ID: 977821581

View in Genome Browser
Species Human (GRCh38)
Location 4:101478160-101478182
Sequence CTGCTGTGAATGTCCAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977821578_977821581 11 Left 977821578 4:101478126-101478148 CCCTTGTAGGGTAGGCCTGCAGT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 977821581 4:101478160-101478182 CTGCTGTGAATGTCCAATACTGG No data
977821580_977821581 -4 Left 977821580 4:101478141-101478163 CCTGCAGTGTTTAGCAATACTGC 0: 1
1: 0
2: 0
3: 4
4: 79
Right 977821581 4:101478160-101478182 CTGCTGTGAATGTCCAATACTGG No data
977821579_977821581 10 Left 977821579 4:101478127-101478149 CCTTGTAGGGTAGGCCTGCAGTG 0: 1
1: 0
2: 0
3: 18
4: 207
Right 977821581 4:101478160-101478182 CTGCTGTGAATGTCCAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977821581 Original CRISPR CTGCTGTGAATGTCCAATAC TGG Intronic
No off target data available for this crispr