818615-33818637 TTCTTTAAACATTTTCTTCCAGG - Intergenic
972313245 4:37900657-37900679 TTCTTTACTCACTTGCTCCCTGG - Intronic
972728372 4:41767339-41767361 TTGGATAGACATTTGCAGCCGGG + Intergenic
972870554 4:43292647-43292669 TGCTGTACACATTTGTAGCCTGG - Intergenic
972938970 4:44173529-44173551 TTCTTTCCACATGTACAACCAGG + Intergenic
973807598 4:54540688-54540710 TCCTTTCCCCATTTGCTGCCTGG - Intergenic
975278354 4:72529590-72529612 TGCTGTACAGGTTTGCAGCCTGG + Intronic
977105885 4:92883964-92883986 TTCTTTGCAAGTTTGAAGCCAGG + Intronic
977237053 4:94520833-94520855 TTGTTTACAGTTTTTCAGCCTGG - Intronic
977802457 4:101252722-101252744 TTCTTTACACATTTGCAGCCTGG + Intronic
978417041 4:108487790-108487812 TTCTGTACAGGTTTGTAGCCCGG - Intergenic
978876929 4:113651373-113651395 TTATTTACACATTTGAACACAGG - Intronic
979205075 4:118029590-118029612 TTCTTTAAAAATCTTCAGCCTGG - Intergenic
979625368 4:122839031-122839053 TGCTGTACAGGTTTGCAGCCCGG + Intronic
980004707 4:127528482-127528504 TTCATTACACCCTTGCGGCCTGG + Intergenic
982519865 4:156401861-156401883 TTCTTTTCACATTTTTGGCCAGG - Intergenic
983081150 4:163387053-163387075 TTCTTTCCAGGTTTCCAGCCTGG - Intergenic
983366503 4:166797383-166797405 TTGTTTACATATTTGTAGCCAGG - Intronic
983686804 4:170420356-170420378 TTCTATAAACATTTGCATGCCGG - Intergenic
984046678 4:174809231-174809253 TGCTGTACAGGTTTGCAGCCTGG + Intronic
984479187 4:180277082-180277104 TTCTTTAAAGATTTGAAGCCAGG - Intergenic
985181925 4:187273847-187273869 TTCTTCACACATTTTCAGGCTGG - Intergenic
985479321 5:98313-98335 TTTTTTCCCCATTTTCAGCCAGG + Intergenic
986659544 5:10046648-10046670 TTTTGTTCACATTTGCATCCTGG - Intergenic
988037457 5:25846044-25846066 TTCTTTACCCATTTTCAATCAGG - Intergenic
988831549 5:34992342-34992364 TGCTGTACAGGTTTGCAGCCTGG + Intergenic
988888280 5:35583360-35583382 TTCTGTACAGGTTTGTAGCCTGG + Intergenic
988931459 5:36039507-36039529 CAATTTTCACATTTGCAGCCAGG + Exonic
989132096 5:38117195-38117217 TGCTGTACAGATTTGTAGCCTGG - Intergenic
991657604 5:68919764-68919786 TTCTTTTCACAGTTTTAGCCTGG - Intergenic
991987532 5:72305461-72305483 TCCTTGACACATTTGCATTCAGG - Intronic
992506568 5:77393027-77393049 TTCTTTAGAGACTTGTAGCCAGG + Intronic
993654789 5:90564482-90564504 TTCTTTCAACATTTCCAGCCAGG - Intronic
993880969 5:93360489-93360511 TGCTGTACAGATTTGTAGCCTGG + Intergenic
995686855 5:114781146-114781168 TTCTTTACATTTCTTCAGCCTGG + Intergenic
997883076 5:137607827-137607849 TTCCAGACACATTTGCAGCGAGG + Intergenic
999883801 5:155897186-155897208 TGCTCTACAGGTTTGCAGCCTGG - Intronic
1000684243 5:164227388-164227410 TTCTTTAGACATAAGCTGCCTGG + Intergenic
1002126529 5:177049630-177049652 TTCTTGCCACACTGGCAGCCTGG + Intronic
1004402381 6:15300532-15300554 TTCTTTAACCGCTTGCAGCCAGG + Intronic
1004407231 6:15344689-15344711 TTCTTTATAGATTTCCACCCAGG + Intronic
1004751101 6:18562961-18562983 TGCTGTACAGGTTTGCAGCCTGG - Intergenic
1006315893 6:33291441-33291463 TTTTATACACATTTGCAGCAAGG + Intronic
1007612693 6:43160711-43160733 TTCCCTACAGATTTGCAGGCTGG + Exonic
1008303647 6:49873432-49873454 TAGTTTACACTTTGGCAGCCAGG + Intronic
1008580335 6:52901023-52901045 TTCTATACACAGTTACAACCAGG + Intronic
1008698933 6:54075615-54075637 TTTTTTAAACATTTCCAGTCTGG - Intronic
1016288866 6:142506264-142506286 ATTTTCTCACATTTGCAGCCAGG + Intergenic
1016579464 6:145613948-145613970 TCCTTTAAAGATTTGAAGCCAGG + Intronic
1016930427 6:149401639-149401661 TTCTTTATTCATTTTCTGCCTGG - Intronic
1017549221 6:155487143-155487165 TTGTTCTCACATTTGCAGCATGG + Intergenic
1018360475 6:163062738-163062760 TTCTTTTCACCTATGCAGCTGGG - Intronic
1018433397 6:163741209-163741231 TTGTTTCCAAATTTGCAGCATGG + Intergenic
1018580044 6:165300912-165300934 TTCTGTACACATGTGCTGCCTGG + Intronic
1018708232 6:166478367-166478389 ATCTTCACACAGTTGCTGCCAGG - Intronic
1020466965 7:8491202-8491224 TGCTTTGGACATTTCCAGCCAGG + Intronic
1021256880 7:18403114-18403136 TTATTTACAGATTTGGAGCTGGG + Intronic
1022371628 7:29777028-29777050 TTCTTTACACAGCTGCAGAGTGG - Intergenic
1022584548 7:31594166-31594188 TACTGTACAGGTTTGCAGCCTGG + Intronic
1023763132 7:43485576-43485598 TGCTGTACAGGTTTGCAGCCTGG - Intronic
1024180397 7:46887519-46887541 TTCTTTACACATCTACAGGCTGG + Intergenic
1024623134 7:51180756-51180778 TTCTTTAGAGACTTGTAGCCAGG - Intronic
1024914603 7:54485101-54485123 TTCTTTGCACTTATGCAACCAGG + Intergenic
1031906256 7:127463265-127463287 TTCTTGACACATCTCCACCCAGG - Intergenic
1032025345 7:128437213-128437235 TTCTTCACCCAGTTGTAGCCGGG - Intergenic
1032578711 7:133082707-133082729 TGCTGTACATCTTTGCAGCCTGG - Intergenic
1034057499 7:148050873-148050895 TGCTGTACAGATTTGTAGCCTGG + Intronic
1034357917 7:150467886-150467908 TCCTTTACACAATTGCTGCTTGG + Intronic
1034690277 7:153008325-153008347 TTCCTTAGAAATTGGCAGCCAGG + Intergenic
1040800685 8:51336816-51336838 TTCTTTCCACCTCTACAGCCTGG + Intronic
1040997509 8:53417027-53417049 TTCTTTAGATATTTTCAGTCGGG + Intergenic
1042821923 8:72938541-72938563 TTCATGACACTTTTGCATCCAGG - Intergenic
1042961815 8:74311466-74311488 TTCTTTTAAGATTTGCTGCCTGG - Intronic
1044439608 8:92208200-92208222 CTCTTTTCACAATGGCAGCCCGG - Intergenic
1044577838 8:93790604-93790626 TTCTTTCATCATTTGCAGTCTGG + Intronic
1047014086 8:120703852-120703874 TACTTTACACATTTAGAGCCAGG - Intronic
1047567920 8:126066437-126066459 ATCTTTAGACATTTGTAGTCTGG + Intergenic
1047944847 8:129865412-129865434 TGCTTTAGACATTTGCAGAGTGG + Intronic
1048208947 8:132438916-132438938 TTGTTTAACCATTTCCAGCCTGG + Intronic
1051009344 9:12392037-12392059 ATCTTTAAACATTAGGAGCCAGG - Intergenic
1053620770 9:39813100-39813122 TGCTGTACAGATTTGTAGCCTGG + Intergenic
1053625940 9:39870832-39870854 TGCTGTACAGATTTGTAGCCTGG - Intergenic
1053839411 9:42176682-42176704 TGCTGTACAGATTTGTAGCCTGG - Intergenic
1053878936 9:42572388-42572410 TGCTGTACAGATTTGTAGCCTGG + Intergenic
1053893730 9:42721975-42721997 TGCTGTACAGATTTGTAGCCTGG - Intergenic
1054117872 9:61183061-61183083 TGCTGTACAGATTTGTAGCCTGG - Intergenic
1054217948 9:62379869-62379891 TGCTGTACAGATTTGTAGCCTGG + Intergenic
1054232756 9:62529307-62529329 TGCTGTACAGATTTGTAGCCTGG - Intergenic
1054263393 9:62894342-62894364 TGCTGTACAGATTTGTAGCCTGG - Intergenic
1054589884 9:66999505-66999527 TGCTGTACAGATTTGTAGCCTGG + Intergenic
1055236523 9:74129426-74129448 TTCTTTAAAGATTTGCATACAGG - Intergenic
1055610233 9:78015224-78015246 TGCTTTACAGGTTTGCAGCCTGG + Intronic
1057018252 9:91674021-91674043 TTCTTTCCAAATTAGCAGACAGG - Intronic
1057037418 9:91821449-91821471 TCCTTTCCACATTGGCTGCCTGG + Intronic
1057809526 9:98247009-98247031 TTTTTTACTGATTTGCAACCAGG - Intronic
1058204339 9:102084518-102084540 TGCTTTCCAGATTTGCAGACAGG - Intergenic
1061360661 9:130140125-130140147 TATTTTACACATTTGCAACACGG - Exonic
1187390170 X:18881113-18881135 TTATTAATATATTTGCAGCCGGG + Intergenic
1188133867 X:26470625-26470647 CTCTTTTCACAATGGCAGCCCGG - Intergenic
1188809105 X:34630468-34630490 TGTTTTACAGGTTTGCAGCCTGG - Exonic
1188955273 X:36427509-36427531 TTCTTTAGATACTTGTAGCCAGG - Intergenic
1190947517 X:55110077-55110099 CTCTTTTCACAATGGCAGCCTGG + Intronic
1191586685 X:62834444-62834466 TTTTTTTTAAATTTGCAGCCTGG - Intergenic
1191963339 X:66727810-66727832 TGCTTTACAGGTTTGTAGCCTGG - Intergenic
1193769587 X:85573128-85573150 TTCTTTACATTTTTGGAGACAGG - Intergenic
1196865657 X:120068136-120068158 TTCTCTTCACAATGGCAGCCTGG + Intergenic
1196877436 X:120168144-120168166 TTCTCTTCACAATGGCAGCCTGG - Intergenic
1198981593 X:142403718-142403740 TTGTTTAAAAATTTGCAGCCGGG + Intergenic
1202049319 Y:20764275-20764297 TTTTTTACACAATTGGAGTCTGG + Intronic