ID: 977806641

View in Genome Browser
Species Human (GRCh38)
Location 4:101307271-101307293
Sequence CTGTAATCACAAGTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977806641_977806643 -8 Left 977806641 4:101307271-101307293 CCTAGCTCCACTTGTGATTACAG 0: 1
1: 0
2: 0
3: 14
4: 159
Right 977806643 4:101307286-101307308 GATTACAGATTAAGTTTTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 183
977806641_977806644 0 Left 977806641 4:101307271-101307293 CCTAGCTCCACTTGTGATTACAG 0: 1
1: 0
2: 0
3: 14
4: 159
Right 977806644 4:101307294-101307316 ATTAAGTTTTCCTGGTCTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977806641 Original CRISPR CTGTAATCACAAGTGGAGCT AGG (reversed) Intronic
911238567 1:95438995-95439017 CTAAAATCACAAGTCCAGCTTGG + Intergenic
911333867 1:96557410-96557432 CTGGAATCACACGTGAAGTTGGG - Intergenic
912803238 1:112735003-112735025 CTGTAATCAAACCTTGAGCTTGG - Intergenic
913454814 1:119020000-119020022 CTGTACTCACTAGAGGAGCATGG + Intergenic
920150627 1:203904074-203904096 CTGTCATCAGGAGTGGAGCCAGG + Intergenic
924704843 1:246492338-246492360 CTGGAATCACCTGGGGAGCTTGG - Intronic
1063032034 10:2245059-2245081 ATTTAAACACAAGTGGGGCTGGG - Intergenic
1063464161 10:6232316-6232338 CTGTGATCAGAAGTGGGGCAGGG + Intronic
1063773634 10:9234193-9234215 TAGTAATCACCAGTGCAGCTTGG - Intergenic
1069637164 10:69931921-69931943 CTGTATTCTCATCTGGAGCTAGG + Intronic
1072629476 10:97135493-97135515 CTGGAATCACAAGGGGAAGTGGG + Intronic
1078315845 11:10293136-10293158 ATGTAATAACAAATTGAGCTGGG - Intronic
1079665445 11:23099579-23099601 CTGTGAGGAAAAGTGGAGCTTGG - Intergenic
1079680148 11:23286306-23286328 ATGTATTCACAAGTGGTGCCTGG - Intergenic
1080126382 11:28739425-28739447 CTGTTACCAAAAGTGCAGCTAGG - Intergenic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1084534285 11:69747539-69747561 CTGTCATCACGAGGGGAGCGAGG - Intergenic
1086025636 11:82287359-82287381 ATGTAATCACAAGTGGAAAAGGG - Intergenic
1088087808 11:106002587-106002609 CTGTCATCTGAAGTGGAGCTGGG + Intronic
1088614755 11:111614204-111614226 CTGTAATCCCAGGTTGACCTGGG - Intronic
1090033757 11:123230409-123230431 CTTTAATCACCTGTGAAGCTTGG + Intergenic
1091228392 11:133972041-133972063 GTGTGCTCACACGTGGAGCTAGG - Intergenic
1091368310 11:135039628-135039650 CAGGAAGCCCAAGTGGAGCTGGG + Intergenic
1096909557 12:54968767-54968789 ATGTAATCTCAAGTGGAGGTTGG + Intronic
1097101266 12:56591275-56591297 CAGTTGTCACAAGTAGAGCTCGG + Exonic
1109177565 13:59175056-59175078 CTTTGATAACTAGTGGAGCTTGG - Intergenic
1109475298 13:62873405-62873427 GTGCAATCACAAGTCTAGCTGGG - Intergenic
1109493140 13:63130051-63130073 CTATAATCACAAATGGGACTAGG + Intergenic
1113682184 13:112252279-112252301 CTGTTAACTCAAGTGGAGCCTGG + Intergenic
1113980889 13:114274394-114274416 CTAAAATTAGAAGTGGAGCTGGG - Intergenic
1116974208 14:51097373-51097395 CTGTAATTACAAGAAGAGGTAGG + Intergenic
1117004966 14:51411580-51411602 TTGTAATGATAAGTGGAGTTAGG - Intergenic
1117613525 14:57508518-57508540 CTGATCTCACATGTGGAGCTGGG - Intergenic
1118882946 14:69843962-69843984 CTGTGACCAGCAGTGGAGCTGGG + Intergenic
1125297332 15:38217527-38217549 CTGTAAACTCAAGTGGCTCTGGG - Intergenic
1126638213 15:50800174-50800196 CTGTGATCACAATTGCAGCTAGG - Intergenic
1127353403 15:58174589-58174611 CTGTAAGCCAAAGTGGGGCTTGG - Intronic
1128268221 15:66285785-66285807 CTGCAATCACTTCTGGAGCTTGG - Intergenic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1128502320 15:68235242-68235264 GTGTAGTCACAGGTGGACCTGGG + Intronic
1128554340 15:68620931-68620953 CTGTGCTCCCAAGTGGAGCTCGG - Intronic
1130195077 15:81771949-81771971 CTGGACTCAAATGTGGAGCTAGG + Intergenic
1135645090 16:24154829-24154851 CTGGAAGCAGGAGTGGAGCTGGG - Exonic
1137402671 16:48165920-48165942 CTGTAACCACATGTGGAGGGTGG + Intergenic
1137494166 16:48956847-48956869 CTGTAATCACAGGTAGCACTAGG - Intergenic
1137925124 16:52533198-52533220 CTACAATCACAAGTGTGGCTGGG + Intronic
1138838990 16:60474722-60474744 TTGAAATCAAAAGTTGAGCTAGG + Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1141281690 16:82634910-82634932 CTGCACACACAAGTGGTGCTTGG - Intronic
1142388964 16:89785727-89785749 CTGTGGTCTCAAGTGGGGCTAGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147152685 17:38527349-38527371 CTGTAATCTCAAGGGTTGCTGGG + Intergenic
1150226124 17:63525387-63525409 CTGTAAACACAAAGGCAGCTGGG - Intronic
1151340951 17:73470637-73470659 CCGTAATCAAAAGTGGAGGATGG - Intronic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1155127591 18:22894650-22894672 CTGTAATGACAAGTGATGATGGG - Intronic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1158892145 18:61882775-61882797 CTGTAATACCAAGTGGGGGTTGG - Intronic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1159775558 18:72600017-72600039 CTGTAACCACAGGCGGTGCTTGG - Intronic
1159834038 18:73314593-73314615 CTGAAATCTCAACTCGAGCTTGG + Intergenic
1159890437 18:73948301-73948323 CTGTCATCTCCAGTGTAGCTAGG - Intergenic
1164550685 19:29209713-29209735 CTGTAATCCCAGGTAGTGCTAGG - Intronic
1165458968 19:35933005-35933027 CTGTAATCCCAGGTTGAGGTGGG + Intergenic
925556654 2:5138176-5138198 ATGTAAGCACAGGTGGTGCTTGG - Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
929976890 2:46643806-46643828 CTGTCTTGAAAAGTGGAGCTGGG - Intergenic
930461525 2:51684239-51684261 CTGTAATGACAAGGGAAGCTGGG + Intergenic
931330904 2:61282235-61282257 CTGTAATCACAGGCCGAGGTGGG - Intronic
935458517 2:103299834-103299856 ATGTCATCAAAAGAGGAGCTGGG - Intergenic
935662064 2:105475408-105475430 CTTGAATGACAGGTGGAGCTAGG + Intergenic
936345048 2:111669191-111669213 CTGTAATCAAGTGTGCAGCTTGG - Intergenic
936996446 2:118419301-118419323 CTGGAATCTCTAGTGGATCTTGG - Intergenic
937540146 2:122939877-122939899 CTGTAATGACTAGTGATGCTCGG + Intergenic
937707747 2:124940961-124940983 TTGTGATCACATTTGGAGCTAGG + Intergenic
937787112 2:125914030-125914052 CTGAAATCAGAAGTGAAGTTGGG - Intergenic
939122696 2:138137232-138137254 CTGCAATCTCAAGTGAGGCTTGG + Intergenic
939271393 2:139944478-139944500 CTAGAATCACAAGTGGAAGTGGG - Intergenic
940511616 2:154622711-154622733 CTTTAATCACAAATGGTGCAGGG + Intergenic
940551061 2:155157467-155157489 ATGTATTCACAAAGGGAGCTGGG - Intergenic
941004946 2:160238344-160238366 GTGTACTCACAAGTGGAGCCAGG - Intronic
942290175 2:174461493-174461515 CTGTAATCACAAGTGATATTGGG + Intronic
945042406 2:205753157-205753179 CTGTAATCACAAGAGAGGCTGGG - Intronic
946815115 2:223569128-223569150 CTGTATTCACATGTGGAGCCTGG - Intergenic
946826933 2:223688919-223688941 CTGGTAAAACAAGTGGAGCTGGG - Intergenic
1171419515 20:25008543-25008565 CTGTAATACCAAGTGGATCCTGG + Intronic
1172420117 20:34808856-34808878 TTGAAATCACCTGTGGAGCTTGG - Intronic
1174727768 20:52880787-52880809 CTGTAACCACAAGAAGAGATTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1177962955 21:27691600-27691622 CTAGAATCACAAGTGGAGGGAGG + Intergenic
1180657232 22:17432837-17432859 CTGTAATCACAGGGTGAGGTGGG - Intronic
1183922458 22:41180206-41180228 ATGTATTCACAAGTAGATCTTGG + Intergenic
950941373 3:16896369-16896391 CTGAAAGCACAAAAGGAGCTGGG + Intronic
952490478 3:33866678-33866700 GTGTAATCAAATGTGGAACTGGG - Exonic
953277982 3:41522842-41522864 GTGTTATCACAAGAGGAACTGGG + Intronic
954878571 3:53819184-53819206 CTGTAATCACTCGTGGAGGTGGG - Intronic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
962024706 3:131535697-131535719 CTGTAATCACGAGGGGAACTAGG + Intronic
962041785 3:131714897-131714919 CTGTCATCATAAGTGGGGCTGGG - Intronic
967241751 3:187446387-187446409 AGGTAATCACAGGTGGTGCTGGG - Intergenic
968004137 3:195227922-195227944 CTGGTATCACATGTGAAGCTGGG - Intronic
971319271 4:25592211-25592233 CTGTAATCCCAGGTAGAGATGGG + Intergenic
975985761 4:80200367-80200389 TTATAATGACAAGTGGAGATAGG + Intronic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
978448274 4:108801873-108801895 CTGCAATCAAAACTGGAGTTTGG + Intergenic
979377379 4:119962985-119963007 CAGTAATGACCAGAGGAGCTGGG - Intergenic
979381053 4:120007179-120007201 CAGTAATGACCAGAGGAGCTGGG + Intergenic
979602474 4:122601550-122601572 ATGTACTCACACCTGGAGCTGGG + Intergenic
980107981 4:128606754-128606776 CTGAAATCACATGGGGAGTTAGG + Intergenic
982303040 4:153899551-153899573 CTGTAATCCCAACAGTAGCTGGG + Intergenic
987310855 5:16679826-16679848 CTGTAATCAAAACTAGTGCTTGG - Intronic
998504805 5:142663942-142663964 CGCAAATCACAAGTGGAGCTCGG + Intronic
1000306987 5:160003659-160003681 CAGTAATCACATGTGGAGAATGG - Intergenic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1003371208 6:5528616-5528638 ATGTAAGGACAAGTGGTGCTAGG - Intronic
1004188076 6:13439262-13439284 CTGTAATTTCAAGTGGATTTGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005859768 6:29891236-29891258 CTGTGATCACAGGTGGTGGTAGG - Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007131942 6:39483396-39483418 CAGAAATCAAATGTGGAGCTGGG - Intronic
1008290737 6:49713071-49713093 CTGTAATAACAATTAGAGTTGGG - Intronic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1012222421 6:96664955-96664977 CTGTAATCACATGTGGAAAATGG + Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013947499 6:115738461-115738483 CTCTATTCACTAGTGGAGCATGG + Intergenic
1014340513 6:120200472-120200494 CTGTAATCTCATCTGGAGTTTGG - Intergenic
1016754568 6:147669729-147669751 CTAGAATTAGAAGTGGAGCTAGG - Intronic
1017796073 6:157845560-157845582 CTGTAATCACAACTGGTTCATGG + Intronic
1018624424 6:165764106-165764128 CTGTTACCAGGAGTGGAGCTTGG - Intronic
1018886901 6:167946925-167946947 CTGTGATCACAAGTGTACTTAGG - Intronic
1024786044 7:52909196-52909218 CTAGAATTAGAAGTGGAGCTTGG - Intergenic
1029992385 7:104974114-104974136 CTGAAATCCCAAGAGGAGGTTGG - Intergenic
1030130289 7:106193945-106193967 CTGTCAGCACAAGTGGGTCTGGG + Intergenic
1030285916 7:107826634-107826656 GAGTAATCACACCTGGAGCTGGG + Intergenic
1030339606 7:108362220-108362242 CTGTAATCCCAAGTGGAGAAAGG + Intronic
1030469018 7:109939400-109939422 CTGTGATGACAGGTGCAGCTTGG + Intergenic
1030678938 7:112413863-112413885 CTGTATTCACAATTGAAGTTGGG + Intergenic
1033292500 7:140099454-140099476 CTGTAATCCCAAGTTGATTTGGG - Intronic
1036068696 8:5415228-5415250 CTGTGAGCACAGGAGGAGCTGGG + Intergenic
1036278691 8:7380000-7380022 CTGAACTCACCAGTGTAGCTTGG + Intronic
1036342832 8:7931868-7931890 CTGAACTCACCAGTGTAGCTTGG - Intronic
1036838172 8:12092623-12092645 CTGAACTCACCAGTGTAGCTTGG - Intergenic
1036859962 8:12338871-12338893 CTGAACTCACCAGTGTAGCTTGG - Intergenic
1037604866 8:20429553-20429575 CGTTAATAACAAGGGGAGCTTGG - Intergenic
1038791480 8:30672037-30672059 CTGTAATCACCTGTGGAGGGAGG - Intergenic
1043916140 8:85924661-85924683 CTGTTATCACATCTGGAGCAAGG + Intergenic
1044304923 8:90628030-90628052 CTGGGATCAGAAGTGCAGCTGGG - Intronic
1047064076 8:121261092-121261114 CTGTTACCACTAGTGGAGGTGGG - Intergenic
1048048052 8:130791773-130791795 CTGTAAACACCTGTGGGGCTCGG - Intronic
1049729068 8:144166689-144166711 CTGTGAGTACAAGTGGGGCTGGG + Intronic
1050785393 9:9394798-9394820 TTTTAATCAAAAATGGAGCTTGG - Intronic
1052980733 9:34447204-34447226 CTGGAATCACATCTTGAGCTAGG - Intronic
1053623867 9:39848696-39848718 ATGTAATCAAAAGTGGAGACGGG + Intergenic
1053881002 9:42594533-42594555 ATGTAATCAAAAGTGGAGACGGG - Intergenic
1054220030 9:62402004-62402026 ATGTAATCAAAAGTGGAGACGGG - Intergenic
1054230685 9:62507168-62507190 ATGTAATCAAAAGTGGAGACGGG + Intergenic
1055270766 9:74555704-74555726 CTGTAATTCCAATTAGAGCTTGG + Intronic
1056128296 9:83558884-83558906 CTAGAATCAGAAGTGGAGCCTGG + Intergenic
1057422378 9:94922712-94922734 CAGAAATTACAAGTGGAGTTGGG - Intronic
1058979366 9:110155131-110155153 CAGGAATCACAAGTGAAGCCTGG - Intronic
1062247467 9:135576539-135576561 CTGTGGTCACAAGATGAGCTGGG + Intergenic
1186692265 X:11990791-11990813 CTGTAATCTGGTGTGGAGCTAGG + Intergenic
1186872211 X:13784169-13784191 CTGGAATCACCTGGGGAGCTTGG + Intronic
1187758668 X:22555495-22555517 CAGTACTAACAAGTGAAGCTAGG + Intergenic
1187795689 X:23001265-23001287 CTGTTATGACAAGTGCAACTTGG + Exonic
1188977120 X:36689124-36689146 CTGTAAACACAAGTAGAGCCAGG - Intergenic
1189102403 X:38205018-38205040 CTGTAAGCTCAAGTGGACGTGGG - Intronic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1196236773 X:113290920-113290942 CTGTAATGACTAATGGTGCTGGG + Intergenic
1196251472 X:113465305-113465327 CTGTAATCAAAACTGGATCATGG + Intergenic
1201475228 Y:14374570-14374592 CTGTAATCACCAGTTGTGCAGGG + Intergenic