ID: 977822024

View in Genome Browser
Species Human (GRCh38)
Location 4:101483447-101483469
Sequence AATCTGATGGGGAAGTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977822024 Original CRISPR AATCTGATGGGGAAGTTGAC AGG (reversed) Intronic
900718593 1:4160711-4160733 AATCTGCTGGGTAAGTCGGCAGG + Intergenic
901860986 1:12074190-12074212 AATGTGGTGGGGAGGTGGACAGG - Intronic
905996326 1:42384034-42384056 AATATGATGGTGGAGTTGATTGG + Intronic
908113816 1:60922314-60922336 AATCTGCAGGGGAAGTTTATGGG - Intronic
909155593 1:72071539-72071561 ACTCTAATGGGGATGGTGACAGG - Intronic
911289307 1:96037554-96037576 GATCTCATGTGAAAGTTGACAGG - Intergenic
911857130 1:102893153-102893175 AATGGGATGAGAAAGTTGACAGG - Intronic
915082958 1:153364718-153364740 AATCTGATGTGGAAAATGAGAGG + Intergenic
915512033 1:156391739-156391761 AATGTGATGGGGCAGTTCCCAGG - Intergenic
919360326 1:196584684-196584706 AATCTGATATAAAAGTTGACAGG - Intronic
920697832 1:208195238-208195260 CTTCTGATTGGAAAGTTGACAGG + Intronic
922535939 1:226381106-226381128 AAACTCGGGGGGAAGTTGACGGG - Exonic
923047420 1:230365738-230365760 CATGTGATGGGGATTTTGACTGG - Intronic
1067964092 10:50889374-50889396 AAAATGATGGGGAAATTGACTGG + Intergenic
1068312938 10:55302465-55302487 AATCTGCAGGGTAAGTTGGCAGG + Intronic
1069470779 10:68687393-68687415 AATTAGATGGGGAAATTCACAGG - Intronic
1080546571 11:33324893-33324915 AATTTGCTGGGGAAGATGCCTGG - Intronic
1084630287 11:70343760-70343782 TGTCTGATGGTGAAGATGACAGG + Exonic
1087885896 11:103482482-103482504 AATCTGATGATTAAGTTGTCTGG - Intergenic
1088149601 11:106727862-106727884 AATTTGAAGGGGAAATTGGCTGG - Intronic
1091915720 12:4271013-4271035 AATCGGAAGGGGAAGTGGACAGG + Intergenic
1092751679 12:11725048-11725070 AAGCTGATGGGGAAGTGGGCAGG - Intronic
1093079555 12:14793789-14793811 AATCAGATGGAGAAAGTGACGGG - Exonic
1093699879 12:22207480-22207502 AATCAGCTGAGGAAGTTGAAAGG + Intronic
1103195171 12:119037464-119037486 AATGTGATGGGGAGGCTTACAGG - Intronic
1105577604 13:21668710-21668732 AATCTGATGGTGAAGTGGCGAGG + Intergenic
1106289342 13:28346209-28346231 ATTCTGATAGAGAAGGTGACTGG - Intronic
1108726101 13:53183206-53183228 ATTCTGAAGGGGAAGTTGATGGG + Intergenic
1109004518 13:56854783-56854805 ATTCTGAAGGTTAAGTTGACCGG + Intergenic
1111784972 13:92775049-92775071 AACCTGATGGGTAAATTGCCTGG - Intronic
1112046649 13:95604169-95604191 AGACTGATGCGGAAGTTTACAGG - Intronic
1120056234 14:79927362-79927384 AATCTGCAGGGAAGGTTGACAGG + Intergenic
1120497873 14:85259059-85259081 TATCTGATTGGGAAGTTAATTGG - Intergenic
1120545222 14:85802990-85803012 AATGTTATGGGGGAGTAGACAGG - Intergenic
1121410785 14:93746898-93746920 CAACTGATGGGGAAGATTACTGG + Intronic
1121614853 14:95306808-95306830 AAACATATGGGGAAGTTGAGAGG + Intronic
1121649316 14:95545429-95545451 AATCTGATGGGGCAGTCCCCAGG - Intergenic
1125742233 15:41973082-41973104 AATCTTGAGGGGAAGTGGACTGG + Intergenic
1125963874 15:43856809-43856831 CATCTGATGGGGATGATGAGAGG + Intronic
1126811894 15:52414973-52414995 GATATGATGGGGAAGTTCAGAGG - Intronic
1128408249 15:67366205-67366227 AACCTGCTGGGGATGTGGACAGG - Intronic
1128450481 15:67803379-67803401 AATCTGATGGAGAATTTGGGAGG - Intronic
1129184521 15:73897819-73897841 AATTTGATGGGGAAGGAGCCTGG + Intergenic
1138760432 16:59537328-59537350 CATCTGATGATGAAGTAGACAGG + Intergenic
1139400494 16:66677478-66677500 AATCTGAATGGGAAAGTGACTGG + Intronic
1139514312 16:67444371-67444393 AATCGGAGGAGGAAGTTGAAGGG + Intronic
1143545247 17:7591588-7591610 AGTCTGATGGGGAAGGAGAGAGG + Exonic
1145904761 17:28509986-28510008 GATCTCTTGGGGAACTTGACTGG + Intronic
1146563547 17:33892452-33892474 AAGCTGATGAGGAGGTTGCCAGG - Intronic
1153091182 18:1345551-1345573 AACCTGATGGAGAAGTGGACTGG - Intergenic
1153235991 18:2988217-2988239 ATTCTGATGGGGAAATAGAGTGG - Intronic
1156399268 18:36726050-36726072 AATCTTATGGGGATTTTGATAGG + Intronic
1157079574 18:44508170-44508192 AGTCTGATGGGCATGCTGACAGG + Intergenic
1165461174 19:35945125-35945147 ACTCTGATGGGGAGGGTGTCGGG + Exonic
1166673315 19:44724423-44724445 AGTCTGATGGGGGTGTTGAAGGG - Intergenic
932230384 2:70078958-70078980 TATCTTAAGGTGAAGTTGACAGG + Intergenic
932825107 2:74932032-74932054 AGTCTGATGGAGAAGTAGAGAGG + Intergenic
935740392 2:106142166-106142188 AAACTGTTGAGGAAGTTGGCTGG - Intronic
938118614 2:128618723-128618745 AATCTGGGGGAGAAGTTGAAGGG - Intergenic
944636718 2:201681976-201681998 AGTCTGATGGGGAAGAAGAGGGG + Intronic
945792085 2:214317804-214317826 AATATACTGGGGAAGGTGACTGG - Intronic
945837919 2:214854263-214854285 AATCTTGTGGGGAATTGGACTGG + Intergenic
946803565 2:223447260-223447282 AATGTGATGAGGAAAATGACTGG - Intergenic
947972161 2:234333492-234333514 GATCTGATGGGCAAGTTGCAGGG + Intergenic
1169873547 20:10272255-10272277 AATCTCATGGGGTTGTTGAGGGG - Intronic
1170372052 20:15659810-15659832 AATGTGATGGAGAAGGTTACAGG + Intronic
1170830519 20:19835711-19835733 AATATGAATGGGAAGTTGAGTGG + Intergenic
1174477948 20:50810529-50810551 ATTCTGGTGGGGAAGATGACAGG + Intronic
1174627488 20:51927693-51927715 GATCTGATGGTGAAGGGGACAGG + Intergenic
1175728956 20:61339811-61339833 TATCTGATGGAGAATTTGAGAGG + Intronic
1175850987 20:62092853-62092875 AAACTGAAGGGGAAGGAGACGGG + Intergenic
1176215955 20:63947878-63947900 AAACTGACGGAGAAGTTGGCAGG - Intronic
1178792622 21:35714172-35714194 AAGCTGATTGGCAAGTGGACTGG - Intronic
1181976088 22:26731006-26731028 AATCTATTGGGGAAAATGACGGG + Intergenic
1184224472 22:43121303-43121325 ACTCAGATGGGGAGGTTGGCAGG + Intronic
949166504 3:948968-948990 AAACTGATGGTGAACTTGGCTGG - Intergenic
950248443 3:11443226-11443248 GATCTCATGGGGAAGTAGACAGG - Intronic
950326244 3:12112293-12112315 AATCTGACTGTGAAGTTGCCAGG - Intronic
951134997 3:19095242-19095264 AATCTGATGGGGAAGAGGGTTGG - Intergenic
951829915 3:26915024-26915046 AATGTGATGGAGAAGGTGGCAGG + Intergenic
953743350 3:45555383-45555405 ATCCTGATGGGGATGTGGACAGG + Intronic
955487302 3:59447931-59447953 AATAGGATGGGAAAGTTGAGTGG - Intergenic
956254449 3:67268943-67268965 AATCTGCAGGGTAAGTTGGCTGG - Intergenic
959931697 3:111991506-111991528 AATCTTATGGGGCAGTTCACAGG - Exonic
961358890 3:126355625-126355647 ATTCTGATGGGAAGGTAGACAGG - Intronic
963613448 3:147503403-147503425 TATCTGATAGGGTAGTTGTCAGG - Intronic
964250532 3:154711201-154711223 GATCTGATGAGGAAGATTACAGG - Intergenic
964735126 3:159909242-159909264 ATTCTGAGGGGGAAGTGGAATGG - Intergenic
965617810 3:170612722-170612744 AAACAGATGGGGTAGTTGATGGG + Intronic
969488777 4:7486937-7486959 ACTCTGATTGGGATGTGGACAGG + Intronic
969965874 4:10994979-10995001 AATCTGATGGGGAAGGGGGAAGG + Intergenic
969982704 4:11174847-11174869 TCTCTGATGGGGAAGTTAGCAGG - Intergenic
974936577 4:68415624-68415646 ATTCTGATGTGGAAATTGAGTGG - Intergenic
975893792 4:79061924-79061946 AATGTGATTGGCAAGTTGAAGGG - Intergenic
977822024 4:101483447-101483469 AATCTGATGGGGAAGTTGACAGG - Intronic
979784843 4:124703334-124703356 AAACTGATGGGGAAGAGGAAGGG + Intronic
981426474 4:144609188-144609210 AATCTTATTGGGAAATTTACTGG + Intergenic
983067220 4:163225516-163225538 AATCTGATTGGGAAGCTGGGTGG - Intergenic
987117821 5:14740068-14740090 AATCTGATGGAGAGCTTTACCGG - Intronic
989043449 5:37251428-37251450 AATCTGATGGGGCAATTCTCAGG - Intergenic
991492008 5:67193018-67193040 AATTTGATTGGGAAGCTGAGTGG + Intronic
991502684 5:67292702-67292724 AAACTGATAGAGAAGTTGATAGG + Intergenic
995254656 5:110032634-110032656 AATGTGATGCGGAAGTGGAGTGG - Intergenic
998514876 5:142743869-142743891 AAGCTGATGGGGAGTTTGGCAGG - Intergenic
1000553005 5:162690199-162690221 AATGTGATGGTCAAGTTGATAGG - Intergenic
1003140013 6:3463646-3463668 AATCTGATGTGGGATTTGATGGG - Intergenic
1008087376 6:47259188-47259210 ACTCCGATGGGGCAGATGACTGG - Intronic
1008478660 6:51961045-51961067 AATCTGAATGGGAAGAAGACTGG - Intronic
1010099944 6:72092358-72092380 AATAAGTTGGAGAAGTTGACAGG + Intronic
1011858029 6:91719488-91719510 ATTCTGATGGGAAAGTAGAGAGG - Intergenic
1012202789 6:96426535-96426557 AATGTCATGGGTAATTTGACAGG + Intergenic
1016616689 6:146057478-146057500 AATGTGATAGGGTAGTTGAGAGG + Intronic
1017663153 6:156693433-156693455 ATTCTGAAGGGGAAGTAGAATGG + Intergenic
1017875062 6:158517291-158517313 AGTCTGATGAAGAAGTCGACAGG - Intergenic
1020255706 7:6502144-6502166 CATCTGATGGGGTCCTTGACGGG - Intronic
1020980900 7:15067564-15067586 AGTCTGATGAGGAAGTTGTCCGG - Intergenic
1024593670 7:50913819-50913841 AATAGGATGGGCAAGTTGATGGG - Intergenic
1026300135 7:69090555-69090577 ACTCAGGTGTGGAAGTTGACGGG + Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1041709901 8:60884976-60884998 CCTGTGATGGGGAAGTTGATAGG - Intergenic
1042652306 8:71056857-71056879 AATGAGATGGGGAAATTGAGAGG + Intergenic
1046089264 8:109479457-109479479 AATCTTATGGGGAAATGGAACGG + Intronic
1047293071 8:123546611-123546633 AGTCTTATGAGGAAGTGGACGGG - Intergenic
1052764831 9:32630414-32630436 ACTCTGATGTGGATGTTGAAGGG - Exonic
1053004247 9:34593628-34593650 AATCTGAGGGGGACCTGGACAGG - Intergenic
1053031134 9:34779484-34779506 AATTTGTTGGAGAAATTGACAGG + Intergenic
1053946736 9:43317322-43317344 AATCTAATGGAGAAATTGAATGG - Intergenic
1054929358 9:70619850-70619872 TACCTCATGGGGAAGTTGACAGG + Intronic
1055645841 9:78360519-78360541 AATCTGATGGAGAAGGAGAAGGG - Intergenic
1056125488 9:83532775-83532797 AATCTGATGGGAAAACTGATGGG + Intronic
1056510943 9:87305194-87305216 AAGCTGCTGGAGAAGTTGTCAGG + Intergenic
1203589866 Un_KI270747v1:45880-45902 AATCTAATGGAGAAATTGAATGG - Intergenic
1187096852 X:16157762-16157784 AGTCACATGGGGAAGTTGAGTGG + Intergenic
1187228711 X:17399744-17399766 AATAAGATGGGGAAGATGGCTGG + Intronic
1187257470 X:17655865-17655887 CTTCTGATGAGGAAGTCGACTGG - Intronic
1189367080 X:40397133-40397155 ATTCTGATGGGCAAGTGGAAGGG + Intergenic
1193418675 X:81256385-81256407 AATCTAATAAGAAAGTTGACTGG - Intronic
1193603295 X:83535333-83535355 AATATGAAGGGGAAATTAACGGG - Intergenic
1196236039 X:113281437-113281459 AATCAGATTGGAAAGTTGGCAGG + Intergenic
1198003229 X:132462431-132462453 AATCTGCTAGAGAAGTTCACAGG + Intronic
1198542821 X:137658296-137658318 GATTTGATGTGGAAGTTGAGAGG - Intergenic
1199133460 X:144222714-144222736 AATCTGATGAGGAAGTTCAATGG + Intergenic
1199473498 X:148220949-148220971 AATGAGATTGGGAAGTTGCCCGG + Intergenic
1199814918 X:151388669-151388691 AATCTGATGGGGAATTACACTGG + Intergenic
1201380490 Y:13371795-13371817 AAGCTGATGGAGAAGTTGTAGGG + Intronic
1201420489 Y:13793700-13793722 GGTCTGAAGGGGAAGCTGACAGG - Intergenic