ID: 977827196

View in Genome Browser
Species Human (GRCh38)
Location 4:101547224-101547246
Sequence TGAACCAGTTTTCAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977827193_977827196 24 Left 977827193 4:101547177-101547199 CCCTTAGCCATTAATATGGTGGA 0: 1
1: 0
2: 2
3: 10
4: 99
Right 977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG 0: 1
1: 0
2: 1
3: 19
4: 213
977827195_977827196 17 Left 977827195 4:101547184-101547206 CCATTAATATGGTGGAGTACATT 0: 1
1: 0
2: 9
3: 98
4: 414
Right 977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG 0: 1
1: 0
2: 1
3: 19
4: 213
977827194_977827196 23 Left 977827194 4:101547178-101547200 CCTTAGCCATTAATATGGTGGAG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG 0: 1
1: 0
2: 1
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977827196 Original CRISPR TGAACCAGTTTTCAAAGAAC TGG Intronic
905256128 1:36686672-36686694 TGTACCCATTTTAAAAGAACTGG + Intergenic
905854069 1:41295727-41295749 AGAACCAGTGTTCAGAGAATTGG + Intergenic
905859466 1:41340275-41340297 GGAACCAGTTTCCGAAGACCTGG - Intergenic
906393268 1:45437616-45437638 TGTTCCAGTTTTCAGAGAAAAGG + Intronic
907365704 1:53957722-53957744 TGCTCCAGTTTTCAAATCACTGG + Intronic
908236305 1:62150508-62150530 GGAGCCAGTTTTAAGAGAACTGG + Intronic
908316924 1:62941851-62941873 TGACCCAATTTTGCAAGAACAGG - Intergenic
909418360 1:75433474-75433496 TCAGTGAGTTTTCAAAGAACTGG - Intronic
910375186 1:86561062-86561084 TTAACGAGTGTTCAATGAACAGG - Intronic
911507511 1:98771868-98771890 TGACTCTGTTTTCAAATAACTGG - Intergenic
913302822 1:117390185-117390207 TGAAAGAGTTTCCATAGAACTGG + Intronic
916146824 1:161747367-161747389 TAACCCAATTTTCAAAAAACTGG - Intergenic
918536099 1:185576382-185576404 TGAACCATATTTGAAAGAAAAGG - Intergenic
919375923 1:196794976-196794998 TAACTCAGTTTTCAAATAACAGG + Intronic
919385627 1:196919861-196919883 TAACTCAGTTTTCAAATAACAGG + Intronic
919998311 1:202774685-202774707 TGGACCAGATTGCAAAGTACTGG - Exonic
920117698 1:203632140-203632162 TTAACCATTTTTTAAAGAATGGG - Intronic
920318630 1:205099067-205099089 TGCACCAGACTTCAAAGAATTGG - Exonic
922450902 1:225736524-225736546 TGGATCATTTTTCAGAGAACAGG - Intergenic
1063365907 10:5490790-5490812 AGAAGCAGCTTTCAAAGAACTGG + Intergenic
1063694613 10:8321370-8321392 TGATTGAGTTTTCAAGGAACGGG + Intergenic
1064540109 10:16396598-16396620 TGAACTAGTTTTGAAAGATAAGG - Intergenic
1066013623 10:31216527-31216549 TGAACCAATTTTCAAAGAATTGG - Intergenic
1067512542 10:46907963-46907985 TGAACCAGGCTGCAAAGCACAGG + Intergenic
1067649702 10:48143859-48143881 TGAACCAGGCTGCAAAGCACAGG - Intergenic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1071793804 10:88984557-88984579 TGAACCAGTTTGCAAACACTGGG - Intronic
1072589060 10:96810529-96810551 TGAAACAGTTTTCCAAAAATAGG - Intergenic
1073532977 10:104249837-104249859 AGAAACATTTTTTAAAGAACAGG - Intronic
1073891447 10:108106983-108107005 TGAACCAGTAGGCAAAGAAGAGG + Intergenic
1079495956 11:21044331-21044353 TGAAGCAGTTTTCATAGGAGTGG + Intronic
1080371650 11:31653305-31653327 GTCACCAGTTTTCAAAGAATTGG - Intronic
1083248067 11:61445339-61445361 AGAACCAGATTTCAGTGAACGGG - Intronic
1084828074 11:71746369-71746391 TGTACCACTTCTAAAAGAACAGG + Intergenic
1085075321 11:73586014-73586036 TGAACCAGTTTTTACAGAGCAGG - Intronic
1087442396 11:98202977-98202999 TGAACCAGATTTCAAAGGGAAGG - Intergenic
1090163843 11:124524520-124524542 TGAACTAATTTTCAGGGAACTGG - Intergenic
1090536719 11:127650295-127650317 TGTAACAGTTTTGAGAGAACAGG + Intergenic
1091418071 12:307984-308006 GGTGGCAGTTTTCAAAGAACGGG - Exonic
1092415170 12:8285336-8285358 TGTACCACTTCTAAAAGAACAGG - Intergenic
1095065390 12:37765764-37765786 TGTGCCAGTTTTCAAAGAGAAGG - Intergenic
1095453036 12:42351316-42351338 TGAACTAATTTTCAAAGTACTGG - Intronic
1096850884 12:54435715-54435737 TGAACCTGTTTTTAAAGCAATGG + Intergenic
1097148878 12:56962315-56962337 TGTACCAGTTTTCAAAGGGAAGG - Intergenic
1098546717 12:71719523-71719545 TGTAACAGTTTGTAAAGAACTGG + Intergenic
1099419256 12:82433578-82433600 TAAACCAGGATTCAAATAACAGG + Intronic
1100015438 12:90005153-90005175 TCAACCAATTTTCAAACCACAGG - Intergenic
1101146111 12:101841877-101841899 TGATCCAGTTTTCAAACACCAGG - Intergenic
1106016160 13:25870925-25870947 TAAAGCAGGTTTCAAACAACAGG + Intronic
1108697231 13:52913203-52913225 TAAAACAGCTTTCAAAGCACCGG - Intergenic
1110566552 13:76963177-76963199 TCAACAACTTTTCAAAGTACTGG + Intergenic
1111748790 13:92300929-92300951 TTTACCAGTTTTCAATGAAAAGG - Intronic
1115136646 14:30117321-30117343 TGTACCAGTTTTCAAAAAGTAGG + Intronic
1116139015 14:40965173-40965195 TTAGCAAGTATTCAAAGAACAGG + Intergenic
1118063030 14:62161628-62161650 TGGACAAGTTTTCAAAAAATTGG + Intergenic
1118720463 14:68590341-68590363 AGAACCAGTTTTCCATGAGCAGG + Intronic
1119619893 14:76124195-76124217 AGAAAGAGTTTTCTAAGAACAGG + Intergenic
1120076852 14:80168506-80168528 TGTAACAGATTTCAAAGATCTGG + Intergenic
1120792912 14:88601528-88601550 TGAACCACTTTTCCAAAATCTGG - Intronic
1122588919 14:102831419-102831441 TAAAACATTTTTCAAAGAAAAGG + Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124129676 15:26972486-26972508 TGCTCCAATTTTCAAATAACAGG - Intronic
1125090723 15:35788833-35788855 TCAACCAGTTTTTCAAGAAAAGG + Intergenic
1126062131 15:44792879-44792901 TGCCCCAGTTATCAATGAACAGG + Intergenic
1126358579 15:47822303-47822325 TGAAGCTGTTTTCAAGGAACAGG - Intergenic
1126855172 15:52831825-52831847 GGAACCACTTTTCCCAGAACTGG - Intergenic
1130170498 15:81507318-81507340 TGAACCAGCTTTCCAAAAAATGG + Intergenic
1131651521 15:94404659-94404681 TGAAGGCGTTTTCAAAGAAAAGG - Intronic
1131748847 15:95482973-95482995 AGAACCAGTTTGCAAAGACTGGG + Intergenic
1133150328 16:3823656-3823678 TGAACCAGAGTTCAAACAGCAGG - Intronic
1135692827 16:24557322-24557344 TGAACCAGTTTTTAATGAAATGG + Intronic
1137749142 16:50845708-50845730 TGAGCCAGTTTTCAAAGGGGAGG + Intergenic
1139414615 16:66797849-66797871 AGAACCATTTTTAAAATAACTGG + Intronic
1139606110 16:68019852-68019874 TGACCCAGTCTCCAAAGATCGGG - Intronic
1141009830 16:80387097-80387119 TGAGCCAGTTTTCAGAGAAAAGG + Intergenic
1141793378 16:86251921-86251943 TGAAGTGGTTTTCAAAGGACAGG - Intergenic
1145289988 17:21535300-21535322 TCAACAGGTTTTCAAAGAAGAGG + Exonic
1146034457 17:29393626-29393648 AGAGCCAGTTGTGAAAGAACAGG - Intronic
1147682424 17:42259390-42259412 TGCAGCAGTTTTCAAACAAGAGG + Intronic
1150036295 17:61802675-61802697 TGAACCAGTTTTCTTATTACTGG + Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1157519562 18:48336225-48336247 ATAACCAGTTTTCAAAGCCCAGG + Intronic
1157612270 18:48964617-48964639 TGAATCAGGTTTAAAAGAATAGG + Intergenic
1158354565 18:56602767-56602789 TTAACCAGTTTTCAAATACATGG + Exonic
1158883955 18:61807575-61807597 TGATCCAGTTATCAAAAGACAGG + Intergenic
1163822963 19:19506707-19506729 GGAACCAGTTTTTAAAGAGTGGG - Exonic
1163980020 19:20890496-20890518 TGAACCAGTGGGCAATGAACAGG - Intergenic
1167173758 19:47851272-47851294 GGAACCAATTTTCTAAAAACAGG + Intergenic
926501815 2:13664505-13664527 TTACCCAGTTTTGAAAGAAATGG - Intergenic
928282216 2:29957878-29957900 TGAAATATTTATCAAAGAACAGG + Intergenic
933029858 2:77314456-77314478 TAAACTAGTTTTCTAAGAATAGG + Intronic
933828170 2:86182960-86182982 TGAACCATTTTTAATAGAAAAGG + Intronic
936722614 2:115271008-115271030 TGAACTAGTTTTGAAGGTACTGG - Intronic
937174803 2:119919246-119919268 TGTACCAGTTTTCAAGAAAATGG + Intronic
937517848 2:122675637-122675659 TGAGCCAGACTTTAAAGAACTGG + Intergenic
939201533 2:139042097-139042119 TGCACCAGTTTTCAAGAAAAGGG + Intergenic
939486891 2:142825768-142825790 AAAAACAGTTTTCAAAGTACTGG + Intergenic
940857128 2:158738333-158738355 GTAACCAGTTTTGTAAGAACAGG + Intergenic
942538644 2:176992319-176992341 TGAAACAGTTTGAGAAGAACTGG - Intergenic
942848763 2:180457705-180457727 TGAAAGAGTTTTCAAAGATTAGG + Intergenic
943308187 2:186293425-186293447 TGAACCAGTTTTCCCATTACAGG - Intergenic
943499401 2:188668180-188668202 AGAACTAGATTTCAAAGGACTGG + Intergenic
945732312 2:213553907-213553929 TGTAACAGTATTCAAAGAAAGGG - Intronic
947675270 2:231973073-231973095 TGGAACAGTTTGCATAGAACTGG + Intronic
1168901753 20:1370824-1370846 TGACTCAGCTCTCAAAGAACAGG + Intronic
1169153949 20:3313390-3313412 TGAACCAGTGATCTGAGAACAGG + Intronic
1169488076 20:6050257-6050279 TGAACAACTTTTCAAAGCAAAGG - Intronic
1169591307 20:7146043-7146065 TGAATAAGTTTTCTAAGAAGAGG + Intergenic
1170469294 20:16652606-16652628 TGAACCAGTTTGGATAGACCAGG + Intergenic
1170861418 20:20107280-20107302 TGACCCAGTAGTCAAATAACTGG - Intronic
1172099837 20:32478564-32478586 AGAACCACTTTTCACAAAACTGG - Intronic
1172732483 20:37099652-37099674 TGAACCAGATATCAAAGAATTGG + Intergenic
1173994741 20:47329077-47329099 TGCACAACTTTTCAAAGAATAGG + Intronic
1176945149 21:14970709-14970731 CAAACCAGTTTTCAAATGACTGG - Intronic
1178076088 21:29014306-29014328 TGAAAAAGTTCCCAAAGAACAGG - Intronic
1178181471 21:30166620-30166642 TGAACCAGTCTTCAAAGTAAAGG - Exonic
1178760124 21:35394115-35394137 TGAAACAGTTTATAAAGAAAAGG - Intronic
1179898782 21:44378129-44378151 GGAAGCATTTTTCAAAGTACAGG + Intronic
1180663496 22:17489917-17489939 TGAGCCTTTTTTCAAAAAACAGG + Intronic
1180930627 22:19588313-19588335 TGCACCATTTTTCAATGAATTGG + Intergenic
1181422112 22:22809322-22809344 TGAACCAAGTTTCAAGGTACAGG + Intronic
1182411288 22:30189164-30189186 AGAACTAGTTTTCAAAACACTGG - Intergenic
1183326156 22:37195689-37195711 TTAATCAGTTTTCCAAGAAAGGG + Intronic
1184588009 22:45460742-45460764 TGAAGCACTTTTCAAATAAAAGG - Intergenic
949157215 3:843473-843495 ATAACCAGTTTTGAAACAACTGG - Intergenic
951116633 3:18871030-18871052 TGAAAAAGTTGTCAAAGAACAGG + Intergenic
951456839 3:22902428-22902450 TGAACCAGTTTTGAAGTAATGGG + Intergenic
952329836 3:32354432-32354454 TGAGCCGTCTTTCAAAGAACGGG - Intronic
954468681 3:50674132-50674154 TCAACCACTTACCAAAGAACAGG - Intergenic
956227964 3:66980887-66980909 TGAACCAGAAGTCAAAGAAATGG + Intergenic
957697719 3:83663720-83663742 TGATACAGTTTTCAAAGATGTGG - Intergenic
957942861 3:87027011-87027033 TGAAGCAATTTTCACAGAAGAGG - Intergenic
958041291 3:88229935-88229957 TCTACCAGTTTTCAACAAACAGG - Intergenic
958679156 3:97304316-97304338 TGTGCCAGTTTTCAAGGAAAGGG + Intronic
961629948 3:128289273-128289295 GGAACCAGTTTACCAAGACCTGG + Intronic
961892725 3:130143947-130143969 TGTACCACTTATAAAAGAACAGG - Intergenic
962938723 3:140106092-140106114 AGATCCAGTCTTTAAAGAACTGG + Intronic
965776294 3:172235080-172235102 TTGACCAGTTTTGAAAAAACTGG - Intronic
966711215 3:182975136-182975158 TAAAAAAGTTTTAAAAGAACAGG - Intronic
967224236 3:187275633-187275655 AGAACTGGTTTTCATAGAACTGG - Intronic
967267497 3:187703302-187703324 TGAAACAGGTTGCTAAGAACCGG + Intronic
968324293 3:197799098-197799120 TGAACCAGTTTTGAGAGTACGGG + Intronic
969750043 4:9103195-9103217 TGTACCCGTTCTAAAAGAACAGG + Intergenic
973838120 4:54831524-54831546 TTAACCAGTTTACAAAGAATTGG + Intergenic
974853205 4:67428338-67428360 TGAAACAGTTTTTAATGACCTGG - Intergenic
975822715 4:78288151-78288173 TGAACCTGTTTTAAAGTAACAGG - Intronic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977827196 4:101547224-101547246 TGAACCAGTTTTCAAAGAACTGG + Intronic
977830039 4:101579426-101579448 TGAAACAGATTGCAAAGAATTGG + Intronic
978382134 4:108140264-108140286 GGATCCAGTTTGAAAAGAACTGG + Intronic
979310869 4:119201724-119201746 TGTGCCAGTTTTCAAAGGAATGG - Intronic
980275867 4:130649928-130649950 TCAACCAGTTTACAAAGAATTGG + Intergenic
980473240 4:133276726-133276748 TTAACTACTTTTCCAAGAACTGG - Intergenic
984093819 4:175409496-175409518 TTAGCCAGTTCTCAAAGATCAGG - Intergenic
984686017 4:182668905-182668927 TTTACCAGTTCTCAAAGCACAGG + Intronic
984904317 4:184612666-184612688 TGGGCCAGTTTTCAAAAAACAGG + Intergenic
985046232 4:185942826-185942848 TGAACCAGTCTGCAAAGTAATGG - Intronic
985528493 5:420247-420269 AAAACCTGTTTTCATAGAACAGG + Intronic
986200932 5:5577641-5577663 TAAACTAATTTTCAAACAACTGG - Intergenic
986627493 5:9736349-9736371 TGAGCCAGTGTTCACAGAAATGG - Intergenic
987396396 5:17428669-17428691 TGAAGCAGTTTCCAAGGAACAGG + Intergenic
988177640 5:27747458-27747480 TGGAATAGTTTCCAAAGAACTGG - Intergenic
988496869 5:31752761-31752783 TGAAACAGGCTTCAAAGAAGGGG - Intronic
989162947 5:38409238-38409260 TGAACCAGTTTACCAAATACTGG + Intronic
989234599 5:39131804-39131826 TATACCAATTTCCAAAGAACAGG + Intronic
989655281 5:43741089-43741111 TGAACTAGTTTCAAAAAAACTGG - Intergenic
992699199 5:79323603-79323625 TGAACCAGCACCCAAAGAACTGG - Exonic
994903707 5:105808435-105808457 TAAACAAGTTTTCAAATAAGAGG + Intergenic
995590702 5:113696791-113696813 TGAACCAGATTTATAAGAAGTGG - Intergenic
996807818 5:127477510-127477532 TGAACTAGTTTACAAAGACTTGG + Intergenic
997637258 5:135421723-135421745 TTAAACAGATTTCAAAAAACTGG - Intergenic
999226519 5:150029668-150029690 TGACACAGTTTTCAAACTACAGG - Intronic
1000874116 5:166614669-166614691 TGAACCAATTGTCAGAGGACTGG + Intergenic
1003603069 6:7535944-7535966 TTTACCAGTTTTTAAATAACTGG + Intergenic
1010145949 6:72669630-72669652 CGAACTAGTCTTCAAAGAAAGGG - Intronic
1010779839 6:79932888-79932910 TGAACTTTTTTTCAAAGAAGAGG + Intronic
1014446158 6:121530572-121530594 GGTTCCAGTTTTCAAAGATCAGG - Intergenic
1016686537 6:146888717-146888739 TGAATCAGATTTCAAAAAAATGG + Intergenic
1018500791 6:164409337-164409359 TGCAGCAGTGGTCAAAGAACAGG + Intergenic
1020322941 7:6953447-6953469 TGTACCCGTTCTAAAAGAACAGG - Intergenic
1020995239 7:15255431-15255453 TGAAATAGTTTGTAAAGAACTGG - Intronic
1021136924 7:16976543-16976565 GGAACCAGTTTTAAAATGACTGG + Intergenic
1022123116 7:27329239-27329261 AGAAACAGTTCTCAAAGACCAGG - Intergenic
1022568668 7:31429464-31429486 TCAACCTGTTTACAAAGAAGGGG - Intergenic
1024349452 7:48348810-48348832 TGATCCAGAATTCAAAGAATTGG - Intronic
1026014394 7:66661708-66661730 TGAAAGAGTTTGCAAAGGACTGG - Intronic
1026018415 7:66689946-66689968 TGAAAGAGTTTGCAAAAAACTGG - Intronic
1026511859 7:71034045-71034067 TGAGCCAGTTTCCAGAGAGCTGG + Intergenic
1027990094 7:85347529-85347551 TGATCCAGTTTCCCAAGAAAAGG - Intergenic
1030751096 7:113234167-113234189 TCAACCAGTTTACAATGAATAGG - Intergenic
1032324761 7:130916949-130916971 TGAACAAGTTTACAGAGAAGAGG - Intergenic
1032615618 7:133466623-133466645 TGAAAGAGTTTGCAAAGGACTGG - Intronic
1034240463 7:149606782-149606804 TGAAGGAGTTTTCTAAGATCTGG - Intergenic
1034640260 7:152596711-152596733 TTAAGATGTTTTCAAAGAACTGG + Intergenic
1035347052 7:158207402-158207424 TGAACTAGTTTACAAAGCAATGG + Intronic
1035740256 8:1922329-1922351 TGAACCACATTTCCAATAACTGG - Intronic
1036373122 8:8177535-8177557 TGTACCACTTCTAAAAGAACAGG + Intergenic
1036435890 8:8732938-8732960 TAAACCAGATATCAAAGAAGTGG + Intergenic
1036467442 8:9013988-9014010 ACAACCAGTTCTCAAAAAACTGG + Intronic
1036721549 8:11180240-11180262 AGAACCAGCTTTCACAGAAGAGG + Intronic
1036877782 8:12488106-12488128 TGTACCACTTCTAAAAGAACAGG - Intergenic
1039965828 8:42283008-42283030 TGAACAAGTCTTGAAATAACTGG - Intronic
1041049677 8:53921346-53921368 TGGAACAGTTTTTGAAGAACTGG + Intronic
1041406548 8:57505696-57505718 TGCACTATTTTTCAAAGAAAGGG + Intergenic
1041484085 8:58354991-58355013 TTAACCAGTTTTCAGTTAACAGG + Intergenic
1042063536 8:64848102-64848124 TGAACCAATTTTCCAGGACCAGG - Intergenic
1042394267 8:68273491-68273513 TGAACAATTTTTTAAAGAAAAGG - Intergenic
1045047395 8:98293098-98293120 TTAACCAATTATCAAAGATCTGG - Intronic
1046376211 8:113384596-113384618 AGACCCAGTTCTCAAAAAACAGG + Intronic
1046991833 8:120466552-120466574 AGCACTAGATTTCAAAGAACTGG - Intronic
1047103372 8:121706122-121706144 TGCACCATTTTACAATGAACTGG + Intergenic
1047657497 8:126994091-126994113 TGAATTCGTTTTCAAAGAATAGG - Intergenic
1051156354 9:14151332-14151354 TGAACAAATTTTCAGCGAACAGG - Intronic
1051366652 9:16326027-16326049 TAAATCTGTTCTCAAAGAACAGG + Intergenic
1052818628 9:33121723-33121745 AGAAGCAGTCTTCAAGGAACTGG - Intronic
1052837490 9:33262762-33262784 TGAACCAGTTGTCCAAGACCTGG - Exonic
1055209569 9:73774054-73774076 TGAATCAGTTTTGCAAGAAGAGG + Intergenic
1055332898 9:75202351-75202373 TGCACCATTGTTCAAAGTACTGG - Intergenic
1056628544 9:88274083-88274105 TTAACCAGATCTCAAGGAACAGG + Intergenic
1057421331 9:94915464-94915486 TCAACCAGATTTCAAAGGAAGGG - Intronic
1058906432 9:109485898-109485920 TGAAAGAATTTTCAAAGACCAGG - Intronic
1060576197 9:124697011-124697033 AGAACCACCTTCCAAAGAACTGG + Intronic
1187596610 X:20779435-20779457 TGAAACAGTTTACAAACAATTGG - Intergenic
1188121245 X:26310824-26310846 TAAAACAGTTTTCATAGAAAAGG - Intergenic
1188373885 X:29403757-29403779 AGAACCAGTTTTCTAACTACTGG - Intronic
1188816208 X:34717756-34717778 TGAACCAGTCTTCAGAGCACAGG + Intergenic
1188908293 X:35814296-35814318 TGAACCATCTCTCAAAGAACTGG + Intergenic
1189055139 X:37691568-37691590 TGAGCCAGTTGTTAAACAACTGG - Intronic
1189918205 X:45877769-45877791 TGAATCAGTTTCCAAACAAAGGG + Intergenic
1192525511 X:71839997-71840019 TGTGCCAGTTTTCAAAGGAAAGG + Intergenic
1195347836 X:103968293-103968315 TGAACCAGGATTCACAGACCCGG - Intergenic
1195359606 X:104070548-104070570 TGAACCAGGATTCACAGACCCGG + Intergenic
1197733159 X:129828987-129829009 TGAAGCAGCTTTCATAGAAATGG - Exonic
1200299844 X:154962316-154962338 TGAAACAATTTTTAAAGAAGTGG - Intronic