ID: 977809834

View in Genome Browser
Species Human (GRCh38)
Location 4:101346526-101346548
Sequence GCGTCCCACCCAGCCTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977809834_977809851 14 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809851 4:101346563-101346585 CCGCGGGGGCGGGGGGTTCGCGG 0: 1
1: 0
2: 3
3: 44
4: 443
977809834_977809855 24 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809855 4:101346573-101346595 GGGGGGTTCGCGGGGTTCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 208
977809834_977809853 16 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809853 4:101346565-101346587 GCGGGGGCGGGGGGTTCGCGGGG 0: 2
1: 0
2: 10
3: 80
4: 1509
977809834_977809842 -2 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809842 4:101346547-101346569 GCGTGGGGGAAGGGCGCCGCGGG 0: 1
1: 0
2: 0
3: 16
4: 263
977809834_977809841 -3 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809841 4:101346546-101346568 CGCGTGGGGGAAGGGCGCCGCGG 0: 1
1: 0
2: 0
3: 16
4: 193
977809834_977809847 5 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809847 4:101346554-101346576 GGAAGGGCGCCGCGGGGGCGGGG 0: 1
1: 0
2: 2
3: 65
4: 611
977809834_977809849 7 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809849 4:101346556-101346578 AAGGGCGCCGCGGGGGCGGGGGG 0: 1
1: 0
2: 2
3: 52
4: 485
977809834_977809852 15 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809852 4:101346564-101346586 CGCGGGGGCGGGGGGTTCGCGGG 0: 1
1: 1
2: 2
3: 39
4: 425
977809834_977809843 -1 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809843 4:101346548-101346570 CGTGGGGGAAGGGCGCCGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 206
977809834_977809844 0 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809844 4:101346549-101346571 GTGGGGGAAGGGCGCCGCGGGGG 0: 1
1: 0
2: 1
3: 37
4: 396
977809834_977809846 4 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809846 4:101346553-101346575 GGGAAGGGCGCCGCGGGGGCGGG 0: 1
1: 0
2: 4
3: 71
4: 762
977809834_977809848 6 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809848 4:101346555-101346577 GAAGGGCGCCGCGGGGGCGGGGG 0: 1
1: 1
2: 2
3: 76
4: 701
977809834_977809845 3 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809845 4:101346552-101346574 GGGGAAGGGCGCCGCGGGGGCGG 0: 1
1: 0
2: 1
3: 65
4: 892
977809834_977809854 23 Left 977809834 4:101346526-101346548 CCAAGTGAGGCTGGGTGGGACGC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 977809854 4:101346572-101346594 CGGGGGGTTCGCGGGGTTCGCGG 0: 1
1: 0
2: 0
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977809834 Original CRISPR GCGTCCCACCCAGCCTCACT TGG (reversed) Intronic
900076185 1:819875-819897 CCGTCCCACTCAGCCCCACCTGG + Intergenic
900646735 1:3712470-3712492 GGGGCCTCCCCAGCCTCACTTGG - Intronic
901409424 1:9072030-9072052 GAGTCCCCCTCAGCCTCACCCGG + Intronic
902776625 1:18679115-18679137 CCTTCACACCCAGCCCCACTGGG + Intronic
902890747 1:19441634-19441656 GGACCCCACCCAGCATCACTTGG - Intronic
912580057 1:110712777-110712799 GCCTCCCACCCAACCCCACAAGG + Intergenic
914720633 1:150285859-150285881 GCCTCCCACCCAGCCTCAGCTGG - Intronic
914742555 1:150477427-150477449 CATTCCAACCCAGCCTCACTGGG - Intergenic
915165075 1:153944010-153944032 GAGTCCCTCCCAGCCTCCCCTGG + Intronic
915604311 1:156941130-156941152 AATTCCCACCCAGCCTCTCTGGG - Intronic
917122028 1:171652757-171652779 CAGCCCCACCCAGCCTCACGTGG - Intergenic
922801848 1:228368108-228368130 GCCTGCCACCCCGCCTCACCTGG + Intronic
1064237158 10:13587025-13587047 TCCTCGAACCCAGCCTCACTGGG - Exonic
1065646777 10:27843381-27843403 GTGTACCACCCAGCATAACTGGG + Intronic
1068942105 10:62690386-62690408 GCCTCCCTCCCAGCCACACCTGG + Intergenic
1069751039 10:70745144-70745166 GCGTCCCCCACTCCCTCACTGGG - Intronic
1071165629 10:82802958-82802980 ACATCGCACCCAGCCTCCCTAGG + Intronic
1073989431 10:109245708-109245730 GCTTCCCACACAGCCTCAGCTGG + Intergenic
1074318862 10:112382520-112382542 GAGTCCCAGGAAGCCTCACTGGG + Intronic
1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG + Intergenic
1075256847 10:120932109-120932131 GACTCTCAGCCAGCCTCACTAGG - Intergenic
1076133275 10:128028332-128028354 GGGTCACACACAGCCACACTCGG + Intronic
1076560696 10:131361468-131361490 CAGCCCCACCCAGCCTCACCTGG + Intergenic
1076670437 10:132117996-132118018 GAGTCCCACACATCCTCACGGGG + Intronic
1076811032 10:132886499-132886521 GAGCCCCACCCAGCCTCCATAGG + Intronic
1076874958 10:133211321-133211343 TGGTCCCACCCTGCCTCTCTGGG + Intronic
1077339389 11:2019224-2019246 GCGTCTCCCCCAGCCTCCCCAGG - Intergenic
1080711256 11:34750056-34750078 GAGTCAAACCCAGCTTCACTGGG + Intergenic
1085021738 11:73214377-73214399 GCATCCCAGGCGGCCTCACTTGG + Intergenic
1085266439 11:75240675-75240697 GCCTCCCACCCCGCCTCCCACGG + Intergenic
1202822374 11_KI270721v1_random:74413-74435 GCGTCTCCCCCAGCCTCCCCAGG - Intergenic
1096109524 12:49020679-49020701 GGGCCACACCCTGCCTCACTAGG + Exonic
1096530525 12:52239746-52239768 GCTACCCACCCAGCCCCTCTGGG - Intronic
1103561742 12:121796466-121796488 GCGTTGCCTCCAGCCTCACTGGG - Intronic
1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG + Intergenic
1106394690 13:29368308-29368330 GTGTCCCACCCATCCTCTCCAGG + Intronic
1107986820 13:45783343-45783365 GCTCCCCACACAGCCTCCCTAGG - Exonic
1108020995 13:46127566-46127588 GCCTCCCACCCAGCCCCATTGGG + Exonic
1108497487 13:51039954-51039976 GTGTCCCTGCCAGCCTCACTGGG - Intergenic
1109979873 13:69894005-69894027 GCAACTCCCCCAGCCTCACTTGG + Intronic
1112155068 13:96808290-96808312 TGGTCCCACCCAGCCACAATGGG - Intronic
1112478313 13:99752284-99752306 GCCTGCCACCCAGCCTAGCTTGG + Intronic
1112630263 13:101153626-101153648 GTGTCCCCCCCTGCCTCAGTGGG + Intronic
1113343680 13:109452085-109452107 GCCTCCAATCCTGCCTCACTTGG + Intergenic
1113598994 13:111555009-111555031 TCATCCCACCCAGCCTCCCTGGG - Intergenic
1119478999 14:74948222-74948244 GGGTCCCTCCCAGCCTCGCAGGG - Intronic
1120070819 14:80100349-80100371 GAATCCCACCCAGGCTCACATGG + Intergenic
1121661706 14:95640072-95640094 GCTTCCCACCCTTCCTCATTGGG + Intergenic
1122132770 14:99614769-99614791 TCGTCCCCTCCAGCGTCACTAGG - Intergenic
1122996532 14:105268328-105268350 GCTGCCCACGCAGCCTCCCTGGG + Intronic
1123008738 14:105337024-105337046 CCGCACCACCCAGCATCACTGGG + Intronic
1123035852 14:105471676-105471698 ACGTCCCACCCACCCTCCCTGGG + Intergenic
1124002762 15:25772433-25772455 GTGGCCCACGCAGGCTCACTGGG + Intronic
1125541300 15:40471303-40471325 GCGGCCCACCCAGCCCCGCCCGG - Exonic
1128379697 15:67103573-67103595 GAGTCCCACTCACCCTCCCTGGG + Intronic
1128608741 15:69057490-69057512 GCGTCCCTCAGAGCCTCTCTGGG + Intronic
1131290303 15:91101139-91101161 GCGTCCCACCCCACCCCACTGGG - Intronic
1132568577 16:634372-634394 GTCTCCCACCCAACCTCACAAGG + Intergenic
1133977828 16:10612705-10612727 GTGTCCTACCCAACCTCGCTGGG - Intergenic
1135467966 16:22703491-22703513 GGGTCTAATCCAGCCTCACTAGG + Intergenic
1136069413 16:27778976-27778998 GCATCCCATCCAGCCTCAGAGGG + Exonic
1136145454 16:28313755-28313777 GCCTCCCACCCAGCCCCAAACGG - Intronic
1138491539 16:57379967-57379989 GGCTGCCACCCAGCCACACTGGG - Intronic
1140189277 16:72801242-72801264 ACGTGGCACCCAGCCCCACTTGG + Intronic
1140900608 16:79363936-79363958 GCTACCCATCCAGCCTGACTGGG + Intergenic
1141780120 16:86153854-86153876 CACTACCACCCAGCCTCACTTGG + Intergenic
1141874100 16:86809594-86809616 GATTCCAACCCAGCCTCTCTGGG - Intergenic
1142604721 17:1075116-1075138 GAATCCCAGCCATCCTCACTTGG - Intronic
1143885180 17:10059958-10059980 GCATCCCACCCACCCTCAGGGGG - Intronic
1144829875 17:18125282-18125304 GCGTCCCACCCGGCCCCAGGAGG - Intronic
1147160586 17:38567496-38567518 GCATCCCACCCAGACTCCCCAGG - Intronic
1147494558 17:40903595-40903617 CCCTCCCACCCAGCTTTACTTGG - Intergenic
1151733564 17:75925085-75925107 GTGCCCCACCCAGCCTCAGAAGG - Intronic
1155175546 18:23298316-23298338 GCGTCCCACACATCCTGACCAGG + Intronic
1155362314 18:25015786-25015808 GCTTCCTCCCCAGCCTCAGTGGG + Intergenic
1157750643 18:50175084-50175106 AGGTCCCACCCAGCCTCTCAGGG + Intronic
1160315248 18:77838143-77838165 GAGTCCTCCCCAGCCTCCCTGGG + Intergenic
1160895197 19:1399238-1399260 GCGCCTCACCCAGCCTCACCCGG + Intronic
1161070031 19:2255443-2255465 TCCTCCCACCCCTCCTCACTCGG + Intronic
1161070062 19:2255547-2255569 CCCTACCGCCCAGCCTCACTGGG + Intronic
1161089212 19:2351853-2351875 GCGTCCCACCCGGCACCCCTGGG - Intronic
1161328699 19:3676026-3676048 GGATCCCACCCAGCCTGACCAGG + Intronic
1162099788 19:8332984-8333006 GTGTCCCACCCACCCTCCCTTGG + Intronic
1167674368 19:50875306-50875328 GCTCCCCACCCACCCTCACGGGG - Intronic
1168058865 19:53879421-53879443 GCGTCCCGCCCAGCCTCGCGGGG + Intronic
1168115686 19:54220422-54220444 GCCTCCCTCACAGCCTCCCTCGG + Intronic
1168118673 19:54240168-54240190 GCCTCCCTCACAGCCTCCCTCGG + Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925140082 2:1544112-1544134 GTGTCCCACCCAGTCTCATGTGG - Intergenic
926646843 2:15298989-15299011 GCTTCACACCCAGAATCACTCGG + Intronic
928201824 2:29252105-29252127 GTGTCCCACCCAACGTCCCTAGG + Intronic
931374412 2:61694815-61694837 CCGCCCCACCCCGCCTCCCTTGG - Intergenic
932059701 2:68483360-68483382 GGCTCCCAGCCAGTCTCACTGGG + Intronic
936233239 2:110722611-110722633 GCTTCCCACCCAGCCTCTGGTGG - Intergenic
936403850 2:112185379-112185401 GCATCCAGCCCAGCCACACTTGG - Intronic
942098466 2:172555898-172555920 GAGTCCCGCCCAGCCTCCCGAGG - Intronic
944352441 2:198744886-198744908 GTGCCCCACACAGCTTCACTGGG + Intergenic
946330053 2:219003915-219003937 GCCTCCCTCCCGTCCTCACTGGG + Intronic
948116462 2:235497120-235497142 GCTACCCACCCACCCTCACAGGG - Intronic
1171510015 20:25674578-25674600 GCTTCCCTCCCAGCCTTCCTTGG - Exonic
1173298758 20:41782198-41782220 TTGTCCCACCCTGCCACACTGGG + Intergenic
1174823342 20:53746337-53746359 GTGTCCCACCCAGACCCACATGG - Intergenic
1175387149 20:58604676-58604698 GCGGCTCACCCTGCCCCACTGGG - Intergenic
1176121648 20:63456801-63456823 GGGTCCCACGCAGCCTCCTTAGG + Intronic
1176410208 21:6445696-6445718 GCAGCCCACCCAGCCTCCCACGG - Intergenic
1178792326 21:35711964-35711986 CCTTCCCACACAGCCTCACAAGG - Intronic
1179631890 21:42683898-42683920 TCGCCCCACCCCGCCCCACTGGG - Intronic
1179685701 21:43054018-43054040 GCAGCCCACCCAGCCTCCCACGG - Intronic
1179909263 21:44439271-44439293 CGGTCCCACCCAGCTTCACCAGG + Intronic
1180123247 21:45768093-45768115 GCTTCCCTCCCAGCTGCACTGGG + Intronic
1181167692 22:20992345-20992367 GCAGCCCACCCAGCCTGCCTCGG + Exonic
1181734126 22:24868557-24868579 GCCTCCACCCCAGCCTCCCTGGG - Intronic
1182764832 22:32751137-32751159 GCGTCCCTCCTGGCGTCACTGGG - Intronic
1183668263 22:39257385-39257407 GCCCCAGACCCAGCCTCACTAGG + Intergenic
1183987633 22:41578189-41578211 GCGCCCCAGCCATCCCCACTCGG - Intronic
1184822777 22:46923269-46923291 TCTTCCCACACAGCCACACTGGG + Intronic
1185272192 22:49934778-49934800 GCGCCCCTCCCCGCCTCCCTGGG + Intergenic
949535884 3:4995799-4995821 CCCTCCCACCCAGTCACACTAGG - Intergenic
954337453 3:49928071-49928093 GGGTACCACTCAGCCACACTGGG - Intronic
966093844 3:176173751-176173773 GTGTCCTTCCCAGCCTCAGTTGG - Intergenic
968812013 4:2804439-2804461 GCTTCCCAACCAGCCTCCCCAGG + Intronic
970561414 4:17285194-17285216 CCTGCCCACCCAGCCTCAATGGG - Intergenic
975248496 4:72149068-72149090 GCTTCCCACACTGCCACACTGGG - Intergenic
976583159 4:86763801-86763823 TCCTCCCACCCAGCCTCCCAAGG - Intronic
977809834 4:101346526-101346548 GCGTCCCACCCAGCCTCACTTGG - Intronic
985100114 4:186450500-186450522 GCCTCCCTCTCAGCCTCACTTGG + Intronic
985425660 4:189828104-189828126 CCCTCTCACCCAGCCTCACGGGG + Intergenic
985579042 5:687153-687175 GCGTCCCACCAAGCCTCCAGAGG + Intronic
985593885 5:779216-779238 GCGTCCCACCAAGCCTCCAGAGG + Intergenic
985764067 5:1767844-1767866 GCAGCCCACCCACCCTCAGTGGG - Intergenic
985856803 5:2434812-2434834 ATCTCCCACCCACCCTCACTGGG - Intergenic
986402233 5:7394036-7394058 CCCTCCCACCAAACCTCACTGGG - Intergenic
986707895 5:10466431-10466453 GCGTGCAACACAGCATCACTGGG + Intronic
986723888 5:10580361-10580383 GGTCCCCACCCAGCCTCACTTGG + Intronic
987418579 5:17691500-17691522 GCTTCCTTTCCAGCCTCACTGGG + Intergenic
998492176 5:142556796-142556818 GGGCCCTACCCAGCCTCTCTAGG + Intergenic
999732797 5:154487872-154487894 CCATCCCACCCTGCCTCACAGGG + Intergenic
1002073410 5:176694193-176694215 ACGTCCCCTCCAGTCTCACTGGG + Intergenic
1002080700 5:176735810-176735832 GCGTACCACCCAGCAGCTCTTGG + Intergenic
1002661355 5:180792816-180792838 GCGACCCCGCCAGCCTCACCCGG - Exonic
1002772395 6:301136-301158 GCTTCCCACCAAGACTCCCTGGG + Intronic
1006466165 6:34196188-34196210 TCGTCCCAACCTGCCTCACTGGG + Intergenic
1006501095 6:34459302-34459324 GCAGCTCACCCAGCCTCTCTGGG + Intergenic
1007476825 6:42124635-42124657 GCTCCCCACCCACCCTGACTTGG + Intronic
1017906935 6:158763158-158763180 GGTTCCCACCCTGCTTCACTGGG + Intronic
1019183364 6:170207005-170207027 GCTTCCTACCCAGCCTCCCTGGG + Intergenic
1019505626 7:1389065-1389087 CCTTCCCAGCCAGCCTCACACGG - Intergenic
1020557264 7:9685822-9685844 GCACTCCACCCAGCCACACTAGG - Intergenic
1021951394 7:25778531-25778553 GGGTCCCACCCATCCTGGCTTGG + Intergenic
1023414577 7:39919873-39919895 GTGCCCCATCCAGACTCACTTGG - Intergenic
1023760840 7:43463865-43463887 GCCTCCCACCCTGCCTCATGGGG + Intronic
1024237577 7:47409630-47409652 GCATCGCCCCCAGCCTCTCTTGG + Intronic
1025262464 7:57427782-57427804 CTGACCCACCCAGCGTCACTAGG - Intergenic
1029715449 7:102322965-102322987 GCCTCCCACCCAGGATTACTCGG - Intergenic
1032197639 7:129798709-129798731 GGGTCTCCCCCATCCTCACTGGG - Intergenic
1033253147 7:139777680-139777702 TCGGCCCCCCCAGCCTCAGTCGG + Exonic
1035533822 8:375871-375893 CCGTCCCACTCAGCCCCACCTGG - Intergenic
1037291992 8:17360851-17360873 GCCTGCCACCCGGCCTCTCTGGG + Intronic
1040860110 8:51990346-51990368 CCATCACACCCCGCCTCACTAGG - Intergenic
1040892972 8:52336646-52336668 CCATCTCACCCAACCTCACTTGG - Intronic
1042525821 8:69763497-69763519 GCCTCCCACCCAGCATAGCTGGG - Intronic
1042836872 8:73086965-73086987 TCGTCCCACCCATCCCCACCAGG - Intronic
1048502194 8:134988459-134988481 GCATCCTCCCCAGCCTCATTGGG + Intergenic
1049242894 8:141547646-141547668 GCAGACCCCCCAGCCTCACTCGG - Intergenic
1049327247 8:142029204-142029226 GGCTCCCACCCAGCCACACATGG - Intergenic
1053426860 9:38015914-38015936 GGTCCCCAACCAGCCTCACTGGG - Intronic
1056816548 9:89805962-89805984 GAGTCCCACCCAGTCTCCCAAGG - Intergenic
1057016578 9:91657657-91657679 ACGTCCCACCCAGCAGCACAGGG + Intronic
1057030371 9:91770379-91770401 GGGCCCACCCCAGCCTCACTCGG + Intronic
1057227094 9:93298115-93298137 GCCTACCTCCCAGGCTCACTCGG - Intronic
1057231400 9:93323775-93323797 CCGGCCCACACAGCCTCACTGGG - Intronic
1060945928 9:127569233-127569255 GCGCCCCACCCAGCCCCTCCAGG + Intronic
1062423712 9:136496601-136496623 GCTGGCCACCCAGCCTCACCTGG - Exonic
1191972255 X:66829587-66829609 CCCTCCCACCCATCCTCCCTGGG + Intergenic