ID: 977830612

View in Genome Browser
Species Human (GRCh38)
Location 4:101587713-101587735
Sequence GACTACTCACTGGCCAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977830612_977830616 11 Left 977830612 4:101587713-101587735 CCAGTATTGGCCAGTGAGTAGTC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 977830616 4:101587747-101587769 TATCCTGCTACCTCTCTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977830612 Original CRISPR GACTACTCACTGGCCAATAC TGG (reversed) Intronic
905855441 1:41308502-41308524 GACTAATGCCTGGCTAATACAGG - Intergenic
907249258 1:53127260-53127282 GATTTCTCACTGCCCCATACAGG - Intronic
907931023 1:59000348-59000370 GCCAACTCACTGGCCACTGCAGG + Intergenic
908569775 1:65397075-65397097 GAGTACTAACTGGCCTAAACTGG - Intronic
911968516 1:104399139-104399161 GAATACTTACAGGCCAATATGGG + Intergenic
923945714 1:238884930-238884952 GACTTTTCACAGGCCAATTCTGG + Intergenic
1064086957 10:12352239-12352261 GACTAAGCATTGGCCATTACAGG - Intronic
1069872262 10:71540374-71540396 GTCTAGTAACTGGCCCATACAGG - Intronic
1072640375 10:97206993-97207015 CACTACACACTTGCCAACACTGG + Intronic
1075292074 10:121239404-121239426 GACTACTCACAGACCAAGAAGGG - Intergenic
1082921362 11:58498163-58498185 TACTACTCACTGGCCAATCTTGG + Intergenic
1096005660 12:48168967-48168989 GCCAACTCACTGGCCACTGCAGG - Intronic
1101143763 12:101821927-101821949 GCCTACTCACTGGGCAAAAGAGG + Intronic
1108208569 13:48115678-48115700 GACTCCTCAGTGGCCAAAGCAGG - Intergenic
1114842098 14:26276576-26276598 GCCTATTGACTGGCCAAGACTGG + Intergenic
1119815203 14:77560144-77560166 TCCTACTCACTGGCCAACATAGG - Intronic
1126097180 15:45097923-45097945 GAATACTCACTTGTCTATACTGG - Intronic
1128240001 15:66095472-66095494 GACTTCTCTCTGCCCAGTACTGG + Intronic
1130640547 15:85669818-85669840 GTATACTCACTGTCCAATCCAGG - Exonic
1137002447 16:35241304-35241326 GATTTCTCACTGACCATTACTGG + Intergenic
1146442759 17:32911401-32911423 AACTAGTAACTGGCAAATACAGG - Intergenic
1146760802 17:35476260-35476282 CTCAACTCACTGGCTAATACAGG + Intronic
1147457591 17:40547857-40547879 GACTAGTCACTGGGCAATATGGG - Intergenic
1148670298 17:49405116-49405138 GCCAACTCACTGGCCACTGCAGG - Exonic
1154235415 18:12601056-12601078 GACTGCCCACTGGCCAAGTCTGG - Intronic
1161462849 19:4409122-4409144 GACTGTGCTCTGGCCAATACTGG - Exonic
1162520291 19:11175680-11175702 GAACACTCACTGGCCAAGCCTGG - Intronic
1165673160 19:37696742-37696764 GCCAACTCACTGGCCACTGCAGG - Exonic
1166882648 19:45938800-45938822 GACTGGTCACTGTCCAATACAGG + Exonic
926219299 2:10924539-10924561 GGCTGCTCACTGGCCAGAACTGG + Intergenic
926333662 2:11847292-11847314 AACTACTCTTTGTCCAATACAGG - Intergenic
941314410 2:163974649-163974671 GACTTCCCACTGGCCAATCTTGG - Intergenic
946328723 2:218997945-218997967 GACTCCTAACTGGCCCAAACTGG - Intergenic
946449973 2:219771542-219771564 CACTCCTCACTAGCCAATGCAGG - Intergenic
1168808450 20:686991-687013 GACTGCCCCCTGGCCAAGACGGG - Intergenic
1172313415 20:33935111-33935133 GAATCCTCAGCGGCCAATACAGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173136928 20:40447002-40447024 GACAACACTCTGGCCAATAAGGG - Intergenic
1178045668 21:28691435-28691457 GCCAACTCACTGGCCAAAAATGG - Intergenic
1178552529 21:33552769-33552791 GACTGCTCAGTGGGCAATGCTGG - Exonic
952936686 3:38404160-38404182 GACTCCTTAATGTCCAATACAGG + Intronic
953044127 3:39280390-39280412 GAGTACTCACTGGACCACACTGG + Intronic
955879660 3:63530066-63530088 GAATACTCACTGGCCCTCACAGG - Intronic
959204608 3:103289526-103289548 GACAACTCATTGGCTTATACTGG - Intergenic
963133797 3:141881910-141881932 GACTACTTCCTGGACAATCCAGG - Intronic
967492769 3:190112587-190112609 GACTACTAACAGGACAATGCAGG + Intronic
971754358 4:30688239-30688261 GACTACTTATTGGACAATGCAGG + Intergenic
977830612 4:101587713-101587735 GACTACTCACTGGCCAATACTGG - Intronic
981249901 4:142587179-142587201 TACTGCCCACTGGCCATTACAGG - Intronic
982005619 4:151060219-151060241 GACTACCCACTGTTCTATACTGG + Intergenic
985787277 5:1903778-1903800 AACTACTGAGTGGCCAACACAGG + Intergenic
990376419 5:55175114-55175136 AACTTTTCACTGGCCAAAACTGG + Intergenic
1002411377 5:179080119-179080141 GACTTCTCACTGGGGAATAAGGG + Exonic
1007298337 6:40845960-40845982 ATCTACTCACTGGGCGATACTGG - Intergenic
1008163847 6:48111187-48111209 GACTTCTCACTGGGCAAGTCTGG + Intergenic
1008427328 6:51374584-51374606 GAATACTTATTGGCCAATAAAGG + Intergenic
1013057685 6:106600231-106600253 GGCTACTCGCTGGCCCCTACTGG + Intronic
1016685951 6:146882525-146882547 TACTACTCACTGACCTCTACCGG + Intergenic
1017062832 6:150501414-150501436 GGCCACTCACTGGCCAATGGAGG + Intergenic
1021038943 7:15837355-15837377 GACTACACACTCACAAATACAGG + Intergenic
1033561331 7:142535197-142535219 GACTACACACTGGCCACTTGGGG + Intergenic
1042259125 8:66838631-66838653 GACTGCTCACTGGCAAAGAATGG + Intronic
1049677735 8:143899973-143899995 CATTCCTCATTGGCCAATACTGG + Intergenic
1051905209 9:22087021-22087043 GACTAGTAACTGACCAATAATGG - Intergenic
1199226826 X:145385691-145385713 GACTTCTCACCTCCCAATACAGG - Intergenic
1200281315 X:154779265-154779287 GACCTCTCACTGGTCAATAATGG - Exonic