ID: 977818734

View in Genome Browser
Species Human (GRCh38)
Location 4:101446625-101446647
Sequence TCATTCCCACACAAAGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977818734 Original CRISPR TCATTCCCACACAAAGACTT TGG (reversed) Intronic
900839092 1:5032757-5032779 ACATTCCTATACAAAGATTTGGG + Intergenic
902220967 1:14964773-14964795 TCATTCAAACACAAAGACGGTGG - Intronic
903389926 1:22956415-22956437 TCACTCCCACACACAGAACTGGG - Intronic
903907271 1:26696091-26696113 TCATTCCCAGGCAAGGGCTTGGG + Exonic
905931798 1:41793136-41793158 ACATGCCACCACAAAGACTTCGG + Intronic
906524802 1:46487855-46487877 TCAGTCACACACACAGACATGGG - Intergenic
906767706 1:48449833-48449855 TCATTTCACCACAAATACTTTGG - Intronic
907811714 1:57877417-57877439 ACATTCCCACACACACCCTTTGG + Intronic
908169630 1:61491915-61491937 TCATTCCCACACATATTCCTCGG + Intergenic
912034016 1:105287812-105287834 ACATTCCCACTCCAAGATTTTGG + Intergenic
915954227 1:160209407-160209429 ACACTCACCCACAAAGACTTGGG - Intronic
916279096 1:163028833-163028855 TCATTCCCAGAGAAGGAGTTAGG - Intergenic
916524444 1:165596630-165596652 TCATTTTCACACAAAGGATTTGG - Intergenic
917686211 1:177418648-177418670 TCATTCTCACCCGAAGACTGAGG - Intergenic
919510566 1:198458530-198458552 TTACTCCCACAAAAAGAGTTTGG - Intergenic
920888862 1:209962696-209962718 TCATTCCCCTTCAAAGACTGGGG - Intronic
923145150 1:231192603-231192625 TCATTCACACACAAAGGACTGGG + Intronic
923838075 1:237636703-237636725 ATATGTCCACACAAAGACTTGGG + Intronic
1063659347 10:8023024-8023046 TGATTCAAACACAAAGATTTGGG - Intergenic
1063810610 10:9701288-9701310 TCTTGCACACACAAAGAATTTGG + Intergenic
1068890787 10:62146583-62146605 CCATTCCCACAGAGAAACTTTGG - Intergenic
1068923138 10:62506388-62506410 CCATACCCACACACAGACTTGGG + Intronic
1070857671 10:79620104-79620126 TCATGCACACACAGAGACTTAGG - Intergenic
1071695643 10:87866246-87866268 TCATTTCAAAACAAAAACTTGGG - Intronic
1072041325 10:91609478-91609500 TCATTCCCATATATAGAATTGGG + Intergenic
1072892098 10:99332747-99332769 TCATACCAACACAAAGTCTAGGG - Intronic
1074327786 10:112469790-112469812 TCATTTTCAGCCAAAGACTTAGG + Intronic
1076074339 10:127521473-127521495 TCATAACCACAAAAACACTTTGG + Intergenic
1076360277 10:129883551-129883573 TGATTCACACACGAACACTTTGG - Intronic
1079815621 11:25053574-25053596 TCATCCCCACACTAAGCCTCAGG + Intronic
1083776920 11:64898523-64898545 GCATTCCCACACAAACACCCAGG - Intronic
1085436884 11:76513049-76513071 TCCTTTCCATACAAATACTTAGG - Intronic
1085512250 11:77094311-77094333 TCTTTCCCACCCAAACCCTTTGG - Intronic
1086071206 11:82801688-82801710 TCTTTCCCAGACAAACACTAAGG - Intergenic
1087002153 11:93432117-93432139 TCATCCCAATACAAAGCCTTGGG + Intronic
1087354263 11:97074293-97074315 TCAGGCTCACACAAAGACCTGGG - Intergenic
1087548105 11:99610364-99610386 TCAGTCCCACACCAATATTTAGG + Intronic
1087692267 11:101335189-101335211 TCCTTCCCCCAGGAAGACTTGGG - Intergenic
1089891171 11:121883066-121883088 TCATTCCCACTCTGAGACATGGG + Intergenic
1090483302 11:127086803-127086825 TCATCCCCATGCAGAGACTTTGG + Intergenic
1091613267 12:2029887-2029909 TCATGCCCTCACAAACACCTGGG - Intronic
1092810082 12:12264584-12264606 TTTTTCCCCCACAAAGAATTGGG - Intronic
1095321644 12:40835635-40835657 TCAATCCCACACACAGAATCAGG + Intronic
1095372218 12:41482289-41482311 AGATTCCCACAGAAATACTTTGG + Intronic
1099901558 12:88716672-88716694 TCCTACCCACACAAATAATTTGG - Intergenic
1103885294 12:124195854-124195876 TCATTCCCAAACAATCACTCAGG - Intronic
1105767150 13:23572790-23572812 TAATTGCCACAAAATGACTTTGG + Intronic
1106295704 13:28411777-28411799 TCATTCCCAGACAATGGCTCTGG - Intronic
1108870671 13:54980887-54980909 TCATTTCCAAACACAGATTTTGG - Intergenic
1111444167 13:88323712-88323734 GCATTTCAACACAAAAACTTGGG + Intergenic
1111487760 13:88926695-88926717 TCAGTCAGACACACAGACTTGGG - Intergenic
1112302550 13:98243202-98243224 TGATTCCCAAACTAAGATTTGGG + Intronic
1113526853 13:110985984-110986006 CCTTTCTCACACAAAGACTTTGG + Intergenic
1114956666 14:27829077-27829099 TCATTTCCACACAAAGAAAATGG - Intergenic
1115169983 14:30493848-30493870 TGATTCCCATACAAACAATTTGG + Intergenic
1115299881 14:31872950-31872972 TCATTCGCACCCTATGACTTTGG + Intergenic
1116651768 14:47603015-47603037 TGTTGCCCACACAAAGCCTTGGG + Intronic
1117331040 14:54712174-54712196 TCATCCCCACCCAAAGCCTTTGG + Intronic
1118566379 14:67145568-67145590 TCATTCCCACTCAAGGAGGTAGG - Intronic
1121106874 14:91286250-91286272 CCGTTCCCACTCAAAGACCTTGG + Intronic
1202832008 14_GL000009v2_random:45029-45051 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1126605628 15:50473201-50473223 TCAATCCCCCACAAATACTGAGG - Intronic
1127621704 15:60740392-60740414 TCATTCGCAGACACAGAATTCGG + Intronic
1127891025 15:63251047-63251069 TCATCCCCACAAAAAGATTAGGG + Intronic
1130184506 15:81667121-81667143 TCCTTCCCACATAGGGACTTAGG - Intergenic
1130306507 15:82715262-82715284 TCCTTCCCATACAGAGCCTTTGG + Intergenic
1131438988 15:92444517-92444539 TCATCCCCAAACAAAGACCCAGG - Intronic
1134162186 16:11900505-11900527 TCATTCCCACCAAAAGCCTTAGG + Intronic
1134204884 16:12229026-12229048 TCATTCCTTCACACAGACCTTGG + Intronic
1137396441 16:48118734-48118756 TCATGCCCACACACAAACTTTGG + Intronic
1139136167 16:64207204-64207226 TCCTTCCCCCACAAACCCTTAGG - Intergenic
1140922899 16:79555095-79555117 TCATTTCCAGACAGAGCCTTAGG - Intergenic
1143720345 17:8804773-8804795 TTCATCCCACACACAGACTTTGG + Intronic
1145156296 17:20547170-20547192 TCAGTCACACACGAAGCCTTCGG - Intergenic
1151005774 17:70434468-70434490 TAATTAACAGACAAAGACTTAGG - Intergenic
1151992603 17:77586720-77586742 TCATACACACACAAATACCTAGG - Intergenic
1153084731 18:1271417-1271439 TCATTCCCCCACAAGGACAAAGG + Intergenic
1155463595 18:26111294-26111316 TGATTCCCACACAAAAATGTTGG - Intergenic
1156366606 18:36433425-36433447 TCATTTCCACACAGGGAGTTTGG - Intronic
1156602771 18:38629950-38629972 TCTTTTCCACACAAAGATATTGG - Intergenic
1161816783 19:6504058-6504080 ACTTTCCCACTCAAGGACTTTGG + Intergenic
1163172058 19:15538197-15538219 TAATTCTCACACAATGACTATGG - Intronic
1167807614 19:51799500-51799522 TCATCCACACACACAGACATTGG - Intronic
1202640674 1_KI270706v1_random:82723-82745 TCATTCCAAGAAAAAGTCTTAGG - Intergenic
926360079 2:12078629-12078651 CCATTCCCACACAGGGACTTGGG + Intergenic
926376131 2:12229413-12229435 TCATTCTCACAGATAGACTCAGG - Intergenic
927115814 2:19901362-19901384 TCATTCGCACCCAGAGACTTAGG - Intronic
928611048 2:32992976-32992998 TCCTTCCCCAACAAAAACTTGGG - Intronic
928806211 2:35159688-35159710 TTATTAACACACAAAGAATTAGG - Intergenic
933122651 2:78560593-78560615 TAATTCCAACACTAAGCCTTTGG + Intergenic
934480618 2:94638903-94638925 TCATTTCCACACAAAGAAGATGG + Intergenic
935162849 2:100544193-100544215 TGACTCCCTCACAAAGCCTTGGG + Intergenic
935899432 2:107774980-107775002 GCACTCCCAAACAAAGCCTTTGG - Intergenic
937695818 2:124807501-124807523 TCATTCTCACACAATGACTATGG + Intronic
938562159 2:132482656-132482678 ACATTCCCTCACAAAATCTTTGG + Intronic
939173493 2:138723087-138723109 TCTTTCCCACAACAAGACTGAGG + Intronic
939503426 2:143014108-143014130 ACATTCCTACACAAAGATTATGG + Intronic
940842645 2:158601821-158601843 TCATAACCACATAATGACTTGGG + Intronic
941221690 2:162789073-162789095 ACTTTCCCAAACAAAGACTGAGG + Intronic
943783604 2:191851469-191851491 TCATTGATACACAAGGACTTTGG - Intergenic
944288763 2:197980092-197980114 GCATTCCCACACACAGAGTCAGG - Intronic
945992208 2:216405613-216405635 TCAGTACCACGCAAAGACATTGG - Intergenic
946670886 2:222103032-222103054 TCATGCTCACAAAATGACTTGGG - Intergenic
1169196805 20:3687597-3687619 TCACTCTCACACTAAGACTGAGG - Exonic
1170600132 20:17835686-17835708 CCCTTCCCAGACAAAGACCTGGG + Intergenic
1171199952 20:23232896-23232918 TGATTCCCCCACAAATATTTTGG - Intergenic
1171385015 20:24764125-24764147 TCTTTCCCAAGCAAAGTCTTGGG - Intergenic
1172391524 20:34568457-34568479 GCCTTCCCACACACAGACCTGGG + Intronic
1175313135 20:58025516-58025538 CCCTTCCCACACAAAGGCTTGGG - Intergenic
1177460892 21:21408663-21408685 TCATTCCCACAATAAGTTTTAGG - Intronic
1178373269 21:32045311-32045333 ACTTTCCCAGACAAAGACTGAGG + Intergenic
1179022843 21:37655929-37655951 TCTTTCCCACACACAGCCCTGGG + Intronic
1180361268 22:11899139-11899161 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1181150074 22:20876891-20876913 TCATTATCACACAAACCCTTCGG + Intronic
1181714495 22:24714222-24714244 TCTTTCTCTCTCAAAGACTTCGG + Intergenic
1183145608 22:35988682-35988704 TTAGTCCCACTAAAAGACTTTGG - Intronic
951276264 3:20689898-20689920 TCATCCCCACATAAGGACTGAGG - Intergenic
953156010 3:40374390-40374412 TCATTCCCACTGAAGGGCTTTGG + Intergenic
954693805 3:52409969-52409991 TCAGTCCCACACACAGACAACGG + Exonic
954836524 3:53473804-53473826 ACACTCCCACCCAAAGACTGTGG - Intergenic
955087273 3:55715463-55715485 TCATTCCCACACACTGAACTTGG + Intronic
958544471 3:95524599-95524621 ACATGTCAACACAAAGACTTTGG - Intergenic
958731370 3:97963926-97963948 TCACTCCCACTCAAACACTGTGG + Intronic
960915708 3:122692762-122692784 TCAGTCACACACACACACTTGGG - Intronic
961132732 3:124483898-124483920 TCATTTCCACAGAAAGCCTGGGG + Intronic
963375880 3:144464032-144464054 AAATACACACACAAAGACTTGGG + Intergenic
964784874 3:160385228-160385250 TAATTGCCACATAAAAACTTAGG + Intronic
965245893 3:166268103-166268125 GCATACCCAATCAAAGACTTGGG - Intergenic
1202737876 3_GL000221v1_random:24664-24686 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
969129443 4:4980831-4980853 TTATTGCCACGCAAAGCCTTGGG + Intergenic
973114819 4:46442657-46442679 TCATTCCCATACAAATATATAGG + Intronic
974859746 4:67505438-67505460 TCAATCCCCCACAAATACTGAGG - Intronic
975396509 4:73880323-73880345 GCATTCCCATACAACGACATCGG - Intergenic
976980765 4:91224434-91224456 CCATTGTCACACAAAGACATTGG - Intronic
977726547 4:100302896-100302918 TTATTCCCACTCAATTACTTGGG - Intergenic
977818734 4:101446625-101446647 TCATTCCCACACAAAGACTTTGG - Intronic
978326033 4:107556805-107556827 TCATTCTAACAAAAACACTTAGG - Intergenic
979139399 4:117153088-117153110 CCATTCCCATACAGAGAATTTGG - Intergenic
982306703 4:153939808-153939830 TCATTCCCACACAGGGCCTGTGG - Intergenic
982726056 4:158907949-158907971 AAATTCCCACACAATGACATTGG - Exonic
983988977 4:174095220-174095242 TCATTGCCTCCCAAAGTCTTGGG - Intergenic
984743839 4:183194060-183194082 TGTTTGCCACAGAAAGACTTGGG + Intronic
984894894 4:184529611-184529633 TCCTGCCCACACAAAGACTCAGG + Intergenic
1202768045 4_GL000008v2_random:168578-168600 TCATTCCAAGAAAAAGTCTTAGG - Intergenic
985943215 5:3155589-3155611 GCATTCCCACCCAAACACGTGGG - Intergenic
986983994 5:13479836-13479858 GGAATTCCACACAAAGACTTTGG - Intergenic
988627071 5:32888676-32888698 TCTTTCACAGACAAAGGCTTTGG + Intergenic
990342651 5:54838992-54839014 TCAGCCACAAACAAAGACTTGGG - Intergenic
992120865 5:73590684-73590706 GCATTACCACACAAAGACTTTGG - Intergenic
993654455 5:90560113-90560135 CCATTAACACACAATGACTTCGG + Intronic
994561375 5:101377824-101377846 TCATACACACACAAATAATTTGG + Intergenic
994596991 5:101851807-101851829 ACTTTCCCAGACAAAGACTACGG + Intergenic
997671144 5:135673195-135673217 ACATTTTCACACAAAGATTTAGG - Intergenic
997715572 5:136040212-136040234 ACATCCCTACACATAGACTTTGG + Intronic
997839973 5:137230292-137230314 ACATTCACACCCAAGGACTTGGG + Intronic
998565693 5:143214098-143214120 TCATCCCCTCACAAAGATATGGG + Intronic
998667415 5:144314217-144314239 CCATTACCACCCAAATACTTTGG - Intronic
998818116 5:146033774-146033796 TTTTTCCCACAAAAAGGCTTAGG - Intronic
999548778 5:152660914-152660936 TCATTCCCCCACAGAAACTGAGG + Intergenic
999933368 5:156458028-156458050 TGTTTGCCACAGAAAGACTTGGG - Intronic
1000265498 5:159632345-159632367 TCCTTCCCACCCAAAGAGATGGG - Intergenic
1003748398 6:9027593-9027615 TAGTTCACACACATAGACTTTGG - Intergenic
1006413894 6:33892378-33892400 TCCTTCCAGCCCAAAGACTTGGG + Intergenic
1008787888 6:55192215-55192237 TCATTCCAACAAAAAAAATTAGG + Intronic
1009674579 6:66801630-66801652 TCATTCCCACCCAAAGGTTTTGG - Intergenic
1010605779 6:77888547-77888569 TCTTTCCCATACAAATACTGAGG - Intronic
1011906659 6:92378382-92378404 TCATTAACACACAAAGACAAAGG - Intergenic
1016410989 6:143784558-143784580 TCATTCCCACAGAAAAGCTATGG + Intronic
1016668903 6:146677705-146677727 TCATTCCAACACATAGAATGTGG + Intronic
1019916148 7:4134020-4134042 GCTTTCCCACTCAAAGACCTTGG - Intronic
1020749535 7:12123165-12123187 TGATTCTCACACCAAGGCTTGGG + Intergenic
1023152704 7:37216709-37216731 ACACACCCACACAAAGGCTTAGG + Intronic
1028546068 7:92002355-92002377 TTTTTCCCACACAGAGTCTTTGG - Exonic
1029843883 7:103393433-103393455 TCCTCCCCACCCCAAGACTTGGG - Intronic
1031878111 7:127164587-127164609 GCCTTCACACACACAGACTTTGG + Intronic
1032025174 7:128435576-128435598 TGATTCCCACACAAAAAGTTTGG + Intergenic
1033713094 7:143969669-143969691 CCATCTCCACAGAAAGACTTTGG - Intergenic
1035897811 8:3423702-3423724 ACATTTCCACACAAAGACCTGGG - Intronic
1036383059 8:8251717-8251739 ACATTCCCACACAAAGAATAAGG - Intergenic
1037123308 8:15315932-15315954 TAATTCCCAAACTAAGACTTGGG - Intergenic
1037307400 8:17519968-17519990 TTATTCCCCAACAATGACTTGGG + Intronic
1042685002 8:71428312-71428334 TCATTGCCACACAACAACATAGG - Intronic
1042972375 8:74424026-74424048 CCAATCCCCCACAAATACTTAGG - Intronic
1043541830 8:81272283-81272305 TCTTTCACACCCAAAGCCTTAGG - Intergenic
1043588233 8:81794484-81794506 GCATTCCCAGACAAAAAGTTAGG + Intergenic
1046714544 8:117553192-117553214 GGATTCCAACCCAAAGACTTGGG - Intergenic
1047398083 8:124521313-124521335 TTATTCACACACACACACTTAGG - Intronic
1049329961 8:142045289-142045311 TCATTCCCACAGAAAGTGATGGG + Intergenic
1050816123 9:9814345-9814367 TCATTTTCAAACAAATACTTTGG - Intronic
1050938975 9:11435224-11435246 TAACACCCACACACAGACTTTGG + Intergenic
1050962487 9:11752804-11752826 TCATTCCCACTCACAGGATTTGG + Intergenic
1051516755 9:17938367-17938389 ACTTTCACACACAAAGACTGAGG - Intergenic
1053660900 9:40277668-40277690 TCATTCCAAGAAAAAGTCTTAGG + Intronic
1053911279 9:42907007-42907029 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1053926972 9:43071188-43071210 TCATTTCCACACAAAGAAGATGG - Intergenic
1054286503 9:63179886-63179908 TCATTTCCACACAAAGAAGATGG + Intergenic
1054361902 9:64130639-64130661 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1054373022 9:64423882-64423904 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1054388314 9:64585098-64585120 TCATTTCCACACAAAGAAGATGG - Intergenic
1054523710 9:66098616-66098638 TCATTCCAAGAAAAAGTCTTAGG - Intergenic
1054680652 9:67913661-67913683 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1056723287 9:89089733-89089755 TCATGCCCCCAAGAAGACTTGGG - Intronic
1057461970 9:95271233-95271255 TCATTCCCACACTAGCACATGGG + Intronic
1203692453 Un_GL000214v1:57484-57506 TCATTCCAAGAAAAAGTCTTAGG - Intergenic
1203706603 Un_KI270742v1:55108-55130 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1203556637 Un_KI270744v1:4376-4398 TCATTCCAAGAAAAAGTCTTAGG - Intergenic
1203643842 Un_KI270751v1:46707-46729 TCATTCCAAGAAAAAGTCTTAGG + Intergenic
1188727173 X:33600203-33600225 TCATGCCAACCCAAAGACTCTGG + Intergenic
1190085844 X:47394548-47394570 TACTTTCCACACAAATACTTCGG - Intronic
1191111775 X:56809367-56809389 ACATTCCCACACAAAAACAGTGG - Intergenic
1192139897 X:68638454-68638476 TCAGTCTCACACAATGTCTTGGG - Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1196033324 X:111115034-111115056 CCAGGCCCACAGAAAGACTTAGG + Intronic
1196429589 X:115608501-115608523 TCATTACCACCCTAAGACTCTGG - Intronic
1196817034 X:119673372-119673394 TCACTCCCACACACCAACTTTGG - Intronic
1198580439 X:138058482-138058504 TGATGCCCACACAAATAATTTGG - Intergenic
1198892339 X:141411818-141411840 TCATTCAGACACACAGAGTTTGG + Intergenic
1201396341 Y:13553121-13553143 CCAATCCCACACAATGGCTTAGG - Intergenic