ID: 977823461

View in Genome Browser
Species Human (GRCh38)
Location 4:101502803-101502825
Sequence CAGGCTCTTGTCACATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 19, 2: 74, 3: 133, 4: 392}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977823461_977823465 -4 Left 977823461 4:101502803-101502825 CCTGGTCATGTGACAAGAGCCTG 0: 1
1: 19
2: 74
3: 133
4: 392
Right 977823465 4:101502822-101502844 CCTGGTTTTTCCTACAGCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 78
977823461_977823463 -5 Left 977823461 4:101502803-101502825 CCTGGTCATGTGACAAGAGCCTG 0: 1
1: 19
2: 74
3: 133
4: 392
Right 977823463 4:101502821-101502843 GCCTGGTTTTTCCTACAGCGTGG No data
977823461_977823468 13 Left 977823461 4:101502803-101502825 CCTGGTCATGTGACAAGAGCCTG 0: 1
1: 19
2: 74
3: 133
4: 392
Right 977823468 4:101502839-101502861 CGTGGGGACTTCAGCAACAGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
977823461_977823466 -3 Left 977823461 4:101502803-101502825 CCTGGTCATGTGACAAGAGCCTG 0: 1
1: 19
2: 74
3: 133
4: 392
Right 977823466 4:101502823-101502845 CTGGTTTTTCCTACAGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977823461 Original CRISPR CAGGCTCTTGTCACATGACC AGG (reversed) Intronic
901447142 1:9315498-9315520 GAGGCTCGAGTCACATGACGGGG + Intronic
901481402 1:9527745-9527767 CAGGTTCTTGTCACACGACCAGG + Intergenic
902370193 1:16001665-16001687 CAGGCTCATGCCACCTCACCTGG - Intergenic
902644711 1:17790377-17790399 CAAGTTCTTGTCCCATGCCCTGG + Intronic
903955455 1:27022275-27022297 CGGGTTCTTCTCACAGGACCAGG - Intergenic
904750620 1:32739727-32739749 CAGGCACTTGTCACCACACCTGG + Intergenic
906410231 1:45573153-45573175 CAGGTTCTTGTCACATGAACAGG + Intergenic
906913592 1:49983079-49983101 CAAGTTCTTGTCCCATGTCCAGG - Intronic
907191736 1:52655041-52655063 CAGGCTTGTGCCACAAGACCTGG - Intronic
908168306 1:61480636-61480658 CAAGCCCTTGTCACTTGTCCTGG - Intergenic
909771618 1:79430390-79430412 CAGGTTCTTTTCACACGACCAGG + Intergenic
909963624 1:81880446-81880468 CAGGTTCTTGTCTCAGTACCAGG + Intronic
910189991 1:84585386-84585408 TGGGTTCTTGTCCCATGACCAGG + Intergenic
911299762 1:96157631-96157653 CAGGTTCTTGTCACATGACCAGG + Intergenic
911369357 1:96978067-96978089 CTGTCTCTTGTTACATGACATGG + Intergenic
911734854 1:101325872-101325894 CAGGTTCTTGTCACACGACCAGG + Intergenic
911805010 1:102194789-102194811 TGGGTTCTTGTCTCATGACCAGG - Intergenic
912044533 1:105437611-105437633 CAAGCTCTTGTCCCATGTCCAGG - Intergenic
913030362 1:114896816-114896838 TAGGTTCTTGTCACATGACCAGG + Intronic
913103650 1:115592955-115592977 TGGGCTCTTGTCACATGACCAGG - Intergenic
913138289 1:115914150-115914172 CAGTCTCTGGTCTCTTGACCAGG - Intergenic
914860592 1:151382756-151382778 CAGGCTCGTGCCACAACACCTGG + Intergenic
914877735 1:151524882-151524904 CCTGCTCTTGTCACATGCCTGGG - Exonic
916631099 1:166613370-166613392 CTGGCTCTTGAAACATGGCCTGG - Intergenic
916638772 1:166703346-166703368 CAGGTTCTTGTCACATGACCAGG - Intergenic
917098255 1:171421619-171421641 CAGGTTCTTGTCACATGACCAGG + Intergenic
917556521 1:176096109-176096131 CAGGCTCTTGTCACACAACTAGG - Intronic
917891326 1:179441130-179441152 CAGGCCCTTGTCTCGTTACCCGG + Intronic
918161272 1:181902274-181902296 TGGGTTCTTGTCACACGACCAGG - Intergenic
918174877 1:182035072-182035094 TAGGCTCCTGTCACACAACCAGG + Intergenic
918175514 1:182040927-182040949 GGGGTTCTTGTCACATAACCAGG + Intergenic
918624921 1:186646392-186646414 CAGGCGCATGTCACAACACCTGG - Intergenic
918820681 1:189250371-189250393 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
919773797 1:201180325-201180347 TAGGCTATAGTCACATGACTAGG + Intergenic
921716759 1:218425017-218425039 CAGGCTCTAGTCACAAGAGGTGG - Intronic
921736576 1:218634620-218634642 TGGGTTCTTGTCTCATGACCAGG - Intergenic
921776528 1:219106697-219106719 CAGGCTCATGTCACCCTACCTGG + Intergenic
921901773 1:220458396-220458418 TGGGTTCTTGTCACATGACCAGG - Intergenic
922041628 1:221903496-221903518 CAGATTCTTGTCTTATGACCAGG + Intergenic
922367631 1:224880864-224880886 TGGGTTCTTGTCACATGACCAGG - Intergenic
922717307 1:227884383-227884405 AAGGCTCTGGTCACTTGCCCAGG - Intergenic
923412620 1:233725230-233725252 CAGGTTCTTGTCACACGACCAGG + Intergenic
923414244 1:233739248-233739270 CAGGCTCTTGTCACACGACCAGG - Intergenic
923900482 1:238320746-238320768 CAGGTTCTTGTCTCACAACCAGG - Intergenic
924799444 1:247316974-247316996 CAGAATCTTCTCACATGACTGGG + Intronic
1063167207 10:3474194-3474216 CAGGCACTTGCCACCAGACCTGG - Intergenic
1063306725 10:4909516-4909538 CCGGTTCTTGTGTCATGACCAGG - Intergenic
1063978360 10:11434729-11434751 CAGGCTCTTGGCACACGACCAGG + Intergenic
1064175662 10:13072752-13072774 TGGGTTCATGTCACATGACCAGG - Intronic
1064257762 10:13758757-13758779 CAGCTTCTTGTCTCACGACCAGG - Intronic
1065415367 10:25479555-25479577 CAGGCACCTGTCACCTCACCTGG + Intronic
1065811039 10:29444095-29444117 TGGGTTCTTGTCACACGACCAGG + Intergenic
1066188925 10:33037526-33037548 CAAGCTCTTGTCTCAGGTCCAGG - Intergenic
1066749298 10:38636197-38636219 CAGGTTCTTGTCATACTACCAGG + Intergenic
1066967353 10:42281595-42281617 CAGGTTCTTGTCATACCACCAGG - Intergenic
1067257997 10:44662622-44662644 CAGCCTCTTGGCACCTGAGCAGG - Intergenic
1068083645 10:52348075-52348097 CAAGATCTTGTCCTATGACCAGG - Intergenic
1068188563 10:53619626-53619648 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1068417744 10:56745873-56745895 CGGGTTCTTGTCACAGAACCAGG - Intergenic
1068878428 10:62022622-62022644 TGGGTTCCTGTCACATGACCAGG - Intronic
1069329995 10:67280425-67280447 CAGGTTCTTGTCTCACAACCAGG + Intronic
1069708455 10:70474076-70474098 CACGCTCCTGCCACATGTCCTGG + Intergenic
1070406264 10:76100234-76100256 CAGGTTCTTGTCACATGATCAGG + Intronic
1070858401 10:79628485-79628507 CAGGCTCTGGTGACAAGAACTGG + Intergenic
1071959520 10:90796566-90796588 CAGGCACTTGTCACGACACCTGG - Intronic
1073341604 10:102749043-102749065 GAGGCTGTTGTCACATGGTCAGG + Intronic
1073558130 10:104473232-104473254 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1073664057 10:105510065-105510087 CGGGTTCTTGTCACATGACTAGG + Intergenic
1074009865 10:109467250-109467272 CAGGCTCTTGTCTCATGACCAGG - Intergenic
1074738875 10:116464979-116465001 CAGGTTCTTGTCCCACGTCCAGG + Intronic
1075875302 10:125800939-125800961 TGGGTTCTTGTCTCATGACCAGG - Intronic
1076836434 10:133023455-133023477 CAGGCTGGCCTCACATGACCAGG + Intergenic
1078736979 11:14029432-14029454 CGGGCTCTTGTCACATGATCAGG + Intronic
1079541435 11:21580522-21580544 CAGGCTCTTGGGGCATCACCTGG + Intergenic
1079674086 11:23203020-23203042 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1080074564 11:28134150-28134172 CATGTTCTTGTCTCATGACCAGG + Intronic
1080075276 11:28140606-28140628 TAGGTTCTTGTCTCATGACCAGG + Intronic
1080628687 11:34052829-34052851 GAGGCACTTGTCACCTGACTCGG + Intronic
1080963035 11:37182107-37182129 CCAGCTATTGTCACACGACCAGG - Intergenic
1081100581 11:38997043-38997065 CAGGTTCTTGTTACAAGACCAGG + Intergenic
1081435811 11:43026453-43026475 TGGATTCTTGTCACATGACCAGG + Intergenic
1081544759 11:44062880-44062902 CGGGTTCTTGTCACACCACCAGG - Intergenic
1082036827 11:47651778-47651800 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1082701176 11:56433124-56433146 CAAGCTCTTGTCCTATGTCCAGG + Intergenic
1082837691 11:57663681-57663703 CAGGCTCATGCCACAGCACCTGG + Intergenic
1082944117 11:58740182-58740204 CAGGTTCTTGTCTCATGACTAGG - Intergenic
1084137134 11:67193130-67193152 CAGGCTCTTGCCACCACACCCGG + Intronic
1084280480 11:68087337-68087359 CAGGCACTTGCCACCAGACCCGG - Intronic
1084487074 11:69454746-69454768 CAGGCCCGTGTTACATGAACGGG + Intergenic
1085127096 11:74009161-74009183 CAGCCTCTTGTCAAGTGATCAGG - Exonic
1085703220 11:78763601-78763623 CAGGTAGTTGTCAAATGACCCGG + Intronic
1085987547 11:81805231-81805253 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1086092834 11:83021200-83021222 CAAGTTCTTGTCCTATGACCAGG - Intronic
1086133632 11:83425097-83425119 GGGGTTCTTGTCACATGACCAGG + Intergenic
1086458901 11:86986020-86986042 CAGGTTCTTGTCACACGACCAGG - Intergenic
1087120023 11:94564046-94564068 CGAGTTCTTGTCACATGACCAGG + Intronic
1087258287 11:95981200-95981222 CAGGCTCTCGTCACATGGCAAGG - Intronic
1088231451 11:107677347-107677369 CAGGCGCCTGTCACTAGACCCGG - Intergenic
1088559340 11:111097125-111097147 CGGGCTCTTGTCACATGACCAGG + Intergenic
1088667699 11:112110139-112110161 CAGGCACTTGTCACCACACCTGG + Intronic
1088748566 11:112824680-112824702 CAGGTTCTTGTCTCGTGTCCAGG - Intergenic
1090706794 11:129344961-129344983 CGGGTTTTTGTCACACGACCAGG - Intergenic
1090873400 11:130767664-130767686 CAGGTTGTTGTCTCACGACCGGG - Intergenic
1091632479 12:2172347-2172369 CAGACTCTTGTCACATCACCAGG + Intronic
1091839326 12:3608321-3608343 CAGGCTCTTGTCGTAGCACCGGG - Intronic
1092037444 12:5349387-5349409 GACACTCTTGTCACATTACCTGG + Intergenic
1092061898 12:5557896-5557918 CGGGTTCTTGTCACATGCCCGGG + Intronic
1092585512 12:9897469-9897491 CAGGTTCTTGTCACACGACCAGG + Intergenic
1093331682 12:17851083-17851105 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1093705775 12:22273539-22273561 TGGGTTCTTGTCTCATGACCAGG - Intronic
1093715350 12:22375836-22375858 CGGGCTGTTGTCACATGACTAGG - Intronic
1094003218 12:25718748-25718770 CAGTTTCTTGTCACATGACCAGG - Intergenic
1094440484 12:30470582-30470604 TGGGTTCTTGTCCCATGACCAGG + Intergenic
1094443666 12:30506780-30506802 CAGGTTCTTGTCACACGACCAGG - Intergenic
1094638351 12:32248707-32248729 CAGGTTCTTGTCTCACAACCAGG + Intronic
1094716658 12:33020848-33020870 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1095345252 12:41142321-41142343 TGGGTTCTTGTCACACGACCAGG + Intergenic
1095968439 12:47884754-47884776 CAGGTTCTTCCCTCATGACCTGG - Intronic
1098643891 12:72873371-72873393 CAGTCTCTTGTCATACGACCAGG - Intergenic
1099529052 12:83752950-83752972 CAGGTTCTTGTCACACGACCAGG - Intergenic
1100233517 12:92634188-92634210 CGGGTTCTTGTCACATGACCAGG + Intergenic
1100361617 12:93884736-93884758 CAGGTTCTTGTCACTCGACTGGG - Intronic
1100419546 12:94418217-94418239 CAGGCGCATGCCACATCACCTGG - Intronic
1100425646 12:94483373-94483395 CAGGCACATGCCACCTGACCAGG + Intergenic
1100658948 12:96676686-96676708 CAGGCGCCTGCCACAAGACCTGG + Intronic
1102866544 12:116379422-116379444 CAGGCACCTGTCACATCCCCGGG + Intergenic
1103588078 12:121971027-121971049 CAGGCTGTTCTCAGAGGACCAGG + Intronic
1104144199 12:126017265-126017287 CAAGTTCTTGTCTCACGACCAGG - Intergenic
1104386366 12:128354924-128354946 GAGGCACTTGTCCCCTGACCTGG - Intronic
1104714598 12:131008032-131008054 CAGGCTCAAGTCACTTGCCCAGG - Intronic
1105496538 13:20935629-20935651 CAGGCTCTTGCTACATTGCCTGG - Intergenic
1105748782 13:23402033-23402055 CAGGCACTTGCCACAACACCTGG - Intronic
1106067017 13:26363183-26363205 CAGGCTCCTGTCACCGCACCTGG - Intronic
1106379609 13:29223635-29223657 CAAGTTCTTGTCCCATGTCCAGG - Intronic
1106431199 13:29682183-29682205 CGGGTTCTTGTCACACAACCAGG + Intergenic
1106564840 13:30875221-30875243 CAGGCTCATGCCACCTTACCAGG + Intergenic
1106569766 13:30916202-30916224 CATGCTCTTGACACATGCCCCGG + Intronic
1108060341 13:46526644-46526666 GAGGCTCTTGTGCCATGCCCTGG - Intergenic
1108203710 13:48067010-48067032 CAGAATCTTGTCACACGATCAGG - Intronic
1108584516 13:51858658-51858680 TGGGTTCTTGTCACATAACCAGG + Intergenic
1108871140 13:54987962-54987984 CAGATTTTTGTCACATGACCAGG + Intergenic
1108940444 13:55946993-55947015 CTGGTTCTTGTCCCATGACCAGG - Intergenic
1109470707 13:62799979-62800001 CAAGTTCTTGTCCCATGCCCAGG - Intergenic
1109638909 13:65161232-65161254 CAGGTTCTCGTCTCATGACCTGG + Intergenic
1109831158 13:67790945-67790967 CAAGTTTTTGTCTCATGACCCGG + Intergenic
1109863607 13:68232720-68232742 TAGGTTCTTGTCACACAACCAGG + Intergenic
1109892148 13:68629885-68629907 CAAGTTCTTGTTTCATGACCAGG + Intergenic
1109924043 13:69110298-69110320 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1109955182 13:69556820-69556842 CAGGTTTTTGTCACACAACCAGG + Intergenic
1110508139 13:76314495-76314517 CCGGTTCTTGTCACACGACAAGG + Intergenic
1111094638 13:83496737-83496759 AAGGCTCTTCTCACATGGCCAGG - Intergenic
1112215158 13:97422856-97422878 AAGCCTCATGTCACATGACCTGG + Intergenic
1112260668 13:97875218-97875240 CGGGTTCTTGTCACAAGATCAGG + Intergenic
1112556307 13:100471933-100471955 CAGGTTCTTGTCTCAGGACTGGG + Intronic
1112848404 13:103672669-103672691 AATGCTCTTCTTACATGACCTGG + Intergenic
1113289216 13:108886413-108886435 CAGGTTCTTGCCTCACGACCTGG + Intronic
1113481910 13:110627488-110627510 CATGCTCTTGTCGTAGGACCTGG + Exonic
1113972857 13:114203522-114203544 TGGGTACTTGTCACATGACCAGG + Intergenic
1115536613 14:34379224-34379246 CAGGCACGTGTCACTTCACCCGG + Intronic
1115898449 14:38117797-38117819 CTGGTTCTTGTCTCATGACCAGG - Intergenic
1116102833 14:40464301-40464323 CGGGTTCTTGTCTTATGACCAGG - Intergenic
1116103520 14:40470522-40470544 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1116256384 14:42562013-42562035 CGGGTTCTTGTCACATGTCCAGG + Intergenic
1116369258 14:44109040-44109062 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1116679577 14:47948969-47948991 CAGGTTCTTATCACACGACCAGG + Intergenic
1117656447 14:57961130-57961152 CAGGCTGCTGTCACTTGAGCTGG + Intronic
1117938536 14:60935877-60935899 CGGGCTCTTGTCACGCAACCAGG + Intronic
1118474591 14:66104893-66104915 TGGGTTCTTGTCACACGACCAGG - Intergenic
1118486932 14:66223335-66223357 TGGGTTCTTGTCACATGACCAGG + Intergenic
1118999051 14:70864986-70865008 CAGGTTCTTGTCTCACAACCAGG + Intergenic
1119874531 14:78046279-78046301 CAGGCTCTTTCCACATGCTCAGG + Intergenic
1120624314 14:86805461-86805483 CAGGCACTAGTCACATTACCAGG - Intergenic
1120704373 14:87732104-87732126 CAGGCTGTAGTCAGATAACCAGG + Intergenic
1120811550 14:88808724-88808746 CAGATTCTTGTCACATAACCAGG + Intergenic
1121659805 14:95626233-95626255 CAGGCTGTGCGCACATGACCTGG + Intergenic
1121799268 14:96760119-96760141 CCGTCTCTTGTCACATTTCCAGG + Intergenic
1122331455 14:100918653-100918675 CAGGCTCATGTCACCACACCTGG + Intergenic
1122406081 14:101501912-101501934 CAGGCACTTGGCACAGGGCCTGG + Intergenic
1122641485 14:103162325-103162347 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1122954618 14:105064862-105064884 CAGGATCTTGTCACGTGACTGGG + Intronic
1202850604 14_GL000225v1_random:15561-15583 CAGGCAATTGTTACATCACCTGG + Intergenic
1123777622 15:23596629-23596651 CAGGTTCTTGTCACATAACCAGG + Intronic
1123888096 15:24748010-24748032 CAGGTTCTTGTCCCACGACCAGG + Intergenic
1124793208 15:32749769-32749791 CAGGCGCTTGTCACCACACCTGG + Intergenic
1125241608 15:37582743-37582765 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1125869846 15:43089714-43089736 CAGGCTCATGCCACAGCACCTGG + Intronic
1126666184 15:51077956-51077978 GGGGTTCTTGTCACATGACCAGG - Intronic
1127016590 15:54695482-54695504 CAGGTTCTTGTCATATGACCAGG - Intergenic
1128920150 15:71603185-71603207 CAGGTTTTTGTCACACCACCAGG + Intronic
1128964146 15:72040574-72040596 TGGGTTCTTGTCACACGACCAGG - Intronic
1129925852 15:79364020-79364042 CAGGTTCTTGTCTCACAACCAGG + Intronic
1132147877 15:99439083-99439105 CAGGCTCATTTCACATACCCGGG - Intergenic
1132549326 16:547866-547888 CGTGCACTTGGCACATGACCAGG - Exonic
1132783624 16:1642255-1642277 CAGGCTTGTGTCTGATGACCTGG + Intronic
1136733418 16:32440936-32440958 CAGGTTCTTGTCATACCACCAGG - Intergenic
1137588710 16:49680368-49680390 CAAGTTCTTGTCCCATGTCCAGG - Intronic
1138978777 16:62241246-62241268 CAGGTTCTTGTCTCATAACCAGG - Intergenic
1139436143 16:66937720-66937742 CATCCTACTGTCACATGACCTGG + Intronic
1139532714 16:67550723-67550745 CAGGCTCCTGTGACAAGAGCAGG - Intergenic
1140443013 16:75000878-75000900 CTGGCTGTTGGCACATGACTGGG + Intronic
1140859066 16:79003614-79003636 ATGGCTTTTGTCACATGTCCAGG + Intronic
1203019665 16_KI270728v1_random:388666-388688 CAGGTTCTTGTCATACCACCAGG + Intergenic
1203038000 16_KI270728v1_random:661824-661846 CAGGTTCTTGTCATACCACCAGG + Intergenic
1142506565 17:367489-367511 CAGGTTCTTTTCACGTGCCCGGG - Intronic
1142506586 17:367623-367645 CAGGTTCTTTTCACGTGCCCGGG - Intronic
1142506615 17:367821-367843 CAGGTTCTTTTCACGTGCCCGGG - Intronic
1142506635 17:367955-367977 CAGGTTCTTCTCACGTGCCCGGG - Intronic
1143533691 17:7522863-7522885 CAGGTTCTTATCACACGACCAGG + Intergenic
1143635325 17:8161148-8161170 CAGGGGCTTGAGACATGACCAGG - Intronic
1143955762 17:10667536-10667558 CAGGCGCCTGTCACAACACCCGG - Intergenic
1144143760 17:12377076-12377098 CAGGCTCTTGTCACATGGCCAGG + Intergenic
1144334057 17:14253304-14253326 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1144348434 17:14371079-14371101 CAGGCTCCTGTCACCAGGCCTGG + Intergenic
1144407547 17:14966686-14966708 CAGGCTCTAACCACCTGACCTGG + Intergenic
1145789025 17:27613328-27613350 CAGGTTCTTGTCTCATGACCAGG + Intronic
1145824978 17:27870044-27870066 TGGGTTCTTGTCTCATGACCAGG - Intronic
1146144546 17:30401624-30401646 CAGGCACGTGTCACAACACCTGG + Intronic
1146553931 17:33806783-33806805 CAGGGACTTGGCACCTGACCTGG + Intronic
1147411694 17:40257601-40257623 CAGGCGCTTGTCACCACACCTGG - Intronic
1149056829 17:52376530-52376552 CAGGTTCTTGTGTCATGACCAGG - Intergenic
1149102313 17:52921804-52921826 CAGGTTCTTGTCACACAACCAGG + Intergenic
1149762205 17:59242655-59242677 CAGGTTCTTGTCACATGACCAGG + Intronic
1149954882 17:61037627-61037649 CAGGCTCCTGTCACCACACCCGG - Intronic
1149978898 17:61293628-61293650 CATGCTGTTGCCATATGACCAGG + Intronic
1151922457 17:77167678-77167700 TGGGTTCTTGTCTCATGACCAGG + Intronic
1152148905 17:78586728-78586750 CAGGCTTTTGTCACACGACCAGG - Intergenic
1152424214 17:80210257-80210279 CATGCTCTGGTCACATGCTCTGG + Exonic
1153246103 18:3073943-3073965 CAGGTTCTTGTCTCACAACCAGG - Intronic
1153741973 18:8138622-8138644 CAGGCTCTTGGCAGATGCGCTGG - Intronic
1155623905 18:27812868-27812890 TGGGCTTTTGTCACATGACCAGG + Intergenic
1156197825 18:34795590-34795612 CACACTCTTGTCACAGGGCCAGG - Intronic
1156782422 18:40866654-40866676 TGGGTTCTTGTCACACGACCGGG - Intergenic
1156972324 18:43171110-43171132 CAGGTACTTATTACATGACCAGG - Intergenic
1157777807 18:50409973-50409995 TTAGTTCTTGTCACATGACCAGG + Intergenic
1158335017 18:56406707-56406729 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1158464236 18:57675674-57675696 CAGGCTCATGTCACCTCACCTGG + Intronic
1158507891 18:58062843-58062865 CAGGCGCCTGTCACAAGGCCCGG - Intronic
1158639207 18:59189011-59189033 CAGGTTCTTATCTCACGACCAGG + Intergenic
1159308616 18:66678798-66678820 CAGGTACTTGTCTCATGACCAGG + Intergenic
1159309204 18:66686544-66686566 CAGGTTCTTATCTCACGACCAGG - Intergenic
1159356986 18:67349270-67349292 TGGGCTCTTGTCACATGCCCAGG + Intergenic
1159431213 18:68356254-68356276 CAAGCTCTCGTCTCATGTCCAGG - Intergenic
1159539348 18:69755799-69755821 CAGGTTCTTGTCTCACAACCAGG + Intronic
1161238025 19:3207559-3207581 CAGCCTAGAGTCACATGACCTGG + Intronic
1163217680 19:15892980-15893002 CAGGGTCATGTCTCATGTCCAGG - Intronic
1163801074 19:19365966-19365988 CAGGCTCCTGTCACCACACCTGG - Intergenic
1164810822 19:31154501-31154523 CAGGTTCCTGTCACATGACCAGG + Intergenic
1165298246 19:34946404-34946426 CAGTCTCTTGCCACATGCCATGG - Intergenic
1165580400 19:36857916-36857938 CAGGCTCCTGGCACAACACCTGG + Intronic
1167327059 19:48833142-48833164 CTAGCTCTTGTCCCCTGACCTGG - Intronic
1167758555 19:51428442-51428464 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1167810178 19:51823003-51823025 CAGGCTCTTGCCACCACACCTGG + Intronic
926239182 2:11071644-11071666 CAGGTTCTTGTCACATGACCAGG - Intergenic
926888925 2:17622669-17622691 CAGGCTCTTGTCATATGACCAGG + Intronic
927243243 2:20936699-20936721 CAGGCTGGTGCCACAAGACCAGG - Intergenic
928418750 2:31121057-31121079 CAGGCCCTGGTCACATCAGCAGG + Intronic
928418934 2:31122294-31122316 CAAGCTCTTCCCACATTACCTGG + Intronic
928834186 2:35523123-35523145 CAGGTTCTTGTCTAACGACCAGG + Intergenic
929463765 2:42126393-42126415 CAGGCTCTTGACAAATGTTCTGG - Intergenic
929662433 2:43800997-43801019 CAGTCTCTTGTGTCTTGACCAGG + Intronic
930567300 2:53037232-53037254 CAGGCGCTTGTCACCACACCGGG + Intergenic
931471009 2:62537582-62537604 CAGGTTCTTGTAACACGACCAGG - Intergenic
931828211 2:66023475-66023497 CGGGCTCTTCTCACCTGACCAGG + Intergenic
931857312 2:66316779-66316801 GAGGCTCTTGTACCATCACCTGG + Intergenic
932046735 2:68357577-68357599 CGGATTCTTGTCACACGACCAGG + Intergenic
932219639 2:69989737-69989759 CAGGGTGTGGTCACATCACCTGG - Intergenic
932324749 2:70850804-70850826 CAAGCTGTTGTCACCTGATCTGG - Intergenic
933061828 2:77747619-77747641 TGGGTTCTTGTCACATGACTGGG - Intergenic
933310264 2:80652028-80652050 CAGGTTCTTGTCACACGACCAGG + Intergenic
933333604 2:80926158-80926180 TAGGTTCTTGTCTAATGACCAGG + Intergenic
933442735 2:82334151-82334173 CAAGCTCTTGTCCTATGTCCAGG + Intergenic
933534854 2:83558560-83558582 CAGGTTCTTGTCTCATGTCCAGG - Intergenic
933809312 2:86022729-86022751 CAGGCACATGTCACAACACCTGG + Exonic
934860581 2:97761042-97761064 CAGCCTCATGTCACATGCTCTGG + Intronic
934932406 2:98437164-98437186 CTGGTTCTTGTCACAAGACCAGG - Intergenic
936271668 2:111053920-111053942 CTAGCTCTTGTCTCCTGACCTGG - Intronic
936832084 2:116659123-116659145 CCAGTTCTTGTCTCATGACCAGG + Intergenic
939356746 2:141112141-141112163 TGGGTTCTTGTCTCATGACCAGG - Intronic
939419156 2:141943820-141943842 CGGGTTCTTGTCACACGACCAGG + Intronic
940391124 2:153133549-153133571 CGGGTTCTTGTCACACAACCAGG - Intergenic
941200040 2:162496618-162496640 TGGGTTCTTGTCTCATGACCAGG - Intronic
942427057 2:175871182-175871204 CAGGCTCTTGACACCACACCCGG - Intergenic
942619724 2:177834160-177834182 TGGGTTCTTGTCTCATGACCAGG - Intronic
942867993 2:180699246-180699268 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
943846503 2:192655884-192655906 CAGGTTCTTGTCACACGACCAGG + Intergenic
944960085 2:204862765-204862787 CAGGTTCTTGTCACACGACCAGG + Intronic
944964429 2:204914302-204914324 GGGGTCCTTGTCACATGACCAGG - Intronic
945468661 2:210201312-210201334 TGGGTTCTTGTCACAGGACCAGG - Intronic
946652924 2:221913707-221913729 CAGGTTCTTGTCACATGACCAGG + Intergenic
946873764 2:224108123-224108145 CTGGTTCTTGTCACATGACCAGG + Intergenic
947043992 2:225957320-225957342 CAGGCACATGCCACATCACCAGG + Intergenic
947136225 2:226979266-226979288 TAGGTTCTTGTCACACAACCAGG + Intronic
1169940683 20:10933966-10933988 CAGCTTCTTGTCACATGACCAGG + Intergenic
1170220606 20:13937584-13937606 CAGGTTCTTGTCACACGACCAGG - Intronic
1170284744 20:14694370-14694392 CTGTCTCTTACCACATGACCTGG - Intronic
1170335718 20:15267989-15268011 TGGGTTCTTGTCACATGACCAGG - Intronic
1170948037 20:20909587-20909609 CGGGTTCTTGTCACACGGCCGGG + Intergenic
1171877856 20:30594936-30594958 CAGGTTCATGTCACATTGCCAGG + Intergenic
1171933299 20:31248146-31248168 CAGGTTTTTGTTACATAACCAGG + Intergenic
1172365232 20:34343950-34343972 CAGGTCCTTGTCACACAACCAGG - Intergenic
1173820867 20:46019556-46019578 CAGCCTCTTGTTTCTTGACCTGG - Intergenic
1174157664 20:48527126-48527148 CAGGCTCGTCTCACTTCACCTGG + Intergenic
1174370425 20:50083320-50083342 CAGGCCCTTGTCACTGGAGCAGG - Intronic
1174426557 20:50435753-50435775 GAGGCTCTGGTCACAGGGCCAGG + Intergenic
1174544098 20:51312360-51312382 AGGGTTCTTGTCACATGACCAGG + Intergenic
1175966717 20:62663560-62663582 GAGGCTATTGTGCCATGACCTGG + Intronic
1176907530 21:14520950-14520972 TGGGTTCTTGTCACACGACCAGG - Intronic
1177414364 21:20775655-20775677 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1177513291 21:22117644-22117666 CAGGCTCTTGTCACCACATCTGG - Intergenic
1177832208 21:26151733-26151755 CTGCCTCTTGTCACATCAGCAGG - Intronic
1177878148 21:26659978-26660000 CAAGTTCTTGTCTCATGACCAGG - Intergenic
1177900928 21:26914174-26914196 CGGGTTCTTGTCTCATGACCAGG - Intergenic
1178482700 21:32993438-32993460 CAGGTTTTTCTCACAGGACCTGG - Intergenic
1179140515 21:38721051-38721073 CAGGGTCTTGTCACATGACCAGG + Intergenic
1180539048 22:16424150-16424172 CAGGTTCTTGTCACACCACCAGG + Intergenic
1181544558 22:23594425-23594447 CAGGCACTTGCCACAACACCTGG - Intergenic
1183759104 22:39799432-39799454 CAGGTTCTTGTCTCATGACCAGG + Intronic
1185363805 22:50425540-50425562 CATGGAATTGTCACATGACCTGG - Intronic
949095152 3:77084-77106 TGGGTTCTTGTCACATGACCAGG + Intergenic
949166926 3:954224-954246 CTGGTTCTTGTCACACGACCAGG + Intergenic
950036946 3:9893005-9893027 GAGGCTCTTGTCACATGATCAGG + Exonic
950320619 3:12049373-12049395 CAGGCACTTGTCACCACACCAGG - Intronic
951303535 3:21028387-21028409 CAGGTTTTTGTCACATGGCCAGG + Intergenic
951879361 3:27465008-27465030 CGGGTTCTTGTCACACGGCCGGG - Intronic
952108279 3:30093504-30093526 TGGGTTCTTGTCTCATGACCAGG + Intergenic
952325112 3:32313823-32313845 CATGTTCTTGTCACACGACCAGG + Intronic
952636989 3:35544890-35544912 TGGGTTCTTGTCACATGACCAGG + Intergenic
953337069 3:42102515-42102537 AAGGTTCTTGTCTCATGACCAGG + Intronic
953441092 3:42918232-42918254 TGGGTTCTTGTCTCATGACCAGG + Intronic
953603119 3:44387329-44387351 CAAGTTCTTGTCCCATGTCCAGG - Intronic
953648094 3:44773814-44773836 CAGGTTCTTGTCGCATGACCAGG + Intronic
955733372 3:62010908-62010930 CAGGTTCTTGTCTCATGACCAGG + Intronic
957028248 3:75209457-75209479 CAGGTTCTTGTCACATGACCAGG - Intergenic
957991894 3:87636592-87636614 CAGGTTCTTGACTCATGACCAGG - Intergenic
958047986 3:88308058-88308080 CAGATTCTTGTCATATGACCAGG - Intergenic
958536217 3:95408028-95408050 CAGGTTCTTATCACATGACCAGG - Intergenic
958536722 3:95412890-95412912 TCGGTTCTTGTCACATGACCAGG - Intergenic
959158177 3:102692645-102692667 TGGGTTCTTGTCCCATGACCAGG + Intergenic
959429661 3:106236857-106236879 CAGGTTCTTGTCTCACGATCAGG - Intergenic
959486808 3:106936231-106936253 CCAGTTCTTGTCACATGACCAGG + Intergenic
959574056 3:107914971-107914993 TGGTTTCTTGTCACATGACCAGG - Intergenic
959660573 3:108863722-108863744 CGGGTTCTTGTCACATGACCAGG + Intergenic
959685354 3:109140221-109140243 CAGGTTCTTGTCATGTGACCAGG + Intergenic
961219205 3:125186804-125186826 CAGGCACTTCTCAAATGAGCAGG - Intronic
961688601 3:128652454-128652476 CAGGCACTTGTCACCAGGCCCGG - Intronic
962582572 3:136811684-136811706 CAGCGTATTGTCTCATGACCAGG + Intergenic
963346327 3:144099692-144099714 CAAGTTCTTGTCCCATGCCCAGG - Intergenic
963534869 3:146514692-146514714 CAGGCTCTTGTCCGGTGTCCAGG - Intergenic
964351147 3:155805318-155805340 CAGGCACTTGTCACCACACCAGG - Intronic
964362036 3:155908463-155908485 CGGGTTCTTTTCACATGACCAGG - Intronic
964772065 3:160234801-160234823 GAGTCTCTTGTCACATGAGCTGG + Intronic
965178471 3:165367247-165367269 TGGGTTCTTGTCCCATGACCAGG + Intergenic
965869712 3:173251011-173251033 CAGGCTCCTGGGAAATGACCTGG + Intergenic
967546197 3:190731847-190731869 CAGGTTCTTGTCACACAACCAGG + Intergenic
967654785 3:192033907-192033929 CAAGCACTTGTCATATGGCCTGG + Intergenic
967761125 3:193227425-193227447 CAGGTTCTTGTCACACAACCAGG - Intergenic
967763150 3:193247564-193247586 TGGGCTCTTGTCTCATGACCAGG - Intronic
968381592 4:101286-101308 TGGGTTCTTGTCACATGACCAGG - Intergenic
968393402 4:211655-211677 CAGGCTCTCGTCCCATGACCTGG - Intergenic
968838278 4:2981311-2981333 CAAGTTCTTGTCCCATGTCCAGG + Intronic
969073775 4:4561011-4561033 CAGGCTCTTGTCACACGACCAGG + Intergenic
969249831 4:5959874-5959896 CAGGCACCTGCCACATGACGTGG - Intronic
969566952 4:7984384-7984406 CAGGCACCTGCCACACGACCAGG + Intronic
969727670 4:8932688-8932710 CAGGCACATGCCACATCACCTGG + Intergenic
969903497 4:10371776-10371798 TAGGTTCTTTTTACATGACCAGG + Intergenic
970729920 4:19090578-19090600 CAGATTCTTGTCACATGACCAGG - Intergenic
971292959 4:25361073-25361095 TAGGGTCTTGCCACATGGCCTGG - Intronic
971572436 4:28230406-28230428 AGGATTCTTGTCACATGACCAGG - Intergenic
971669767 4:29542285-29542307 CAAGTTCTTGTCTCATGTCCAGG + Intergenic
971927908 4:33037883-33037905 CAGGTTCTTGTCACAGGACCAGG - Intergenic
972108152 4:35519996-35520018 CAGGTTATTGTCTCATGATCAGG + Intergenic
972280335 4:37596071-37596093 CAGGCACGTGTCACATGGGCAGG - Intronic
972803314 4:42500614-42500636 CAGGCTCTTGTAAAATTGCCAGG - Intronic
973238596 4:47932710-47932732 CAAGTTCTTGTCTCATGACCAGG + Intronic
973926925 4:55748226-55748248 CAGCCTCTCCTCACATGCCCTGG - Intergenic
974480035 4:62431443-62431465 TAGGAGCTTGTCACACGACCAGG + Intergenic
976461858 4:85320935-85320957 CAAGTTCTTGTCTCATGACCAGG + Intergenic
976751538 4:88455263-88455285 CAGGTTCTTGTCTCATGACCAGG + Intergenic
976778023 4:88727761-88727783 CAGGCTCTTCTCCCATGACCTGG + Exonic
977823461 4:101502803-101502825 CAGGCTCTTGTCACATGACCAGG - Intronic
977989314 4:103421498-103421520 CAGGCTTTTGTCATGTGACCAGG - Intergenic
978328474 4:107586254-107586276 TGGGTTCTTGTCACATGACCAGG + Intergenic
978749334 4:112229318-112229340 CAGGTTCTTGTCACATGACAAGG - Intergenic
978887122 4:113777086-113777108 CAGGGTCTTGTTACACAACCAGG - Intergenic
978964779 4:114727049-114727071 CAGGCTGTTGTCAGAGGATCTGG + Intergenic
979462920 4:121003866-121003888 CAAGTTCTTGTCCTATGACCAGG - Intergenic
979609383 4:122673274-122673296 CAGTTTCTTGTCACTTGACCAGG + Intergenic
979624912 4:122834006-122834028 CTGGTTCTTGTCACACGCCCAGG + Intronic
980127516 4:128787944-128787966 CAGGCTCAGGTCACAAGTCCAGG + Intergenic
980984515 4:139682781-139682803 TGGGTTCTTGTCACATGGCCAGG + Intronic
981324090 4:143426985-143427007 TGGGCTCTTGTCACAAGACCAGG + Intronic
981324707 4:143432390-143432412 CTGGGTTTTGTCACGTGACCAGG + Intronic
981355180 4:143781817-143781839 CAGGCAAGTGGCACATGACCTGG - Intergenic
981456007 4:144954019-144954041 CAGGTTCTTGTCACACGACCAGG - Intergenic
981456904 4:144962880-144962902 CAGGTTCTTGTCATATGAACAGG - Intergenic
981491151 4:145340704-145340726 CAGGTTCTTGTCACATGACCAGG - Intergenic
981529365 4:145736679-145736701 CAGGCTCCTGTGCCAAGACCTGG - Intronic
981764211 4:148229409-148229431 CAGGTTCTGATCTCATGACCAGG - Intronic
982157984 4:152540085-152540107 CAAGTTCTTGTCCCGTGACCAGG + Intergenic
982227203 4:153177208-153177230 CTGGCTCTTGTCATAAGACGAGG + Intronic
982260593 4:153490809-153490831 CAGGCCCATGTCACCAGACCTGG - Intronic
982475253 4:155842778-155842800 TGGGCTCTTGTCACATGACCAGG + Intronic
982521172 4:156418103-156418125 TGGGTTCTTGTCTCATGACCAGG - Intergenic
982590822 4:157307486-157307508 CAGGCTGTTGCCACATGGCCTGG - Intronic
982863117 4:160479436-160479458 CAGGTTCTTGTCTCAAGACCAGG + Intergenic
983040660 4:162921534-162921556 CGGGTTCTTGTCACATGACAAGG - Intergenic
983040672 4:162921616-162921638 CAGGTTCTTATCACATGACCAGG - Intergenic
983495830 4:168441704-168441726 CAGGCCCATGTCACAGTACCTGG - Intronic
983552707 4:169033652-169033674 CAGGTTCTTGTCACACGACCAGG + Intergenic
984099757 4:175471436-175471458 AGGGTTCTTGTCACACGACCAGG + Intergenic
984118473 4:175711896-175711918 ACTGTTCTTGTCACATGACCAGG - Intronic
984219077 4:176951582-176951604 CAGGTTCTTGTCACACAACAAGG + Intergenic
984327357 4:178271195-178271217 CAGGTTCTTGTTTCATGACCAGG - Intergenic
984952571 4:185018233-185018255 CAGGCTTTTCTCACACGACTTGG - Intergenic
985227445 4:187777918-187777940 CAGGCTCTTGTCCCATGACAAGG + Intergenic
985916262 5:2921197-2921219 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
985919926 5:2962472-2962494 CTGGTTCTTGTCTCATGACCAGG + Intergenic
986600779 5:9470441-9470463 CAGTCACTTCTCACATGAGCTGG - Intronic
987358357 5:17084520-17084542 CGGGTTCTTGTCTCACGACCAGG + Intronic
987875462 5:23675228-23675250 CAAGTTCTTGTCACATGTCCAGG - Intergenic
987938359 5:24499542-24499564 CAGGCTCTTGCCACAACACCTGG - Intronic
988069867 5:26274028-26274050 CAGGTTCTCGTCTCATGACGAGG - Intergenic
988157900 5:27477915-27477937 TAGGTTCTCGTCACATGACCAGG - Intergenic
989093273 5:37756694-37756716 CAGGCACTTCTCCCATGGCCTGG - Intergenic
989438179 5:41438678-41438700 TGGGTTCTTGTCACATGACAAGG - Intronic
989691633 5:44151999-44152021 AGGGCTCTTATCATATGACCAGG - Intergenic
989715076 5:44453730-44453752 CAGGTTTTTGTTACATGACCAGG + Intergenic
989715572 5:44458475-44458497 CGGGTTTTTGTCACATGACCAGG + Intergenic
990176959 5:53118728-53118750 CAGGTTCTTGTTTCATGACCAGG + Intergenic
990569949 5:57068043-57068065 CAGGTTCTTTTCTCATGACCAGG - Intergenic
991082991 5:62621255-62621277 CAGGTTCTTGTCACACGACCAGG + Intronic
993703301 5:91143362-91143384 CAAGTTCTTGTCCCATGCCCAGG + Intronic
993728664 5:91397134-91397156 TTGGTTCTTGTCACATGACCAGG + Intergenic
994093341 5:95827320-95827342 TGGGCTCTTGTCACACGACCAGG - Intergenic
994650981 5:102527926-102527948 TAGGCTCTTTTCAGATGACAAGG - Intergenic
994913115 5:105938972-105938994 TGGGTTCTTGTCACATGACCAGG + Intergenic
995863039 5:116661605-116661627 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
996677054 5:126188285-126188307 CGAGTTCTTGTCACAGGACCAGG - Intergenic
996955389 5:129177393-129177415 CAGGTTCTTGTCTCACAACCAGG + Intergenic
997611080 5:135216211-135216233 CAGGGCCTTGACACATGCCCTGG + Intronic
998338074 5:141391452-141391474 CAGGCTCATGCCACCAGACCTGG + Intronic
998641147 5:144012814-144012836 CAGGTTCTTGTCACATGAGTAGG + Intergenic
998651090 5:144122589-144122611 CGGGCTCTTGTCACACAGCCAGG + Intergenic
998845576 5:146306378-146306400 CAGGCACTTGTGACAAAACCTGG - Intronic
998942989 5:147305156-147305178 TGGGCTCTTGTCACATGACCAGG + Intronic
1000234428 5:159344456-159344478 CAGGTTCTTGTCCTATGTCCAGG + Intergenic
1000241841 5:159415942-159415964 CGGGTTCTTGTCACACAACCAGG - Intergenic
1000675652 5:164119756-164119778 TAGGATCTTGTCACATGACTAGG + Intergenic
1002480559 5:179498143-179498165 CAGGCTCATGGCTCACGACCTGG + Intergenic
1002762673 6:214148-214170 CAGGTCCTTGTCCCATGTCCAGG - Intergenic
1005055176 6:21722478-21722500 CAGGTTCTTGTCACACAACCAGG + Intergenic
1005309751 6:24548219-24548241 CAGGCTCTTGTCACACTACCAGG + Intronic
1005564680 6:27079009-27079031 CGGGTTCTTGTCACATAACCAGG - Intergenic
1005981540 6:30840615-30840637 CGGGTTCTTGTCACATGACCAGG + Intergenic
1005981969 6:30843614-30843636 CAGGTTCTTGTCACACAAGCAGG - Intergenic
1006279700 6:33040711-33040733 CAGGCTCATGTCACCATACCAGG + Intergenic
1007575040 6:42919901-42919923 CAGGCACGTGTCACAACACCCGG - Intronic
1007687809 6:43677390-43677412 CCTGCTCTTATCACCTGACCAGG + Intronic
1008188056 6:48419736-48419758 CAGGCTATAGTCAGATGAACAGG + Intergenic
1009735950 6:67675731-67675753 TGAGCTCTTGTCTCATGACCAGG + Intergenic
1010541282 6:77094995-77095017 AGGGCTTTTGTCACATGACCAGG - Intergenic
1010872995 6:81064526-81064548 CGGGTTCTTGTCACACGACCAGG + Intergenic
1010887548 6:81263163-81263185 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
1011882414 6:92045982-92046004 AAGGTTCTTGTCACAGTACCAGG - Intergenic
1012595488 6:101032966-101032988 CAGGTTCTTGTCTAATGACCAGG - Intergenic
1012629171 6:101442187-101442209 CAGGTTCTTGTCACAGGACCAGG + Intronic
1012804819 6:103879993-103880015 TAGGTTCTTGTCACGTGACCAGG - Intergenic
1013239361 6:108229115-108229137 CAGGCTCGTGCCACCTCACCCGG - Intronic
1014193499 6:118525091-118525113 TGGGTTCTTGTCACACGACCAGG - Intronic
1014664190 6:124215973-124215995 CAGGCGCTTGTCACCAGGCCCGG - Intronic
1014953849 6:127592890-127592912 CGTGTTCCTGTCACATGACCAGG + Intergenic
1015057178 6:128917874-128917896 CAGGCTCTTGCCACCCCACCTGG + Intronic
1015681437 6:135813161-135813183 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1016117191 6:140301840-140301862 CAGGCTTTTGTCACACAACCAGG - Intergenic
1016233177 6:141830894-141830916 TGGGTTCGTGTCACATGACCAGG + Intergenic
1016452738 6:144199884-144199906 CAGGCTCTTGCCACCACACCTGG - Intergenic
1016559295 6:145377447-145377469 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1016618319 6:146078882-146078904 CAGGTTCTTGTCACACCACCAGG + Intronic
1016671349 6:146712325-146712347 CAGGCACTTGTCACCACACCAGG + Intronic
1017275967 6:152568748-152568770 CAGGCTCTTGCCACTGCACCTGG + Intronic
1017867946 6:158461041-158461063 CAGGTGTTTGTCACATGACTGGG - Intronic
1019362833 7:614322-614344 CAGCCTTTTGTCAGAAGACCTGG - Intronic
1020596607 7:10214171-10214193 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1020956530 7:14745819-14745841 CAGGTTCTTGTCTCATGACCAGG - Intronic
1021648375 7:22808544-22808566 CAGGTTCTTGTGTCATGACCAGG - Intergenic
1021701069 7:23320051-23320073 CAGGCACTTGTCACCACACCCGG + Intronic
1021874486 7:25035965-25035987 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1022391945 7:29950925-29950947 CAAGCTCTTGTCCCATGTTCAGG - Intronic
1023488962 7:40717229-40717251 CAGGCTCTTGTCACACGACCAGG + Intronic
1024743642 7:52382755-52382777 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1025157912 7:56625986-56626008 TGGGTTCTTGTCACATGACAAGG - Intergenic
1025757817 7:64362038-64362060 TGGGTTCTTGTCACATGACTAGG + Intergenic
1025758355 7:64367316-64367338 TAGGATCTTATCACATGAACAGG + Intergenic
1026384787 7:69835615-69835637 CTTGCTCTTGTCACATGCCTGGG - Intronic
1026655907 7:72256315-72256337 CAGGCCCATGTCACAACACCCGG - Intronic
1028025138 7:85827925-85827947 CAGGCGCTTGTCACCACACCCGG + Intergenic
1028849770 7:95525029-95525051 TGGGTTCTTGTCACATGACCAGG - Intronic
1029002453 7:97168187-97168209 CAAGTTCTTGTCTCATGACCAGG - Intronic
1030496621 7:110308801-110308823 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1031112609 7:117630460-117630482 CGGGTTCTTGTCACATGATCCGG + Intronic
1031616481 7:123887883-123887905 CAGGCTCTTGACTCATGACCAGG - Intergenic
1032250914 7:130256547-130256569 CAGGTTCTTGTCACAAGACTGGG - Intergenic
1032329223 7:130962276-130962298 TGGGTTCTTGTCACATGACCAGG + Intergenic
1032580050 7:133096079-133096101 TAAGTTCTTGTCACACGACCAGG + Intergenic
1033865567 7:145687077-145687099 CAGGTTCTTGTCAGATGACGTGG - Intergenic
1035418407 7:158707690-158707712 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
1035690048 8:1554143-1554165 CAGGCACTTGTCACCAGGCCTGG - Intronic
1036155623 8:6339443-6339465 CAGGTTCTTGCCACACAACCAGG - Intergenic
1037103613 8:15078230-15078252 TGGGTTCTTGTCTCATGACCAGG - Intronic
1037259865 8:16996248-16996270 GAGGTCCTTGTCACATGACCAGG - Intronic
1037412517 8:18613518-18613540 GGGGTTCTTGTCACACGACCAGG - Intronic
1038017120 8:23524610-23524632 CAGGCACTTGTCACCACACCTGG - Intergenic
1038169468 8:25115878-25115900 CAGGCGCTTGTCACCACACCTGG - Intergenic
1038370298 8:26982146-26982168 CGGGTTCTTGACACATGACCAGG - Intergenic
1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG + Intronic
1039743219 8:40401022-40401044 TAGGTTCTTGTCTCATAACCAGG + Intergenic
1039802384 8:40970622-40970644 CAGGTTCTTGTCACACAACCAGG + Intergenic
1040373989 8:46805596-46805618 TGGGTTCTTGTCACATGACTAGG + Intergenic
1040374482 8:46810644-46810666 CAGGATCTTGTAACATAACCAGG + Intergenic
1040480417 8:47821267-47821289 GAGCCTCTTGTCACAGGAGCTGG + Intronic
1040662959 8:49596747-49596769 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1040853413 8:51925045-51925067 CTGGTTCTTGTTACATAACCAGG + Intergenic
1040919330 8:52599325-52599347 CAGTTTCTTGTCCCATGACCAGG - Intergenic
1040997259 8:53414264-53414286 CAGGCTCTTGTCACACGACCAGG + Intergenic
1041292531 8:56320507-56320529 CAGGCTCCAGACACACGACCTGG - Exonic
1041351627 8:56952800-56952822 CAGGTTCTTGTCTCATGACGAGG - Intergenic
1041401272 8:57448041-57448063 CAGGTTCTTGCCACACAACCAGG + Intergenic
1042031626 8:64482516-64482538 CAGGCCCTTCTCTCCTGACCTGG + Intergenic
1042554959 8:70026587-70026609 CGGGTTCTTGTCACACAACCAGG + Intergenic
1043734972 8:83730711-83730733 CAAGCTCTTGTCACATGCCCAGG + Intergenic
1044464481 8:92487622-92487644 CAGCCTCTTTTCAAATGACCTGG + Intergenic
1045482624 8:102604375-102604397 CAGGCTCTTGGCACAGTACCTGG - Intergenic
1046337791 8:112813024-112813046 CGAGTTCTTGTCACACGACCAGG + Intronic
1046412149 8:113859454-113859476 TGGGTTCTTGTCACATGACGAGG - Intergenic
1047128213 8:121987272-121987294 AAGGTTCTTGTCACACAACCAGG + Intergenic
1047288138 8:123506084-123506106 CAGGCTCATGCCACAACACCCGG - Intronic
1047518781 8:125578418-125578440 CAGGCACTTGGCACATGCACGGG - Intergenic
1048175583 8:132149454-132149476 CGGGTTCTTGTCACATGACCAGG - Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049804757 8:144533828-144533850 CAGGCTCTTGGGACAGGTCCAGG + Intronic
1049826791 8:144674208-144674230 CAAGTTCCTGTCACATGTCCAGG + Intergenic
1050445777 9:5721289-5721311 CAGGTTCTTGTCACACAGCCAGG + Intronic
1050785275 9:9393137-9393159 CAGGTTCTTGTCACATGGCCAGG - Intronic
1050929858 9:11309001-11309023 CGGGTTCTTGTCACATGACCAGG - Intergenic
1051931645 9:22393465-22393487 CAGGCTCCTGTCACCACACCTGG - Intergenic
1052059238 9:23940999-23941021 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1052116059 9:24649495-24649517 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1052509032 9:29390750-29390772 TGGGTTCTTGTCACATGACCAGG + Intergenic
1052519920 9:29533668-29533690 CAGGTTGTTGTCACAGGACCAGG + Intergenic
1052795374 9:32918993-32919015 CAGTTTCTTGTGACACGACCAGG - Intergenic
1053751864 9:41265532-41265554 CAGGTTCATGTCACATTGCCAGG - Intergenic
1054257387 9:62829862-62829884 CAGGTTCATGTCACATTGCCAGG - Intergenic
1054333929 9:63785861-63785883 CAGGTTCATGTCACATTGCCAGG + Intergenic
1054774393 9:69112770-69112792 CAGGCGCTTGTCACCTTGCCGGG - Intergenic
1055202507 9:73684163-73684185 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1056350549 9:85744477-85744499 CAGGTTCTTGTCTCAAGACCAGG + Intergenic
1056570266 9:87808554-87808576 CAGGTACTTGTCTCATGACCAGG - Intergenic
1056889845 9:90480928-90480950 TGGGCTCTTGTCACACAACCAGG - Intergenic
1057174751 9:92988055-92988077 CGGGTTCTTGTCTCATTACCAGG + Intronic
1057283415 9:93728523-93728545 CAGGCTCCTGCCCCATGACTGGG + Intergenic
1057342426 9:94214601-94214623 CAGGTTCTTGTCACACGACCAGG - Intergenic
1058281891 9:103126817-103126839 CTGGTTCTTGTCACACCACCAGG + Intergenic
1058282450 9:103132200-103132222 TAGGTTCTTGTGACATGAACAGG + Intergenic
1059190942 9:112325510-112325532 CAGGTTCTTGTCTCACAACCAGG - Intronic
1059252839 9:112902650-112902672 CAGCCTCATCTCACATGACATGG + Intergenic
1059833101 9:118120404-118120426 TGGGTTATTGTCACATGACCAGG - Intergenic
1060486916 9:124053629-124053651 CAGGGTCTTGTCTCATGACCAGG - Intergenic
1060685719 9:125609619-125609641 CAGGCACTTGTCACCGGGCCTGG + Intronic
1061946294 9:133910018-133910040 CAGATTCTAGTCACATGGCCTGG - Intronic
1061976679 9:134071714-134071736 AAGGCTCTTGACACAGGGCCTGG - Intergenic
1062666663 9:137676968-137676990 CCGGTTCTTGTCACACAACCAGG - Intronic
1062695302 9:137872549-137872571 CAGGCTCTTGTCCAAGCACCAGG + Intergenic
1185722851 X:2395775-2395797 CAAGTTCTTGTCCCATGACCTGG + Intronic
1186669096 X:11751305-11751327 CAGGCACTTGCCACCTCACCTGG - Intergenic
1186766434 X:12775264-12775286 CAGGCACATGTCACCTCACCTGG - Intergenic
1187842891 X:23506952-23506974 CGGGCTCTTGTCACATGACCAGG - Intergenic
1188179288 X:27034365-27034387 CGGGTTCCTGTCTCATGACCAGG + Intergenic
1188375271 X:29421166-29421188 CAGGTTCTTGTCACATGACCAGG + Intronic
1189511700 X:41668868-41668890 CAGGCTCTTGTCACCATGCCTGG + Intronic
1189649800 X:43177114-43177136 CAGGTTCTTGTCACAGGACCAGG - Intergenic
1189947767 X:46196475-46196497 CAGGTTCTTGTCTCACAACCAGG - Intergenic
1190548792 X:51557833-51557855 TGGGTTCTTTTCACATGACCAGG + Intergenic
1190576769 X:51847474-51847496 TGGGTTCTTGTCACAAGACCAGG + Intronic
1193140545 X:78022165-78022187 CAGATTCTTGTCACACGACCAGG - Intronic
1193196609 X:78639562-78639584 CAGACTCTTCTCCCTTGACCTGG - Intergenic
1193268891 X:79506508-79506530 TGGGTTCTTATCACATGACCAGG - Intergenic
1193269877 X:79516258-79516280 TGGGTTCTTGTCACATGACCAGG - Intergenic
1193699968 X:84748236-84748258 CGGGTTCTTGTCACACGACCAGG - Intergenic
1194059231 X:89177251-89177273 CGGGATCTTGTCTCATCACCAGG + Intergenic
1194088872 X:89562083-89562105 CAAGTTCTTGTGACACGACCAGG + Intergenic
1194160487 X:90444172-90444194 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1194227608 X:91280267-91280289 CAGGTTCTTGTCTTATGACCAGG + Intergenic
1194476013 X:94360795-94360817 CAGGTTCTTGTCTCATGACTAGG + Intergenic
1194640981 X:96404150-96404172 CAGGTTCTTGTCACACGACCAGG + Intergenic
1194653082 X:96538636-96538658 CCGGTTCTTGTCACACGACCAGG - Intergenic
1194680264 X:96843557-96843579 TGGGTTCTTGTCACATGACCAGG + Intronic
1196691516 X:118563923-118563945 CCAGTTCTTGTCACATAACCAGG + Intronic
1196754635 X:119147428-119147450 CAGGTACTTGACACCTGACCAGG - Intronic
1196892039 X:120300528-120300550 CAGGCTCATGCCACAGGGCCAGG + Intronic
1197299458 X:124760264-124760286 CAGGTTCTTGTCACACGACCAGG - Intronic
1197300845 X:124778434-124778456 CAGATTCTTGTCACATGACCAGG - Intronic
1197509827 X:127356725-127356747 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1197971308 X:132118331-132118353 CAGGTTCTTGTCACACGACCAGG + Intronic
1198043590 X:132878108-132878130 CAGGTTCTCGTCTCATGACTAGG + Intronic
1198139317 X:133786826-133786848 TGGGTTCTTGTCACATGACCAGG - Intronic
1198363035 X:135914695-135914717 CAAGTTCTTGTCACACGACCAGG + Intergenic
1199829818 X:151538389-151538411 CAAGTTCTTGTCACATGACCAGG + Intergenic
1200150581 X:153949472-153949494 CAGCCTCTTGTCAAATGACTGGG - Intronic
1200258342 X:154597798-154597820 TGGGTTCTTGTCACATGACCAGG - Intergenic
1200441548 Y:3218135-3218157 CAAGTTCTTGTGACACGACCAGG + Intergenic
1200506777 Y:4021112-4021134 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1200852117 Y:7894002-7894024 CAGGATCTTGTCACATGATCAGG - Intergenic
1200898270 Y:8399947-8399969 TATGAACTTGTCACATGACCAGG - Intergenic
1200898687 Y:8404579-8404601 TGGGTTCTTGTCACATGACTAGG - Intergenic
1201221297 Y:11773403-11773425 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1201677628 Y:16604752-16604774 CAGGCTCGTGCCACAACACCTGG - Intergenic
1202258949 Y:22949520-22949542 TGGGTTCTTGTCACATGACTAGG + Intergenic
1202411937 Y:24583277-24583299 TGGGTTCTTGTCACATGACTAGG + Intergenic
1202458845 Y:25086795-25086817 TGGGTTCTTGTCACATGACTAGG - Intergenic