ID: 977803491

View in Genome Browser
Species Human (GRCh38)
Location 4:101267583-101267605
Sequence GGAGGGGATAAGCGGATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977803483_977803491 3 Left 977803483 4:101267557-101267579 CCCGTACTATACTGAGATGGGAG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 977803491 4:101267583-101267605 GGAGGGGATAAGCGGATCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 125
977803484_977803491 2 Left 977803484 4:101267558-101267580 CCGTACTATACTGAGATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 100
Right 977803491 4:101267583-101267605 GGAGGGGATAAGCGGATCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977803491 Original CRISPR GGAGGGGATAAGCGGATCTG AGG Intronic
900826091 1:4928115-4928137 GAAGGTGACAAACGGATCTGAGG + Intergenic
902406236 1:16185092-16185114 GGAGGGGATAATAGGATCTGGGG + Intergenic
902668285 1:17954370-17954392 GGAGGGGACAAACGCCTCTGTGG - Intergenic
903339203 1:22643655-22643677 GGAGAGGGGAAGCAGATCTGAGG + Exonic
903812367 1:26041850-26041872 GGAGGGGAGAAGGGAAGCTGAGG - Intronic
903868113 1:26412683-26412705 GGAGGGGAAAGGAGGATGTGGGG + Intronic
905855065 1:41305582-41305604 TGAGGGGATAGGAGGATATGAGG - Intergenic
907278206 1:53328372-53328394 GGAGGTGACAGGCGGATCAGAGG + Intergenic
909211468 1:72830450-72830472 GGAGGGAATCTGCTGATCTGCGG - Intergenic
910193877 1:84621143-84621165 CGCGGGGATAGGGGGATCTGAGG - Intergenic
910333179 1:86098912-86098934 GGAGGGGAAAATCTGACCTGAGG + Intronic
911418762 1:97612083-97612105 ACAGGGCATAAGGGGATCTGTGG - Intronic
912276243 1:108261822-108261844 CGAGGGGATCTGCTGATCTGTGG - Intergenic
912291985 1:108432536-108432558 CGAGGGGATCTGCTGATCTGTGG + Intronic
913214572 1:116609859-116609881 GGAGGGGTAAAGCTGAGCTGGGG - Intronic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
915969896 1:160347150-160347172 AGAGGGGGTAAGCGGGACTGTGG + Intronic
919952590 1:202378887-202378909 GGAGGTAAGAAGAGGATCTGAGG - Intronic
1063202958 10:3802330-3802352 GGAGGGGTTGAGCGGAACTTCGG - Intergenic
1064323863 10:14330778-14330800 GGAGAGGAAAAGTAGATCTGGGG - Exonic
1069403559 10:68075100-68075122 GGAGGGGAGCAGCGGAGCAGCGG - Intronic
1070190359 10:74106401-74106423 GGAGGGCTTAAGTTGATCTGTGG + Intronic
1073148079 10:101293233-101293255 GGAGGGGAGAGGCAGAGCTGGGG - Intergenic
1073862777 10:107766594-107766616 GGATGGGATGAGAGGAGCTGGGG - Intergenic
1076764585 10:132626055-132626077 GAATGGGAAAAACGGATCTGTGG - Intronic
1079643029 11:22830015-22830037 GGCGGGGGTAGGCGGAGCTGTGG - Intronic
1081496902 11:43620923-43620945 GTAGGGTATAAGAGGATCAGAGG + Intronic
1083726283 11:64630281-64630303 GGCGGGGCTAAGCGGCTCTGGGG - Intronic
1083726290 11:64630302-64630324 GGCGGGGCTAAGCGGCTCTGGGG - Intronic
1084116598 11:67046143-67046165 GGAGGGGATACCCAGCTCTGAGG + Intronic
1088189684 11:107214551-107214573 GGAGAGGATAAGAGGATGGGGGG + Intergenic
1089081671 11:115781346-115781368 GGAGGAGATAAGAGTATTTGTGG - Intergenic
1089192342 11:116662064-116662086 GGAGAGGATGAGGGGGTCTGGGG + Intergenic
1091346630 11:134858699-134858721 GGAAGTGATAAGCGGCCCTGGGG - Intergenic
1105218299 13:18303331-18303353 GGAGGGGTAAAGCTGAGCTGGGG - Intergenic
1113708527 13:112449192-112449214 GGAGGAGATATGGGGCTCTGAGG - Intergenic
1115927258 14:38449293-38449315 GGAGGGGATGAGCTGTGCTGGGG - Intergenic
1117533689 14:56684455-56684477 GCAGGGGAGAAGCGGATGTTGGG - Intronic
1121249608 14:92489792-92489814 GGAGGGGATGAGCGGGTCTCAGG - Intronic
1124849002 15:33317758-33317780 GGAGGGGAAAAGTGCATGTGAGG - Intronic
1127567293 15:60203983-60204005 GGAGGGGTGAAGGGGATCTTTGG + Intergenic
1128557765 15:68643298-68643320 GGAGGGGAGAGGCTGGTCTGAGG + Intronic
1129339240 15:74874010-74874032 GGCGGGGGAAAGCGGAGCTGTGG - Intergenic
1130415114 15:83686307-83686329 GGAGGGGACAAACAGATTTGTGG + Intronic
1131832865 15:96365558-96365580 GGAATGGAGAAGCCGATCTGAGG - Intergenic
1133901502 16:9979555-9979577 GGAGGTAATAAGCAGAGCTGTGG - Intronic
1134388936 16:13800754-13800776 GGAGGGGCTGAGCAGATTTGGGG - Intergenic
1135155050 16:20045694-20045716 AGTGGGGATAAGGAGATCTGGGG + Intronic
1138458533 16:57134610-57134632 GGAGGTGAAAAGCAGATGTGGGG + Intronic
1139511961 16:67432650-67432672 GGTGGGGAGAAGGGGATATGAGG + Intronic
1142427930 16:90010737-90010759 GGAGGGGCTGAGGGGATCTGTGG - Intronic
1151590860 17:75043633-75043655 GGAGGGGATAAAGAGAGCTGGGG - Intronic
1152023232 17:77792755-77792777 GGGGGGGATAAGTGGCCCTGGGG + Intergenic
1152183378 17:78839566-78839588 GGAGGGGATAAACGAACCTTGGG + Intronic
1152334871 17:79695097-79695119 GGAGGGGCTGAGGGAATCTGGGG - Intergenic
1156284654 18:35679942-35679964 GGAGGGGGTAAGAGTATGTGGGG - Intronic
1162549656 19:11351468-11351490 GGAGGGGATGAGAGGCTCAGGGG + Intronic
1164161091 19:22625729-22625751 GCAGGAGATAAGCAGATCCGAGG + Intergenic
1165108240 19:33486849-33486871 CCAGGGGATAAGGGGAGCTGGGG + Intronic
1166136200 19:40778523-40778545 GGAGGGGTTTAGTGGGTCTGAGG + Intronic
925535359 2:4910826-4910848 GGAGGGAAGAAGCGGATCCAGGG + Intergenic
927942579 2:27114377-27114399 TGAGAGGATGAGTGGATCTGAGG - Intronic
929941158 2:46335079-46335101 GGAGGGGAGAAGGGGTTATGAGG + Intronic
934295999 2:91743301-91743323 GGAGGGGTAAAGCTGAGCTGGGG + Intergenic
935936851 2:108194771-108194793 GGGGAGGATAAGTGGGTCTGAGG + Intergenic
939039189 2:137167534-137167556 GGAGGGTATATCCAGATCTGAGG - Intronic
941865131 2:170326562-170326584 GGAGGGGACAAGTGGGTGTGTGG - Intronic
1168926321 20:1583138-1583160 GGTGGGGAGAAGAGGATTTGTGG - Intronic
1169956387 20:11107827-11107849 GGAGGGGAAAAGAGGATTTAGGG + Intergenic
1172106216 20:32518695-32518717 GGAGGGGACAGGCGGATGGGTGG + Intronic
1172149407 20:32779787-32779809 AGAGGAGAGAAGCGGTTCTGTGG + Intronic
1173678666 20:44860613-44860635 GGAGGTGATAATGGGATCAGTGG - Intergenic
1180033099 21:45225596-45225618 GGATGGGATTAGCGAAGCTGTGG + Exonic
1182714140 22:32341385-32341407 GGAGGGGCTGAGGGGAACTGGGG - Intergenic
1184359583 22:44006977-44006999 GGATGGGAGCAGCTGATCTGGGG - Intronic
1184401456 22:44276975-44276997 GGAGGGGCTGAGGGGAACTGGGG - Intronic
1185398221 22:50603410-50603432 GGAGGGGATAAGGGGCCCGGGGG - Exonic
950508220 3:13409373-13409395 GGAAGGGATGAGCAGCTCTGTGG - Intronic
952327404 3:32333925-32333947 GGAGGAGAGAAGGGGATATGTGG + Intronic
960639474 3:119812307-119812329 GGATGGGAAGAGCAGATCTGAGG - Intronic
961073957 3:123964225-123964247 GGAGGGGATGAGGGGACCTAAGG + Intergenic
961203138 3:125060085-125060107 GGAGGGGACAAGCAGATGAGAGG - Intergenic
961309663 3:125987904-125987926 GGAGGGGATGAGGGGACCTAAGG - Intergenic
966472253 3:180303848-180303870 GGAGGGGAGCAGAGGTTCTGAGG - Intergenic
967397720 3:189025228-189025250 TGAGGGGATATCCTGATCTGAGG + Intronic
968826746 4:2903717-2903739 GGAGGGGATTACAGGAGCTGGGG + Intronic
970222008 4:13821278-13821300 AGAGGGGAGAAGGGGAACTGGGG - Intergenic
973710211 4:53622473-53622495 GGAGGGAACAAGGGGAGCTGTGG - Intronic
977803491 4:101267583-101267605 GGAGGGGATAAGCGGATCTGAGG + Intronic
984705875 4:182846738-182846760 GCAGGTGACAAGGGGATCTGTGG - Intergenic
993145394 5:84086936-84086958 AGAGGGGAGAAGAGGATGTGTGG + Intronic
994402896 5:99304615-99304637 GGAGGGTGTAAGGAGATCTGGGG + Intergenic
995142342 5:108748658-108748680 GGAGTGGAGACGCGGAGCTGCGG - Intronic
999096106 5:148979370-148979392 GGAGGGGACAAGTGGGTCTGGGG + Intronic
999683485 5:154081689-154081711 GAAGGGGTAAAGGGGATCTGAGG - Intronic
1003489493 6:6609074-6609096 GGAGGGGAAAAGCAGAGCTGCGG - Intronic
1004562328 6:16761841-16761863 GGAGGGGAGACGCGGACCGGAGG + Intergenic
1005215082 6:23516882-23516904 GGAGGGCATAAGAGAATCTCTGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1005673318 6:28128960-28128982 GGAGAGGATAATAGGATTTGGGG - Intronic
1007370289 6:41422433-41422455 GGAGGGGACATGGGGAGCTGGGG - Intergenic
1007511559 6:42378155-42378177 GGTGGAGATAAGCGGATGAGGGG + Intronic
1009806589 6:68607684-68607706 GGATAGGATAACTGGATCTGTGG + Intergenic
1010777765 6:79906580-79906602 GGACGGGATAATCTGTTCTGTGG - Intergenic
1013744585 6:113330302-113330324 GTAGAGGATAAGAGGAGCTGAGG - Intergenic
1014534088 6:122595854-122595876 GGATAGGATAACCGGTTCTGTGG - Intronic
1017830503 6:158123838-158123860 GGAGAGGATAAAGGGGTCTGTGG + Intronic
1018611324 6:165650354-165650376 GGAGGGGAGAAGGGGTCCTGGGG - Intronic
1019498972 7:1355015-1355037 GGTGGGGATAGGCGGGCCTGCGG - Intergenic
1022249698 7:28594950-28594972 GCAGGGTATAAGGGGATCTATGG - Intronic
1025234180 7:57222785-57222807 GGAGGGGAGAAGAGAATATGAGG + Intergenic
1031170864 7:118290717-118290739 GGAGGGGAAAAGTGGTTTTGTGG + Intergenic
1031751949 7:125586174-125586196 GGTGGGGAGATGCGGTTCTGTGG - Intergenic
1032510165 7:132466061-132466083 TGAGGGGAGAAGCTGAGCTGAGG - Intronic
1033756003 7:144398796-144398818 GAAAGGGATAAGGGGATCTGGGG - Intronic
1034263844 7:149772364-149772386 GGAGGGGAAGAGCGGTTCTGGGG - Intronic
1035206516 7:157297149-157297171 GGAGGGGATAACCCAATCTCAGG + Intergenic
1037980142 8:23247181-23247203 GGAGAGGAAGAGGGGATCTGGGG + Intronic
1039059698 8:33563909-33563931 GGTGGGGATAAACTGATCAGAGG - Intronic
1039282920 8:36006415-36006437 GGAGGGGATCTCCTGATCTGTGG - Intergenic
1053818116 9:41935916-41935938 GGAGGGGATGGGAGGAACTGAGG - Intronic
1057495738 9:95559726-95559748 GGAGAGGATAAGGGGCTGTGGGG + Intergenic
1057578754 9:96266762-96266784 GGAGTGGAGAAGGGCATCTGGGG - Intronic
1058387044 9:104448860-104448882 GGAGGGGAGAAGCTTATCTTTGG - Intergenic
1059219139 9:112595560-112595582 GGTGGGGGTAGGCGGAGCTGAGG + Intronic
1059749201 9:117231995-117232017 GAAGGGGATTAGAAGATCTGTGG + Intronic
1060726120 9:126007016-126007038 GGAGGGGATCAGAGGCTCGGAGG - Intergenic
1061662554 9:132139694-132139716 GGAGGGGAAAAGCAAAGCTGGGG + Intergenic
1062001197 9:134216582-134216604 CGAGGGGCTGAGCGGCTCTGAGG - Intergenic
1190165595 X:48070953-48070975 TGAGTGGATAGGGGGATCTGGGG - Intronic
1193600592 X:83504952-83504974 GGTGGGGAGAAGCAGATCTGAGG + Intergenic
1194341783 X:92714455-92714477 AGAGGGGATAAAATGATCTGGGG + Intergenic
1195218161 X:102721098-102721120 GGAGGGAGCAGGCGGATCTGAGG - Intronic
1197830775 X:130640080-130640102 GGAAGGGACAAGCGGCTCTTTGG + Intronic
1200650130 Y:5831148-5831170 AGAGGGGATAAACTGATCTGGGG + Intergenic
1202582050 Y:26392386-26392408 GGAGGTAAGAAGAGGATCTGAGG + Intergenic