ID: 977831468

View in Genome Browser
Species Human (GRCh38)
Location 4:101599054-101599076
Sequence GGCTGTCCCCTGCAAACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977831468 Original CRISPR GGCTGTCCCCTGCAAACTGG GGG Intronic
900453881 1:2764342-2764364 GGCTGTCACCTGCTCACTTGGGG - Intronic
900455327 1:2771604-2771626 GGCTGTCACCTGCTCACTTGGGG - Intronic
902374668 1:16024751-16024773 GGCTGTCCCCAGCACACCAGTGG + Exonic
905516228 1:38564050-38564072 GGCTGTTCCCTGCACACTCCTGG - Intergenic
911934945 1:103958855-103958877 CTCTGTCCTCTGCAAACTGGTGG + Intergenic
920515304 1:206580790-206580812 GGCTGGGCCCTGCATCCTGGTGG + Intronic
923846020 1:237733693-237733715 TGCTTTCCCCAGCAAACTGGAGG + Exonic
924508517 1:244709336-244709358 GTCTGTTCCCTGCACTCTGGGGG - Intergenic
1066242909 10:33555288-33555310 CACTGTCACCTGCAAAATGGTGG - Intergenic
1067851952 10:49760042-49760064 GGCTGTGCCCTGCCCTCTGGTGG - Intronic
1071431877 10:85612912-85612934 GGCTGGGCCCTGCAAGCAGGAGG + Intronic
1072703173 10:97659790-97659812 GGCTTTCCCCTGCAAGTTGCAGG + Intronic
1073144682 10:101272720-101272742 GTCTGCCCCCTGCAGACTTGGGG - Intergenic
1075640469 10:124060641-124060663 GGCTAACCTCTGCACACTGGAGG - Intronic
1077284970 11:1761596-1761618 GCCTGTCACCTGGAAACTGCTGG + Intronic
1077539401 11:3139504-3139526 GGCTTTCCCCAGCTCACTGGAGG - Intronic
1079084962 11:17438727-17438749 GGCTGTACCTTGCAAGATGGTGG - Intronic
1079656053 11:22987896-22987918 GGCTGTACCCTGCAAACCATGGG - Intergenic
1085366973 11:75957141-75957163 GACTATCTCCTGCAAACTTGGGG - Intronic
1086455375 11:86955137-86955159 GGCGCCCCCGTGCAAACTGGGGG - Exonic
1089758733 11:120707305-120707327 GGCTGTGCCTGGCAGACTGGCGG - Intronic
1089820471 11:121221225-121221247 GCTTGTCCCCTGCCAAGTGGAGG + Intergenic
1089968801 11:122675809-122675831 GATGGTCCGCTGCAAACTGGAGG - Intronic
1095976202 12:47942508-47942530 GGCTGCCCCCTGCAGGCGGGAGG - Intronic
1096870129 12:54587905-54587927 CCCTGTCCCCTCCTAACTGGGGG - Intronic
1098241455 12:68471376-68471398 GGTTGTCCTCTTCAAAGTGGAGG - Intergenic
1099818188 12:87675112-87675134 GGCTTTCCTCTGCACACTAGGGG - Intergenic
1100719845 12:97345971-97345993 GGCTTTCCACTTCAAACTGAGGG + Intergenic
1103008522 12:117439920-117439942 GGCTGTCCCCAGCCAGCTGGGGG - Intronic
1104025221 12:125021071-125021093 ACCTGTCCCCTGCAGACTGGAGG - Intronic
1104730769 12:131104178-131104200 GGCTGCCGCCTGCACACTGTGGG - Intronic
1105251687 13:18704421-18704443 GGATCTCTCCTGAAAACTGGTGG - Intergenic
1105402072 13:20104942-20104964 GGCTGTCCCCTGCACTCTCTGGG - Intergenic
1105456733 13:20547915-20547937 GGCTGTCACCTGTAGAATGGTGG - Intergenic
1106886907 13:34196693-34196715 GGCTGTCTTCTCCAAAGTGGAGG + Intergenic
1107250094 13:38349841-38349863 GGCGGTCCCCAGCACACTAGAGG + Exonic
1108358607 13:49650035-49650057 TGCTGTCCTAGGCAAACTGGTGG + Intergenic
1108724274 13:53163447-53163469 GGCTGTACCCTGCAAACCACTGG - Intergenic
1109876041 13:68405574-68405596 GGCTGTACCCTGCAAAATGTAGG - Intergenic
1109884019 13:68519202-68519224 GGCTGTCTCCTGCAAGGTGAAGG - Intergenic
1117062082 14:51973493-51973515 AGCTCTCCCCTGCAAAGGGGTGG + Intronic
1117282579 14:54255379-54255401 GGCTGTCCCCTGGATGCTGGCGG - Intergenic
1118160803 14:63288253-63288275 TGCTGTCAGCTGCACACTGGGGG + Intronic
1118206033 14:63724485-63724507 GCCTTTCCCCTAGAAACTGGGGG - Intronic
1118593135 14:67416288-67416310 GGCTGAGCCCTGCTACCTGGGGG + Intergenic
1118606147 14:67505358-67505380 GTCTGTCCCCTGCAACTGGGAGG + Intronic
1119216297 14:72871713-72871735 GGCTGTACCCTGCAAAGTGGAGG - Intronic
1122436258 14:101702361-101702383 GGCTGCACCCTGCAAAGGGGCGG + Intergenic
1126636286 15:50782947-50782969 GACTGTCCCAGGCAAAATGGAGG - Intergenic
1126942395 15:53780919-53780941 GGCTGTACTCTGCAAACTTCAGG - Intergenic
1129760886 15:78128806-78128828 CTCAGTCTCCTGCAAACTGGAGG - Intronic
1132085472 15:98905007-98905029 GTCTCTCAGCTGCAAACTGGGGG - Intronic
1132945740 16:2530700-2530722 GGCTGTTCCCTTCCAACAGGTGG - Exonic
1134749819 16:16617177-16617199 GAATGTCCCCAGCAAACTGGTGG - Intergenic
1134995654 16:18736438-18736460 GAATGTCCCCAGCAAACTGGTGG + Intergenic
1139743429 16:69055095-69055117 GCCTGTCTCCTGAAAGCTGGTGG - Intronic
1143242316 17:5454284-5454306 CTCTGTCCCAAGCAAACTGGAGG - Intronic
1143581928 17:7832847-7832869 GGCTGTCCACTGAAACCTGGGGG - Exonic
1144663499 17:17086860-17086882 GGATGTTCTCTGGAAACTGGAGG + Intronic
1147249625 17:39145256-39145278 GGCTGTACCCTGCATGCTGGGGG - Intronic
1147985733 17:44306984-44307006 GACTGCCCCTGGCAAACTGGAGG + Intergenic
1148070577 17:44906387-44906409 GACTGCCCCGTGCAGACTGGAGG - Intronic
1148245885 17:46030638-46030660 CCCACTCCCCTGCAAACTGGGGG - Exonic
1151299484 17:73212394-73212416 GGTTGTCCCCTGCTACCTGTAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1156449008 18:37256054-37256076 GTCCCTCCCCTGCAGACTGGAGG + Intronic
1158220618 18:55146721-55146743 AGCTGTCTCCTGCATTCTGGAGG + Intergenic
1160060483 18:75525032-75525054 GGCTGGCCCCTGCATGATGGTGG + Intergenic
1160239661 18:77113962-77113984 GGCTGGCTCCTGAAAACTGCCGG - Intronic
1160805273 19:989818-989840 TGCTGTCCCCTGTGAACTGAAGG - Exonic
1160835381 19:1122407-1122429 GACCGTGCCCTGCAAAGTGGGGG - Intronic
1160869289 19:1269652-1269674 GGCTGTGCCCAGCGAAATGGCGG + Intronic
1160909229 19:1467237-1467259 GCCGGTGCCCTGCAAAGTGGAGG - Exonic
1160957829 19:1701762-1701784 GGCTCTCGTCTGCAAAGTGGGGG + Intergenic
1161286524 19:3471270-3471292 CTCTGTCCCCTCCAGACTGGGGG + Intergenic
1163287144 19:16355891-16355913 GGCTGGGACCTGCAAGCTGGAGG + Intronic
1163433968 19:17284090-17284112 GGCTGTGCCCTGAAAACTCTGGG - Exonic
1165635153 19:37334200-37334222 CGGTGTCGCCTCCAAACTGGTGG + Intronic
1166843625 19:45713156-45713178 GGCTGCCCCCACCACACTGGTGG + Exonic
1167736507 19:51297504-51297526 AGCTTTCACCTGCAAAATGGGGG + Intergenic
926037718 2:9648288-9648310 GGCTGGGCCCTGCAACCAGGTGG + Intergenic
926170837 2:10551683-10551705 GGCTGTCGCATGCACAGTGGCGG - Intergenic
934874882 2:97908303-97908325 GGCAGACCCCTGGTAACTGGGGG + Intronic
937935644 2:127241899-127241921 GGCTGTACCCTGCAAAATCATGG - Intergenic
940851531 2:158691720-158691742 GGCTGTGCCCTGTACTCTGGGGG - Intergenic
942087569 2:172457739-172457761 GGCATCCCCCTTCAAACTGGGGG + Intronic
942978005 2:182042489-182042511 GGCTGCCCACTGAAAACAGGAGG + Intronic
944229493 2:197378552-197378574 GGCTGGCCCCGGTTAACTGGTGG - Intergenic
945435544 2:209813243-209813265 GGGTCTCCCCTTCAAACTCGTGG + Intronic
946662891 2:222019925-222019947 GTCTGGTCCCTGGAAACTGGAGG + Intergenic
947243466 2:228020910-228020932 TGCTTTCCCCTGAAAAATGGTGG - Intronic
1168799295 20:634115-634137 GGCTGACCCCTCCATTCTGGAGG - Intergenic
1170982976 20:21232140-21232162 GGGATTGCCCTGCAAACTGGGGG + Intronic
1171133684 20:22677915-22677937 GGCTGACCCATGAAAACTGAGGG + Intergenic
1172359220 20:34300715-34300737 TGCTGGCCCCTGAAAACTGTAGG - Intronic
1173879636 20:46402253-46402275 GGCAGTGTGCTGCAAACTGGGGG - Intronic
1175713782 20:61242008-61242030 TGCTGTCCCCTGCAGCCTGCAGG - Intergenic
1176837211 21:13804307-13804329 GGATCTCTCCTGAAAACTGGTGG - Intergenic
1179984376 21:44912816-44912838 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984388 21:44912851-44912873 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984400 21:44912886-44912908 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984412 21:44912921-44912943 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984424 21:44912956-44912978 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984436 21:44912991-44913013 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984448 21:44913026-44913048 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984460 21:44913061-44913083 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984472 21:44913096-44913118 GGCTGGACCCTGCACCCTGGGGG - Intronic
1179984484 21:44913131-44913153 GGCTGGACCCTGCACCCTGGGGG - Intronic
1182045807 22:27273372-27273394 GGTTGTCCCCTCCTAACTTGAGG + Intergenic
1183163841 22:36132619-36132641 GTCTCTCCCCTGGAAATTGGAGG + Intergenic
1183248486 22:36711648-36711670 GGCTGTCCCCAGCAATCCTGGGG - Intergenic
1183690346 22:39384591-39384613 GGCTGTCCTCTGCCAACAGAAGG - Exonic
1184689176 22:46109750-46109772 GGCTGGGCCCTGCAGACAGGCGG - Intronic
1184787083 22:46677107-46677129 GGCTGTGCCATGCTCACTGGTGG + Intronic
1184861031 22:47173422-47173444 GGGTGACCCCAGAAAACTGGAGG - Intronic
950156101 3:10722843-10722865 TGCTTTCCCAAGCAAACTGGAGG + Intergenic
951192565 3:19787026-19787048 GGCTGTACCCTGCAAACCACAGG + Intergenic
953616564 3:44495997-44496019 GGCTCTTCCCTGAAATCTGGGGG + Intergenic
953631563 3:44622429-44622451 GGCTGGCCACTGGCAACTGGTGG + Intronic
953969295 3:47334588-47334610 GGCTCTCCACTGCCAACTGCAGG - Intronic
954648273 3:52144449-52144471 GGCTGGCCCCTGCCACCTGGTGG + Intronic
961821783 3:129578969-129578991 GGGTGTCCCCTGGAGACCGGTGG - Intronic
962145403 3:132835116-132835138 GTCTGTCCCCTGCTAAATGCTGG + Intergenic
962332030 3:134486435-134486457 CGCTATGCCCTGCACACTGGCGG + Intronic
965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG + Intergenic
966024432 3:175258736-175258758 GTATGTCCCCTGCAATGTGGGGG + Intronic
968940183 4:3633625-3633647 GGCTGTCCCCTGCAGAGAGATGG + Intergenic
969591091 4:8122311-8122333 GGGTGTCCCCTGGGAAATGGAGG - Intronic
969869096 4:10093692-10093714 GGCTGACTCCTGAAAACTGGGGG - Intronic
970979232 4:22077416-22077438 GGCTGTCCCAGTCACACTGGGGG - Intergenic
972146804 4:36038031-36038053 GGATGTCTCCTGCTAAATGGTGG - Intronic
974260504 4:59518848-59518870 CCCTGTGCCCTGCAACCTGGAGG - Intergenic
977545111 4:98367592-98367614 GGCTATACCCTGCAAACAAGAGG + Intronic
977831468 4:101599054-101599076 GGCTGTCCCCTGCAAACTGGGGG + Intronic
979362969 4:119786145-119786167 GGCATTCCCCTGCCACCTGGTGG + Intergenic
982100102 4:151959201-151959223 GGCTTTCCCTTCCAAAGTGGTGG - Intergenic
983966469 4:173818938-173818960 ATCTGTCATCTGCAAACTGGAGG - Intergenic
985772624 5:1822441-1822463 GTCTGATACCTGCAAACTGGGGG - Intergenic
992317422 5:75571410-75571432 GGCTGTCCACTAAATACTGGGGG - Intronic
995459564 5:112388653-112388675 AGCTGTCCACTGCAAAGTTGGGG - Intronic
996098167 5:119420896-119420918 GGCTGTACCCTGCAAAGCTGGGG + Intergenic
998407596 5:141882891-141882913 AGCTGCCCCATGCAAACTGAGGG + Intergenic
1006164147 6:32054591-32054613 GGCTGTCCCCTGGGTACTTGTGG + Intronic
1007889352 6:45271825-45271847 GGCTGTACCCTGCAAACAGAGGG + Intronic
1012146701 6:95693243-95693265 GACTGTCCCCTGCAAAAGTGTGG + Intergenic
1016465953 6:144325658-144325680 GGGTGTCACCTACCAACTGGTGG - Intronic
1017382712 6:153848704-153848726 GGGTGCCCCCTGCAAGCAGGAGG + Intergenic
1018756354 6:166852885-166852907 GGCTGTGTCCTGCCAACTGATGG + Intronic
1019868596 7:3737156-3737178 GGCTGTGCCCTGCAGTCGGGTGG + Intronic
1020004502 7:4775206-4775228 GGCTATTCCTTGCAAACTGCTGG + Intronic
1022213778 7:28237648-28237670 CGCTGGCCACTGCAAAGTGGTGG + Intergenic
1022315629 7:29242412-29242434 GGCTGCCCTCTGCATACTGCTGG + Intronic
1022481241 7:30744390-30744412 GGGTGTGCACTGCAAACTGTAGG - Intronic
1023613603 7:41995954-41995976 GTCTGACCTCTGCTAACTGGTGG + Intronic
1026848408 7:73710281-73710303 GGCTGACCCTGGCCAACTGGCGG - Intronic
1027726270 7:81809976-81809998 GGCACTGCCCTGGAAACTGGCGG + Intergenic
1029494871 7:100891152-100891174 CGCTGGCCCCTGCATACCGGTGG + Exonic
1030231620 7:107213584-107213606 GGCTGGCCACTGCAATCAGGCGG - Intronic
1034398775 7:150847725-150847747 GGCTGGCCCCTCCATACTGAAGG - Intronic
1034552993 7:151832938-151832960 CACTGTCCCCTGAAAAGTGGGGG + Intronic
1038267879 8:26050185-26050207 GGCTTTCCCCTGCCGGCTGGCGG - Intergenic
1045351842 8:101348507-101348529 GGCTGTCCCTGGCAAAGTAGAGG - Intergenic
1047929583 8:129713440-129713462 GGCTGTCTTCTGCACTCTGGAGG - Intergenic
1048578231 8:135709647-135709669 TGCTGTCCCCGGGACACTGGGGG + Intergenic
1049109499 8:140634803-140634825 GGCTGTCGCCTGGAAAGGGGAGG - Intronic
1049724745 8:144140511-144140533 GGCTGGCCCCTGCTCACTGATGG + Exonic
1049988685 9:973302-973324 GTCTGTCCCCAGCCAACTGAGGG + Intergenic
1054450573 9:65401672-65401694 GGCTGTCCCCTGCAGAGAGATGG - Intergenic
1057212097 9:93205958-93205980 GGGTGTCCCCACCAAACTGGTGG - Intronic
1057365235 9:94414258-94414280 CCCTGTCCCCTCCAAACTTGTGG - Intronic
1057472777 9:95372584-95372606 GCCTGTCACCTGGAATCTGGTGG + Intergenic
1057658086 9:96973826-96973848 CCCTGTCCCCTCCAAACTTGTGG + Intronic
1060210530 9:121707435-121707457 GGCTGCCCACTGAAAAGTGGAGG - Intronic
1060967474 9:127720003-127720025 GGCTTTCTGCTGCCAACTGGGGG + Intronic
1062196127 9:135275204-135275226 GGCTGTCCCCTCCAAACCCTGGG - Intergenic
1062517987 9:136945627-136945649 GCCAGGTCCCTGCAAACTGGGGG - Exonic
1187278467 X:17837285-17837307 GGCTTGCACCTGCACACTGGTGG - Intronic
1187648211 X:21373672-21373694 GGCTGTCACCTGCCAGCTGCTGG - Intergenic
1189384638 X:40527341-40527363 GGCTATCCCCTGCAAAGTAAAGG - Intergenic
1189880571 X:45487242-45487264 GGCTGTGCCCAGCAAAGTGATGG + Intergenic
1190385749 X:49880769-49880791 GCCTGTACCCTGCTAAATGGCGG - Exonic
1190635198 X:52426200-52426222 GTCACTCCCCTGCAAACTGAGGG - Intergenic
1192194477 X:69019100-69019122 GGGTGGGCTCTGCAAACTGGTGG + Intergenic
1193312330 X:80023649-80023671 GGCTGTCCCATGCCAAAAGGTGG - Intronic
1193328298 X:80207514-80207536 GGCTGCCCCCTGCCAAATGGGGG - Intergenic
1193995617 X:88363672-88363694 GGCTGTTCCCTGCCTGCTGGGGG - Intergenic
1195035151 X:100965534-100965556 GGCTGTCCCCTGCAAAGCCATGG + Intergenic
1195309470 X:103616763-103616785 GGTTGTCTCCAGCAAACTAGTGG - Intronic
1195753551 X:108179611-108179633 GACTGTGCCCTGCGACCTGGAGG + Intronic
1196562950 X:117172954-117172976 GGATGCCCACTACAAACTGGGGG + Intergenic
1198224101 X:134629817-134629839 GGAATTCACCTGCAAACTGGAGG + Intronic
1200437190 Y:3165728-3165750 GGCTGAGCCCTGCAAAGTGACGG - Intergenic