ID: 977831837

View in Genome Browser
Species Human (GRCh38)
Location 4:101603359-101603381
Sequence ACATATATAAAATAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 466}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977831834_977831837 8 Left 977831834 4:101603328-101603350 CCATGTATATCAGTTACATACAT 0: 1
1: 0
2: 1
3: 14
4: 210
Right 977831837 4:101603359-101603381 ACATATATAAAATAGTTGGAGGG 0: 1
1: 0
2: 5
3: 61
4: 466
977831833_977831837 13 Left 977831833 4:101603323-101603345 CCTAACCATGTATATCAGTTACA 0: 1
1: 0
2: 1
3: 6
4: 124
Right 977831837 4:101603359-101603381 ACATATATAAAATAGTTGGAGGG 0: 1
1: 0
2: 5
3: 61
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977831837 Original CRISPR ACATATATAAAATAGTTGGA GGG Intronic
901035294 1:6332657-6332679 ATATATATAAAATAATTAGCTGG + Intronic
901054444 1:6442272-6442294 ACATTAAAAAAATAGTTGGCCGG + Intronic
901159864 1:7167546-7167568 ACATATATATAGTGGTAGGAGGG - Intronic
902479872 1:16706064-16706086 ACATTAAAAAAATAGTTGGCTGG - Intergenic
902871806 1:19318157-19318179 TCATCTATAAAATAGATGGATGG - Intronic
903118277 1:21196068-21196090 AAATAAATAAAAGAGTTGGCTGG + Intergenic
904777806 1:32922127-32922149 AAAAAAAAAAAATAGTTGGAAGG + Intergenic
906432620 1:45767490-45767512 ACAAAAATAAAATCCTTGGATGG + Intergenic
907165946 1:52411369-52411391 AAATAGATAAAATATTTGAAGGG + Intronic
907362868 1:53934419-53934441 AAATATTTAAAATAGCTAGAAGG - Intronic
907463566 1:54620546-54620568 ACATACAAAAATTAGCTGGATGG + Intronic
907697883 1:56752347-56752369 ACAATTATAAAACAGTTAGATGG - Intronic
908609574 1:65842325-65842347 TCATATATGAAAGAGTTGCATGG + Intronic
909179352 1:72401739-72401761 ACATTTATAAAATGGTTGGTGGG - Intergenic
909193338 1:72583336-72583358 ACATACATAAATTAGATGAAAGG - Intergenic
910036055 1:82790596-82790618 ATATATGTAAAATAGGTGAAGGG - Intergenic
910094339 1:83503452-83503474 ACAAATAGAAAATAGTTGAAAGG - Intergenic
910272588 1:85412698-85412720 GCATGTATAAAATATTTTGAGGG + Intronic
910828370 1:91433703-91433725 ACATAAATAAGATAGTTAGATGG + Intergenic
911260202 1:95676968-95676990 ACATTTAAAAATTAATTGGAAGG - Intergenic
911893234 1:103398972-103398994 GTATACATAAAATAGGTGGAAGG - Intergenic
912328606 1:108795112-108795134 AAATATATAATATATTAGGAGGG - Intronic
915636172 1:157188558-157188580 ACATATCTATATTAGTTGGATGG - Intergenic
915890267 1:159766985-159767007 ACATGTAGAAAATAGTAGAATGG - Intergenic
915963745 1:160288462-160288484 ATATATATAAAATTTCTGGAAGG + Intergenic
916190454 1:162172643-162172665 ACATATACCAAAGAGTTGGCTGG - Intronic
916200815 1:162270040-162270062 ATATATTAAAAATAGATGGAAGG + Intronic
916291572 1:163172429-163172451 ATATAGATAAAATAGTAGTAGGG - Intronic
916855223 1:168742164-168742186 ACATATGTAAAACACTTGAAAGG + Intergenic
917072621 1:171169050-171169072 GTATATATAAAATAGGTGAAGGG - Intergenic
917764219 1:178199477-178199499 ACATATATAAAAAAGTTCACAGG + Intronic
917887086 1:179397255-179397277 ACATATATAAAATTCTGGGTTGG + Intronic
918101528 1:181379929-181379951 ACATCTTTAAAGTAGTGGGAAGG + Intergenic
918230327 1:182524324-182524346 GCAGAGATAATATAGTTGGAAGG + Intronic
918375639 1:183906605-183906627 ACACATACAAAATAGTAGGAAGG + Intronic
918444252 1:184600839-184600861 GCATATTCAAAATATTTGGAAGG - Intronic
918969048 1:191389564-191389586 AAATATATAGAATAGTTGAATGG + Intergenic
919036645 1:192319294-192319316 TGATATAAAAAAAAGTTGGAAGG - Intronic
919134264 1:193488759-193488781 ACATGTATAAATTACTTTGAGGG + Intergenic
921395877 1:214668994-214669016 ACAAATATAAATTAGTTGTTTGG + Intergenic
921908518 1:220522427-220522449 ACATAGAAAAAATAATTTGAAGG + Intergenic
921952999 1:220953028-220953050 GCATTAATAAAATATTTGGAAGG + Intergenic
922034754 1:221837512-221837534 ACAAAGAAAATATAGTTGGAGGG - Intergenic
922140430 1:222879610-222879632 ACATAAATAAAAAAGATGTAAGG + Intronic
922146127 1:222946636-222946658 ACAGCTATAAACTAGTAGGAAGG + Intronic
922737155 1:227993038-227993060 ACATATATACAAATGTTGGCTGG + Intergenic
923282362 1:232456204-232456226 ACATATATAAAATAAATGGTGGG - Intronic
923647802 1:235841765-235841787 AGATATAGAAAACAGGTGGAAGG + Intronic
924026312 1:239836673-239836695 TCACATATAAGATAGGTGGAGGG + Intronic
1063618087 10:7619873-7619895 AACTATATAAAATAGAAGGAGGG + Intronic
1064470481 10:15630207-15630229 ACAAACATAAAATAGTTGACTGG + Intronic
1064671188 10:17715825-17715847 ACATATTTAAAATACTAGCAAGG - Exonic
1065058482 10:21872368-21872390 ACATATTTAAAATAGATGATTGG - Intronic
1065106542 10:22393703-22393725 ACAATAATAAAATATTTGGATGG - Intronic
1066682840 10:37951569-37951591 AGATATTTTAAATATTTGGAAGG - Exonic
1067315636 10:45158721-45158743 TCATATAAAAGATAGATGGAGGG + Intergenic
1067466883 10:46507220-46507242 ATATATATGTAATAGGTGGATGG + Intergenic
1067620303 10:47877385-47877407 ATATATATGTAATAGGTGGATGG - Intergenic
1068424504 10:56841700-56841722 ACAACTACAAAATAGTTCGAAGG + Intergenic
1068430896 10:56930992-56931014 ACATATATAAGATAGAGAGAGGG - Intergenic
1068857226 10:61810057-61810079 ACATTTTCAAAATAGTTGAAGGG - Intergenic
1068971244 10:62960767-62960789 AAATATAAAAATTAGTTGGGCGG + Intergenic
1069006976 10:63328335-63328357 ACATATATAAAAAATTTGAGAGG + Intronic
1069377092 10:67804190-67804212 ACACATCCAAACTAGTTGGATGG + Intronic
1069969606 10:72155116-72155138 ACATCTATAAAATCCCTGGAAGG + Intronic
1070896672 10:79988751-79988773 ACATAGATAAAATAAAGGGATGG + Intergenic
1071249843 10:83806456-83806478 ACAGAAATAAAGTATTTGGAAGG - Intergenic
1071702015 10:87949183-87949205 ACAAATATTAAAAAGTTGGGAGG - Intronic
1072761134 10:98057760-98057782 ACATATCTAAAATGCTTGGCAGG + Intergenic
1072909397 10:99486208-99486230 GCATATATAAAAAAGTTCTATGG + Intergenic
1074990756 10:118704588-118704610 ATATATGTAAAATAGGTGAAGGG - Intronic
1075692252 10:124405213-124405235 ACACATCTAAAGTAGTTGGCTGG + Intronic
1076192643 10:128493684-128493706 ACAAATATGAAATAGGTGGTTGG + Intergenic
1077573967 11:3364862-3364884 ACAGAAATAAAATAGCTGAATGG + Intronic
1078296131 11:10072040-10072062 GCATACAAAAAATATTTGGAAGG - Intronic
1078493773 11:11795727-11795749 ACATATGCAAAATATTTAGAAGG - Intergenic
1080031223 11:27663326-27663348 ACATCTATAAAATGCTAGGAAGG + Intronic
1081155097 11:39680417-39680439 ACATATGTAAAATAGGTGAAGGG + Intergenic
1081440443 11:43075325-43075347 ACATATATAAAACAATTACAAGG + Intergenic
1083039755 11:59674056-59674078 ATATATATAAAATACTTCTATGG - Intergenic
1084766777 11:71314986-71315008 ACATCTACAAAATAGTTGGCTGG + Intergenic
1086399975 11:86452735-86452757 ACTTATATAAAATAATAGGGAGG - Intronic
1086469023 11:87086713-87086735 GTATATGTAAAATAGGTGGAGGG + Intronic
1086665926 11:89482109-89482131 GCATGTTTAAAATAGTTGTAGGG + Intronic
1087163760 11:94977243-94977265 AAATTAATAACATAGTTGGATGG + Intronic
1087815045 11:102649001-102649023 AAATAAATAAAATAAGTGGAAGG - Intergenic
1089485849 11:118845542-118845564 ACAGATCTAAAAGAGGTGGAAGG - Intergenic
1091277091 11:134360014-134360036 ACATAAATAAACTACCTGGAAGG - Intronic
1091830605 12:3547687-3547709 AACTAAATAAAATAGTTGAATGG + Intronic
1092095020 12:5834430-5834452 AGATATATAAAGTACTTTGAGGG + Intronic
1092267101 12:6990013-6990035 AAATAAAAAAAATAGTTGGGTGG + Intronic
1092731177 12:11536311-11536333 AAAAATTTTAAATAGTTGGAAGG - Intergenic
1093216274 12:16365345-16365367 ACTAATATAAATTAGATGGATGG - Intronic
1093592365 12:20917896-20917918 TTATATCTAAAATAGTTGGAGGG + Intergenic
1093742651 12:22706088-22706110 ATAAATATAAAATAGTTGTGTGG - Intergenic
1093879733 12:24390197-24390219 ACGTGTGTAAAATAATTGGAAGG - Intergenic
1093903640 12:24663895-24663917 ACATATATTTTAGAGTTGGAAGG - Intergenic
1093947812 12:25130234-25130256 ACATATATAAAATATTTATATGG + Intronic
1093983805 12:25504968-25504990 ACATACATAAAATATTTACAAGG - Intronic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1095588661 12:43877665-43877687 ACATATATGTAATATTTTGAGGG + Intronic
1095589522 12:43888368-43888390 ATAATTATAAAATAGTTGTATGG - Intronic
1095799053 12:46252691-46252713 ATATATATATAATTGTTGTATGG + Intronic
1095850564 12:46799299-46799321 ACATATATAAAATATTTATTGGG + Intronic
1096175317 12:49511901-49511923 AGATATATAGAAAAGTTGAAAGG + Intronic
1096299644 12:50415586-50415608 ACATATAACAAAAAATTGGAAGG - Intronic
1096964697 12:55616772-55616794 GCATATATAAAATAGGTGAATGG - Intergenic
1097353808 12:58578482-58578504 ACATATATAACATATATGTATGG - Intronic
1097676770 12:62611498-62611520 ACATATATAAATAAGGTTGAAGG + Intergenic
1098013413 12:66078707-66078729 ACAAAAATAAAATAGTTGTCAGG - Intergenic
1098130994 12:67349512-67349534 ATATATATAAAAAGGTTGTAGGG - Intergenic
1098950477 12:76635644-76635666 AAATATATTAAAAAGTTGAAAGG + Intergenic
1099564275 12:84221462-84221484 ACATATATAAAATATTGACATGG + Intergenic
1100266401 12:92980443-92980465 ACTTATATAAAATTCTTGGTTGG - Intergenic
1100323249 12:93517120-93517142 ATATATATCAAATAGCTTGAAGG - Intergenic
1102401067 12:112630183-112630205 ATATTTATGAAATAATTGGATGG - Intronic
1102627424 12:114246597-114246619 CTATATATAAAATAGTTTGTGGG - Intergenic
1102792627 12:115659930-115659952 ACATATATAGAGTAGGTGAAGGG - Intergenic
1103295183 12:119880148-119880170 TCATCTATAAAATACTTGGTTGG - Intergenic
1105584730 13:21733438-21733460 AAATGAATAAAATAGATGGAAGG + Intergenic
1105799484 13:23891092-23891114 AAATATTTAAAATAGCTGCATGG - Exonic
1105849565 13:24321943-24321965 AAATATTTAAAATAGCTGCATGG + Exonic
1107177849 13:37420490-37420512 ACTTACAGGAAATAGTTGGATGG + Intergenic
1107605972 13:42057350-42057372 ACCTACATAAAATAGTGAGATGG - Intronic
1109059297 13:57593358-57593380 ATATATAGTAAATAGTTTGATGG + Intergenic
1109096037 13:58117781-58117803 AAATATATAAGATTGTTGTAGGG + Intergenic
1109105964 13:58251653-58251675 ACAAGTATAAAATACATGGATGG + Intergenic
1109379007 13:61534077-61534099 AGATATGTAAAATAATTGAAAGG + Intergenic
1109598548 13:64591923-64591945 AAATATATAAAATATATGGCAGG - Intergenic
1109997810 13:70152932-70152954 ACATTTATAAAATAATATGAAGG + Intergenic
1110227427 13:73134200-73134222 ATACATAGAAAAAAGTTGGATGG + Intergenic
1110822229 13:79929517-79929539 ACATTTATAGAAGAGTTGTAAGG - Intergenic
1111097892 13:83538650-83538672 ACATATGTAAAATAGGTGAAGGG - Intergenic
1111310014 13:86472201-86472223 ATATATGTAAAATAGGTGAAGGG + Intergenic
1111389032 13:87566905-87566927 ACATATACAAAATAAATAGATGG + Intergenic
1111981231 13:95017575-95017597 ACATAAATAAAATAATTTCAGGG - Intergenic
1113030068 13:105983235-105983257 ACATAGATAAAATAGGAAGATGG + Intergenic
1113358558 13:109606990-109607012 AAAAATATAAAAGAGTTGGGGGG - Intergenic
1114245365 14:20908470-20908492 ACAAATAAAAAAAAGTTGCACGG - Intergenic
1114377180 14:22159571-22159593 ACAAATATAAATTAGTTCAATGG + Intergenic
1114942965 14:27639002-27639024 CCATATTTAAAATAGTTTGGAGG - Intergenic
1115800283 14:36985918-36985940 AAAGATATAAAATAATTTGAAGG - Intronic
1116114033 14:40625285-40625307 GTATATATAAAATAGGTGAAGGG + Intergenic
1116307578 14:43277755-43277777 GCATATATAAAATGGGTGAAAGG + Intergenic
1118090994 14:62477826-62477848 ACACATATAAATTAATTGGATGG - Intergenic
1118281050 14:64428855-64428877 ACATTTATAAAATAGGTGGAAGG - Intronic
1118287883 14:64493517-64493539 ACATATAAAAAATATTAGCAAGG + Intronic
1118440684 14:65808867-65808889 GTATATGTAAAATAGTTGAAGGG + Intergenic
1119502099 14:75137864-75137886 ACATATAAAAATTAGCTGGGTGG - Intronic
1119933849 14:78572723-78572745 AAATGTAAAATATAGTTGGAAGG - Intronic
1120656253 14:87193589-87193611 ACATGAATAAGATAGATGGATGG + Intergenic
1121319573 14:92983334-92983356 ACATTTTTAAAATGTTTGGAGGG + Intronic
1121672270 14:95721296-95721318 ACATATAAAATGTAGTTGGAGGG - Intergenic
1121939164 14:98053146-98053168 ACAGATATAAAATAAGTGGTAGG - Intergenic
1122376456 14:101263350-101263372 ACTTAAAAAATATAGTTGGAGGG - Intergenic
1122481548 14:102050617-102050639 TCATTTTTAAAATATTTGGAAGG + Exonic
1122890617 14:104730614-104730636 ACATATATAAAATGCCTGGAGGG + Intronic
1123702896 15:22928757-22928779 AAATATATAAAATATTTGTGTGG - Intronic
1124047959 15:26168253-26168275 AAATATACAAAAGAGTTGGAAGG - Intergenic
1124456935 15:29851817-29851839 ACATATATGATATAGGTAGAAGG - Intronic
1126144980 15:45465690-45465712 AAATAAATAAAATAGATCGATGG + Intergenic
1126547791 15:49891481-49891503 AAATACAAAAAATAGCTGGACGG - Intronic
1128308058 15:66613017-66613039 TCATCTCTAAAATAGTTGTAGGG + Intronic
1129080720 15:73037702-73037724 ACCTATAGGAAATGGTTGGAGGG - Intergenic
1129504580 15:76070889-76070911 ACATCTGTAAAATAGTGGGAGGG - Intronic
1131276575 15:90986859-90986881 ACAACTAAAAAATAGTTGTAAGG + Intronic
1131623604 15:94094275-94094297 GCATATAAATAATAGTTGAAAGG + Intergenic
1132305062 15:100805639-100805661 ACATATAAAAATTTGTGGGATGG + Intergenic
1134247395 16:12549924-12549946 ACTTATAAAAAACAGGTGGAGGG - Intronic
1137039153 16:35593614-35593636 ACATAGAGAAAATAGATGGAAGG + Intergenic
1137288056 16:47032553-47032575 CCAAATATTAAATAGTTTGAGGG - Intergenic
1139047326 16:63077450-63077472 ACATATTTAATATAGTTAGTGGG + Intergenic
1139169933 16:64617554-64617576 AAAAATATTAAATAATTGGATGG + Intergenic
1139739810 16:69025540-69025562 GCATATGTAAAATAGGTGAAGGG + Intronic
1140673188 16:77299358-77299380 ACATATATAAAATAATTAAAAGG - Intronic
1142176769 16:88648918-88648940 AAAGAAATAAAATAGTAGGAAGG - Intronic
1143301944 17:5916977-5916999 ACATAAATAAAATAGGGAGAAGG - Intronic
1144471041 17:15541524-15541546 ACAGATATAAAAGAGTAGAATGG - Intronic
1144859489 17:18291869-18291891 AAATAGAAAAATTAGTTGGACGG - Intronic
1144925427 17:18803153-18803175 ACAGATATAAAAGAGTAGAATGG + Intronic
1145290322 17:21539695-21539717 ATATATAATAAATATTTGGAGGG - Intronic
1146384830 17:32360839-32360861 ACAAATATTAAAGAGTTAGAGGG - Intronic
1147480687 17:40759845-40759867 ACATCAAAAAAATAGATGGAGGG - Intergenic
1147505251 17:41009798-41009820 CCATTTATAACACAGTTGGATGG - Intronic
1148843281 17:50512914-50512936 ACATACAAAAAATAGTTGGGCGG + Intronic
1149576681 17:57718590-57718612 ACACCTAGAAAATAGGTGGAGGG + Intergenic
1150177880 17:63081474-63081496 GCATATATAAACCAGTTTGAAGG + Intronic
1150251615 17:63708036-63708058 AAATATAAAAATTAGTTGGGCGG - Intronic
1150726865 17:67658298-67658320 GCATATTTAAAATAGGTGAAGGG - Intronic
1151695006 17:75710392-75710414 ACAAATAAAAAATAATTGGCTGG + Intergenic
1153232338 18:2950872-2950894 ATATTTATAGAATAGTTGAAAGG + Intronic
1153319101 18:3753989-3754011 AAATAAATAAAATAGATGGGAGG - Intronic
1153651453 18:7244346-7244368 ATATATGTGAAATATTTGGAAGG + Intergenic
1154222318 18:12467120-12467142 AAATATAAAAATTAGCTGGATGG + Intronic
1155795353 18:30029178-30029200 AAATATAAAATATATTTGGAGGG + Intergenic
1156121375 18:33846764-33846786 ACATATTTTAAATAGTGGGGTGG - Intergenic
1157160929 18:45313683-45313705 ACATGTATTAACTAGTTTGATGG - Intronic
1159063018 18:63536838-63536860 ACATATATAAACTAATTAGATGG + Intergenic
1159401545 18:67942976-67942998 AAATACACAAAATACTTGGAGGG + Intergenic
1159683363 18:71384194-71384216 ACATATTTCCAATATTTGGAAGG - Intergenic
1159853636 18:73557690-73557712 ACATTTGCAAAATACTTGGAAGG - Intergenic
1160784817 19:895099-895121 AAATAAATAAAATAGCTGGGTGG + Intergenic
1164409491 19:27988704-27988726 ACACATTTAAAATAGTTGAATGG - Intergenic
1167672642 19:50862605-50862627 AAATATATAAAATAGGACGAAGG + Intronic
1167848826 19:52186511-52186533 ATATATATAAAATATTTGATGGG - Intergenic
1202713909 1_KI270714v1_random:31970-31992 ACATTAAAAAAATAGTTGGCTGG - Intergenic
927370108 2:22344700-22344722 ACAAATATAATATGGTAGGAAGG - Intergenic
927977740 2:27352223-27352245 TCACACATAAAAGAGTTGGATGG - Intronic
928354096 2:30592944-30592966 ATATATTTAAAATAGCTAGAAGG - Intronic
928417282 2:31106241-31106263 ACATATTTAAAATATTAGGAAGG - Intronic
929071410 2:38034777-38034799 ACAAATATAAAATATTTTAAAGG + Intronic
929764538 2:44833189-44833211 CCATAGATAACATATTTGGAGGG + Intergenic
930453360 2:51573105-51573127 AGATATATTAAATATTTGAATGG - Intergenic
930582342 2:53227438-53227460 AAATAGATAAAGTGGTTGGAAGG - Intergenic
930621474 2:53648507-53648529 ACAAATATAAAATACTGGGCTGG + Intronic
930693393 2:54387166-54387188 TCACATATAAAATAGCCGGAAGG + Intergenic
930932824 2:56908960-56908982 AAATATATAAAAGAAATGGAAGG + Intergenic
930944653 2:57059156-57059178 TCATTTATAAAATAGAGGGATGG - Intergenic
931113709 2:59141517-59141539 ACATATATAAAAAAGATGTATGG - Intergenic
932058535 2:68471362-68471384 AAATATATACTATGGTTGGATGG + Intronic
932869269 2:75380796-75380818 GCATATGTAAAATAGGTGAAGGG - Intergenic
933528004 2:83468369-83468391 CCATATAGAAAATAGATGGTGGG - Intergenic
934075473 2:88424782-88424804 ACGTATATAAAAAAGTTGCATGG - Intergenic
935474252 2:103498898-103498920 ACATATAAAACATGGTTGAATGG + Intergenic
935504953 2:103889118-103889140 ACATATATAAAGTGCTTGGAGGG - Intergenic
935741060 2:106148655-106148677 ATTTATATAATATAGCTGGATGG + Intronic
937374807 2:121328923-121328945 ACATATGTAAACTAGCTGGAGGG - Intergenic
939563406 2:143758294-143758316 ATATATATAAAATAGGTAGATGG + Intronic
939896103 2:147792935-147792957 ACATATCAAAACTAGTTGTAAGG + Intergenic
940363953 2:152825417-152825439 ATATTTATAAAATATTAGGATGG - Intergenic
940816357 2:158302073-158302095 ACATTTCTAAAGTAGTTGGGGGG + Intronic
941274123 2:163469369-163469391 AAATCTATAAAATATTTGAAGGG - Intergenic
941300371 2:163793921-163793943 GGATATATAAACTAGTTAGAGGG + Intergenic
941420632 2:165279570-165279592 TTATATATAAAATAGATGGATGG + Intronic
941447737 2:165623514-165623536 ACTGATATAAAATATATGGAAGG + Intronic
941473562 2:165920775-165920797 AAATATTTAAAATATTTTGAAGG + Intronic
942076813 2:172363624-172363646 ACATAAATAAAATAATTGGCTGG - Intergenic
942526627 2:176860125-176860147 ACATATATAATATTCTAGGAGGG + Intergenic
942913923 2:181279349-181279371 ACATGTATAAAATATTGGGGAGG + Intergenic
943241416 2:185389293-185389315 ACAAATAAAAAATAATTTGAGGG + Intergenic
943829611 2:192443465-192443487 ATATAGATAAAATATTTAGAAGG - Intergenic
945405739 2:209446629-209446651 ACATTATTAAAATAGGTGGAGGG + Intronic
945545432 2:211144716-211144738 GCATATGTAAAATAGGTGAAGGG - Intergenic
945560242 2:211330497-211330519 ATATATGTAAAATAGGTGAAGGG + Intergenic
945564134 2:211375419-211375441 AAATATATAAAATATTTTGTAGG - Intergenic
945771001 2:214042471-214042493 ACATGTATAAAATAGAGGTAAGG - Intronic
946469766 2:219947593-219947615 ACATATATATGATATTGGGAAGG + Intergenic
947088705 2:226485427-226485449 ATATATATAAAATATTTCAAAGG + Intergenic
947390966 2:229639240-229639262 AAACAAATAAAATGGTTGGAGGG - Intronic
947824441 2:233095165-233095187 ACATTAATAAAAAAGTTGCAGGG + Intronic
948972340 2:241438923-241438945 ACATATCTAAAAGAGTTGGCCGG - Intronic
1170492103 20:16887724-16887746 ACATATATAAAATTTTGAGACGG + Intergenic
1171198857 20:23225134-23225156 ACATATATGATTTGGTTGGAAGG - Intergenic
1171837005 20:30166512-30166534 TCATATAAAAACTAGATGGAAGG - Intergenic
1171941270 20:31332062-31332084 ATATAAATAAGATAGTTGAATGG + Intergenic
1173076238 20:39822412-39822434 ACATATATAAGGTTATTGGATGG + Intergenic
1173695758 20:45010363-45010385 ACATATAATAAATAATTGGGAGG - Intronic
1174468258 20:50734227-50734249 CCATTTAAAAAATATTTGGAAGG + Intronic
1174857793 20:54063583-54063605 ACCTATAGAAAATAGTGTGATGG + Intronic
1176383145 21:6123718-6123740 ATTTAAATAAAATATTTGGAAGG + Exonic
1176910886 21:14563796-14563818 ACAGGTATAAAATACTTGGAAGG + Intronic
1178170411 21:30033983-30034005 ATATATATAAAATAGGTGAAAGG + Intergenic
1178245135 21:30943202-30943224 ACATATATAAAATGGTATAATGG - Intergenic
1178467415 21:32860419-32860441 AGATATGTAAAATAGATGAAGGG + Intergenic
1179429724 21:41312269-41312291 ACATATATACAATCATTAGAGGG - Intronic
1179740322 21:43414521-43414543 ATTTAAATAAAATATTTGGAAGG - Exonic
1179775149 21:43657663-43657685 ACAGTTATAAAATCGATGGAGGG + Intronic
1181995738 22:26880627-26880649 ACTTATAAAAAATAATTGGTGGG + Intergenic
949720930 3:6989247-6989269 ACATACATAAAATATATGAAAGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950169309 3:10826661-10826683 ATATTTATAAACTAGATGGATGG + Intronic
950210909 3:11122295-11122317 ATTTGTATAAAATACTTGGATGG - Intergenic
950474383 3:13206201-13206223 ACATACATAAGATGGGTGGATGG - Intergenic
951415352 3:22416665-22416687 ACATTTTTAATATAGTTGAATGG + Intergenic
951924517 3:27893262-27893284 ACAAATATAAAATTCTTGGTTGG - Intergenic
952208975 3:31210027-31210049 GTATATATAAAATATTAGGATGG + Intergenic
952243934 3:31564268-31564290 TCATATATAAAATAGTTCAGAGG + Intronic
953726574 3:45404635-45404657 AGATATATGAAATAGTTCTAAGG + Intronic
954376326 3:50195845-50195867 ACATAAATAAATTAGTGGGGAGG + Exonic
956202838 3:66724431-66724453 ATATATATAAAATATATGTACGG - Intergenic
956308285 3:67850512-67850534 ATAAAAATAAAATAGTTGGCCGG - Intergenic
957498015 3:81015814-81015836 ACAAATATAAAAATGTTGCATGG + Intergenic
957578646 3:82041925-82041947 ACATTGAAAAAATAGATGGATGG + Intergenic
958107646 3:89098049-89098071 ATATATATAAAATCTTTGTAAGG - Intergenic
958494009 3:94818954-94818976 ACATATAGAAAATATTTGAATGG - Intergenic
958995329 3:100898048-100898070 ACATGCATCAAATGGTTGGATGG + Intronic
959280762 3:104335656-104335678 ACACATATAAAATATTCAGAAGG + Intergenic
959344808 3:105180326-105180348 TAATTTATAGAATAGTTGGAAGG + Intergenic
960426860 3:117519358-117519380 ACAATTATAAAATTGTTGGATGG + Intergenic
960470161 3:118054542-118054564 GCATATATTAAATACTTGAAAGG + Intergenic
960655465 3:119999046-119999068 ACATATATACAATGTTTGGCAGG + Intronic
961437538 3:126929864-126929886 GTTTATATAAAAGAGTTGGAAGG - Intronic
961989893 3:131177472-131177494 ACAGATATAGAATGGTTAGATGG + Intronic
962236080 3:133708617-133708639 ACATATATATATTAGTGGAAGGG - Intergenic
963595779 3:147322532-147322554 ACATAAATAGCATAATTGGAAGG + Intergenic
963621791 3:147618495-147618517 ACATAGACAAAATAGTTTGCAGG - Intergenic
963682520 3:148397224-148397246 ACATATATAAGGTGGATGGAGGG + Intergenic
963876163 3:150477720-150477742 ACATAAATAAAATAGTAAAATGG - Intergenic
963926221 3:150953812-150953834 ATATATATAAAGTACTTGGCCGG - Intronic
964027004 3:152086649-152086671 ACATATATAAAATAATTGAATGG - Intergenic
964982067 3:162697010-162697032 AGGTATATAAAATAGCTGGAAGG - Intergenic
965120317 3:164546193-164546215 ACATGTGTAAAATTGTTGCATGG - Intergenic
966175587 3:177134901-177134923 ACAGATATTTAATAATTGGAAGG - Intronic
966178308 3:177163664-177163686 ATATATATAAAATATCTGGAAGG + Intronic
967770294 3:193326876-193326898 AAATATATACAATAGTTGGCTGG - Intronic
970627478 4:17904425-17904447 AAATATACAAAATTGTTGTATGG + Intronic
970865057 4:20748549-20748571 ATATATATATAAAATTTGGAAGG - Intronic
972507831 4:39737589-39737611 ACATCTATAAATTATATGGAGGG + Intronic
973932585 4:55808056-55808078 ACTTATTTAAAAAAGTTGCAGGG - Intergenic
974167751 4:58225601-58225623 ACATGTATGAATTATTTGGAGGG - Intergenic
974456798 4:62139027-62139049 GCATATGTAAAATAGGTGAAGGG + Intergenic
974578958 4:63769498-63769520 ATATATATTAAATATGTGGACGG - Intergenic
975412048 4:74064761-74064783 ACAAATAAAAAATAGGAGGAGGG - Intergenic
976604205 4:86967465-86967487 ACATATTTAAAATAGTTTGATGG - Intronic
976692075 4:87879116-87879138 ACAAATATAGACCAGTTGGAAGG + Intergenic
976788619 4:88851539-88851561 GGAAATAAAAAATAGTTGGAAGG + Intronic
976990781 4:91362462-91362484 ACATATATAAACTAGTAAGGTGG - Intronic
977114141 4:93000607-93000629 TAATATATAAAATAGTTACAAGG - Intronic
977368737 4:96106806-96106828 TCAAATGTAAGATAGTTGGATGG - Intergenic
977831837 4:101603359-101603381 ACATATATAAAATAGTTGGAGGG + Intronic
979119639 4:116881292-116881314 ACATATTCAATATGGTTGGATGG + Intergenic
979815693 4:125100898-125100920 ACAAATAAAAAATATGTGGAAGG + Intergenic
980183526 4:129432699-129432721 ATATATATAACAAAGTTAGATGG - Intergenic
980324827 4:131328354-131328376 ACAGATAAAAAATAGCTGAAAGG - Intergenic
980400923 4:132284763-132284785 GTATATATAAAATAGGTGAAAGG - Intergenic
980678051 4:136116071-136116093 ACATCTATAAAATACTTTCATGG - Intergenic
981474920 4:145179255-145179277 ACAAATATAGAATATTTTGAAGG - Intronic
982155694 4:152518283-152518305 AAATAAATAAAATAGTAGGCTGG - Intronic
982607138 4:157528962-157528984 GCATATATGAAATAGGTGAATGG + Intergenic
982753590 4:159191810-159191832 AAATATAGATAATAGCTGGAAGG + Intronic
982772559 4:159410955-159410977 AAAAATATAAAATAAATGGAGGG + Intergenic
982885074 4:160768811-160768833 ACATATTTTAAATAACTGGAAGG - Intergenic
983438260 4:167745482-167745504 AGACATTTAAAGTAGTTGGATGG - Intergenic
983738687 4:171098535-171098557 ACATAAATAAAATATTTTTATGG + Intergenic
983983475 4:174028117-174028139 ACATAGATAAAACATTTGGATGG + Intergenic
984189543 4:176588892-176588914 ACATAGATAAAAGACATGGATGG + Intergenic
984435997 4:179710899-179710921 ACTTTTATAAAATAATTGGATGG + Intergenic
984863710 4:184262667-184262689 ATATATAGAAAAAAGCTGGAGGG + Intergenic
986371769 5:7087500-7087522 ATATATATAAAATAGGTGGAGGG - Intergenic
987021834 5:13881521-13881543 ACATATTTAAAACATTTGCATGG - Intronic
987486405 5:18532736-18532758 GCATATGTAAAATAGGTGAAGGG - Intergenic
987613162 5:20235045-20235067 ACATATTAAAAACAGTTGGATGG + Intronic
987661334 5:20881794-20881816 AGATATGTAAAATAGTTATACGG + Intergenic
987824425 5:23010525-23010547 AAATATAATAAATATTTGGATGG - Intergenic
987870001 5:23603871-23603893 ACATACATAAAATAAATGAAGGG - Intergenic
988092890 5:26566157-26566179 ACAAATTTAGAATAGTTGCAGGG + Intergenic
988252997 5:28784588-28784610 ACACAAATAAAATAGATGAAAGG + Intergenic
988664682 5:33312746-33312768 ATATATATAAAATTCTTGGCTGG + Intergenic
990101447 5:52194541-52194563 AGATTCATAAAATATTTGGAAGG - Intergenic
990182523 5:53177758-53177780 ATATATATAAAACAGTTTGTAGG + Intergenic
990771076 5:59246029-59246051 TTATATATAAAATATTTGTAAGG + Intronic
991082064 5:62612076-62612098 ATGTATATAAAATATTTGGAAGG - Intronic
992478020 5:77122659-77122681 ACATATATACAATATTTTGGAGG + Intergenic
992649277 5:78841863-78841885 ACATACTTAAGATAGTTGGAGGG - Intronic
992855724 5:80859425-80859447 ACATATTAAAAATATATGGAGGG - Intronic
993195232 5:84733658-84733680 ATATATATTTAATAGTTGCAGGG - Intergenic
993219252 5:85069706-85069728 ATATATGTAAAATAGGTGAAGGG - Intergenic
993253591 5:85558476-85558498 ATATATTTAAAATAGTTAGCTGG - Intergenic
993838709 5:92848591-92848613 TCATATATTTCATAGTTGGAGGG + Intergenic
993932597 5:93959132-93959154 ACAATTATATATTAGTTGGATGG + Intronic
994192790 5:96886982-96887004 ACATATAGAAAATATTTGGAAGG - Intronic
994403167 5:99308525-99308547 ACATTTATAAAATATTTAAAAGG + Intergenic
994922666 5:106069428-106069450 ACATATATAAATTTATTTGATGG + Intergenic
995320693 5:110830508-110830530 ATATATATAAAATAGGTGAAAGG - Intergenic
996341952 5:122448544-122448566 ATATATATAAAAAATATGGAAGG - Intronic
996390464 5:122955244-122955266 ACATATATAAAATCTCAGGAAGG - Intronic
997012889 5:129900153-129900175 ACATATTTGAAATAGTTAAAGGG + Intergenic
997111854 5:131083648-131083670 ACATTTCTAAAAAAGTGGGAAGG - Intergenic
997559321 5:134832085-134832107 AAATATATCAAATAGTGGCAGGG - Intronic
999660934 5:153862200-153862222 GCATATATAAAATTGGGGGAAGG - Intergenic
1000010232 5:157224472-157224494 TCATTTTTAAAATAGTTGCATGG + Intronic
1000057325 5:157618907-157618929 ATATATATAAAATAGGTGAAGGG + Intergenic
1000092904 5:157945808-157945830 AAATATATAAAAAAGAAGGAAGG - Intergenic
1000312796 5:160061605-160061627 ACATATATATAATACCTGGCAGG - Intronic
1000316583 5:160098077-160098099 ACAGCTATAAAATAATTGGCTGG - Intronic
1000599098 5:163250704-163250726 ACATGTAAAAAAAAGATGGAGGG + Intergenic
1000603115 5:163298507-163298529 AAAGATCTAAAATAGTTGCAGGG - Intergenic
1001779831 5:174358270-174358292 ACATCTACAAAATGTTTGGATGG + Intergenic
1003362779 6:5444680-5444702 CCATATATAAATTAGATGGATGG + Intronic
1003771804 6:9313128-9313150 ATCTATATTTAATAGTTGGAAGG - Intergenic
1004133132 6:12940336-12940358 ATATATATAACATGGTTGTAAGG + Intronic
1004878149 6:19977032-19977054 GGATATATAAAATTATTGGATGG - Intergenic
1005248115 6:23912074-23912096 ACAGACATTAAATAGTTGTACGG + Intergenic
1006103306 6:31700566-31700588 ACATATATAGAATTGTTGTAGGG + Intronic
1006226756 6:32544841-32544863 ACGTTTATAAATTAGTTTGATGG - Intergenic
1008624227 6:53301831-53301853 ACAATTATAATATAGTTGCATGG - Intronic
1009910580 6:69920843-69920865 ACATGTATAAAATGGAGGGAAGG + Intronic
1010447171 6:75961258-75961280 AAAGATATAAAGGAGTTGGATGG - Intronic
1010890307 6:81299991-81300013 ACTTATATAAAATAATTTTATGG + Intergenic
1010985107 6:82414640-82414662 ACAGAAATAAAGAAGTTGGAAGG - Intergenic
1011325003 6:86140956-86140978 ACATAAATAACAGAGTTGCATGG + Intergenic
1011846868 6:91575759-91575781 AAATATATAAAATATTTTAATGG - Intergenic
1012013022 6:93815702-93815724 ACATATATATAACTGTTGAATGG + Intergenic
1012180236 6:96143717-96143739 AAAAATATAAAATCGTTGGGTGG + Intronic
1012216673 6:96594122-96594144 ACTTATGTTAAATATTTGGAAGG + Intronic
1012863794 6:104593824-104593846 TCATATTCAAAATAATTGGAAGG + Intergenic
1013399549 6:109778934-109778956 GAATATTTAAAATATTTGGAAGG + Intronic
1014957990 6:127645292-127645314 GCCTATATAAAATAGTAGTAAGG + Intergenic
1015105011 6:129526316-129526338 ACTTTTATAACATAGTAGGATGG + Intergenic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1015247635 6:131092448-131092470 ATATATAAAAAAAAGATGGAAGG + Intergenic
1015352083 6:132232318-132232340 TCATTTATAAAATACTTGCATGG - Intergenic
1015676547 6:135756306-135756328 ACATACTTAACATACTTGGATGG + Intergenic
1015762140 6:136675014-136675036 ACATTTATTTAATATTTGGATGG - Intronic
1016171236 6:141019832-141019854 ACATATATTAAATTCTTAGAGGG + Intergenic
1016658743 6:146550708-146550730 ACATATATAAAATGTTTGGGGGG + Intronic
1017885028 6:158591843-158591865 ACATAGATACAAAAGATGGAAGG - Intronic
1018294704 6:162332898-162332920 TCATAGAAATAATAGTTGGAAGG - Intronic
1019745016 7:2694967-2694989 ATATATATAAAATAATAGGCCGG - Intronic
1020936311 7:14468949-14468971 AAATATTTAAAATATTTGCATGG + Intronic
1021015363 7:15525374-15525396 GTATATGTAAAATAGTTGAAGGG - Intronic
1021205808 7:17779324-17779346 ATATATATTAAAGAGTAGGAGGG + Intergenic
1021257403 7:18410124-18410146 AAATATATAATGTAGTTTGAAGG + Intronic
1021369717 7:19828522-19828544 AGATATATAAAATGATTGCACGG - Intergenic
1021380526 7:19960613-19960635 ACATATAAAAAATATTTATAAGG - Intergenic
1021830317 7:24600664-24600686 ACCTATAAAAAATAGTTAAATGG - Intronic
1021968772 7:25948055-25948077 ACAAATATAAAATAATCAGAAGG - Intergenic
1022133752 7:27428084-27428106 ACAAATGTAAAATATCTGGAGGG - Intergenic
1022376706 7:29820014-29820036 ATATAAATAAAATAATTGCAAGG - Intronic
1022888379 7:34669970-34669992 AAATATATAGAATACATGGAAGG + Intronic
1022980695 7:35602240-35602262 GTATATGTAAAATAGGTGGAAGG + Intergenic
1023329029 7:39093615-39093637 AGAAATACAAAATATTTGGAAGG - Intronic
1023535609 7:41206014-41206036 ACATATGTAACATATTTTGATGG - Intergenic
1023963855 7:44950879-44950901 ATATGTATAAAAGAGTTGAAAGG - Intergenic
1024386483 7:48757718-48757740 GCAAATAGAAAATATTTGGAAGG - Intergenic
1024958683 7:54952452-54952474 ACATATATAATATATGTGTATGG + Intergenic
1027473946 7:78606822-78606844 ACATAAAGAAAATTGTGGGAGGG - Intronic
1027632310 7:80621961-80621983 GTATATATAAAATAGGTGAAGGG - Intronic
1027652543 7:80887924-80887946 ACATAAAGAATATAGCTGGAAGG + Intronic
1028771708 7:94632076-94632098 AAATATATATAATACTTAGAGGG + Intronic
1028804834 7:95012967-95012989 ACATATACAAAAAAAATGGAAGG - Intronic
1028999640 7:97139481-97139503 ATATATGTAAAATAGGTGAAGGG + Intronic
1029119869 7:98260400-98260422 ACATTTATAAAATTATTTGAAGG - Intronic
1029936591 7:104431669-104431691 ACATGTATAAAATAATTTGTTGG + Intronic
1029990355 7:104957634-104957656 TCATGTATGAAATAGTAGGATGG - Intergenic
1030350003 7:108473986-108474008 ATATATATAAAATAATAGGCTGG - Intronic
1030418651 7:109278888-109278910 AATTATATAAAATTGTTAGAAGG - Intergenic
1030704908 7:112682384-112682406 ACATAAATAAATTAGATGGTTGG + Intergenic
1030764019 7:113386562-113386584 AAATACATAGAATATTTGGAGGG - Intergenic
1030914273 7:115293368-115293390 ATATATATTAAATAGTTAAAAGG + Intergenic
1031663100 7:124451856-124451878 ACATATATACAGTAGAGGGAGGG + Intergenic
1031667392 7:124501642-124501664 ACATATAAATATTAGGTGGAGGG + Intergenic
1031683724 7:124707131-124707153 AAAGATATAGAATAGATGGACGG - Intergenic
1031699809 7:124910089-124910111 ACACATATAAAAAACCTGGAAGG + Intronic
1031781639 7:125975255-125975277 AAATATATAACATAGTTACAAGG + Intergenic
1031820988 7:126501350-126501372 TCAAACAAAAAATAGTTGGAAGG + Intronic
1032353737 7:131190036-131190058 ACATATATAAAATACCTGGTGGG + Intronic
1032727463 7:134604179-134604201 ACCTATATCAAATATTTGGAGGG - Intergenic
1032831753 7:135634272-135634294 ATATACATAGAATAGTTAGATGG + Intronic
1033074430 7:138235153-138235175 AGATATATAAATTTTTTGGAGGG + Intergenic
1033995321 7:147338818-147338840 AGATATATAAAAAGTTTGGAAGG + Intronic
1035426030 7:158774363-158774385 ATAAATATAAAATATTAGGAAGG + Intronic
1037593859 8:20337298-20337320 ACATATATAAAATAAATACATGG + Intergenic
1037687163 8:21150687-21150709 ACATATAAAAATTAGTAGCATGG + Intergenic
1038517347 8:28198410-28198432 ATATATATATATTACTTGGAAGG + Intergenic
1039609466 8:38907805-38907827 ACATACATAAAATAAGTGGCTGG - Intronic
1039614074 8:38940900-38940922 ATATATATAAAATATTTGAAAGG + Intronic
1041817099 8:61985966-61985988 TCATATATAGAATATTTGAAAGG + Intergenic
1042299074 8:67256639-67256661 ACATTTATAAATTATTTGCAAGG - Intronic
1042703732 8:71644562-71644584 AAATATATGAAATACTTAGATGG + Intergenic
1043405335 8:79926626-79926648 ACATATATAAAATAAATGACAGG + Intronic
1043542003 8:81274755-81274777 TCCTATTTGAAATAGTTGGAAGG + Intergenic
1043576688 8:81667030-81667052 ACCTACATAAAAGAGTTGCAAGG + Intronic
1043627217 8:82276328-82276350 ATATATATTAAATTGTTGGCTGG + Intergenic
1044208074 8:89515754-89515776 ATATATAAAAGGTAGTTGGAAGG - Intergenic
1044305506 8:90636234-90636256 ACAAAAATAAAATAGTTTGGAGG - Intronic
1044428157 8:92078150-92078172 TCATATATAAAATAGTTAAGTGG - Intronic
1045031017 8:98136231-98136253 AAATACAAAAAATAGTTGGGTGG - Intronic
1046155564 8:110285668-110285690 AAATAAATAAAATAGTTTCAAGG - Intergenic
1046254369 8:111676879-111676901 ACATATAGAAAATGGATGTAAGG - Intergenic
1046280373 8:112021158-112021180 ATAAAAATAAAATAGTTGTATGG + Intergenic
1046397754 8:113661988-113662010 AAATTTATAAAATAGGTGGATGG + Intergenic
1046497064 8:115027641-115027663 ACATAAATAAAATAGTGAAAAGG - Intergenic
1046697185 8:117355365-117355387 ACATATAGAAAATAGTTTGGTGG + Intergenic
1047960304 8:130006799-130006821 ACATATAGAAAATGGGTGGGGGG + Intronic
1048180658 8:132191526-132191548 ATATATATATAATATATGGATGG + Intronic
1048528585 8:135227228-135227250 ACACATATTAAATAGATGGCAGG - Intergenic
1049092421 8:140526120-140526142 ATACATTTAAAATAGTTGCATGG - Intergenic
1051997122 9:23231181-23231203 ATATATAAATAATAGTTGAAAGG - Intergenic
1052166923 9:25341608-25341630 AAAGATATAAACTAGCTGGATGG + Intergenic
1052295257 9:26890647-26890669 ACATATACATAAAAGTTGGCCGG + Intronic
1052347927 9:27428687-27428709 GCATATCTAAAATGGCTGGATGG + Intronic
1052460034 9:28751119-28751141 ACATATATAAAAATGTTAGCTGG + Intergenic
1052573391 9:30259061-30259083 TCATATTTAAAATAGTTGAGTGG - Intergenic
1052914349 9:33912930-33912952 ACAAATAAAAAAGAGGTGGAGGG - Intronic
1053357905 9:37462472-37462494 ATATATGTAAAATAGGTGAAGGG - Intronic
1054746082 9:68855276-68855298 ACATTTAGAAAATAGATGGAAGG - Intronic
1054843223 9:69764820-69764842 ATATATATAAAATAGATGGGGGG + Intergenic
1055200854 9:73659930-73659952 AAATATATGAAATAGCTGCAAGG + Intergenic
1055451185 9:76432844-76432866 GTATATATAAAATAGGTGAAGGG - Intronic
1056084132 9:83128375-83128397 ATATATATGAAATAGGTGAAGGG - Intergenic
1056739297 9:89239691-89239713 AAAGATATAAAATATTTGAAGGG - Intergenic
1056952215 9:91050175-91050197 AAAGATATAAAATAGCTGAATGG + Intergenic
1060490106 9:124077707-124077729 ACATCTCTAAGAAAGTTGGATGG + Intergenic
1060752821 9:126184945-126184967 AAATATATTTAACAGTTGGAGGG + Intergenic
1061078630 9:128356644-128356666 ACATATAAAAATTAGCTGGCTGG + Intronic
1061552658 9:131346887-131346909 ATATTTATAAAATGGATGGATGG + Intergenic
1185498463 X:578053-578075 ACACATAAACAATAGATGGATGG + Intergenic
1185630016 X:1509363-1509385 AGATAGATAGAATAGATGGATGG - Intronic
1185780542 X:2840661-2840683 ACATATATATGATAGGTAGATGG + Intronic
1185813831 X:3135579-3135601 ACATAGATGAAATTGATGGATGG + Intergenic
1185859958 X:3568613-3568635 ACATATATTCAATAGGTAGATGG - Intergenic
1186308077 X:8286695-8286717 ACAAATATAAGATGGATGGATGG - Intergenic
1187109369 X:16280586-16280608 ACATCCATGAATTAGTTGGATGG + Intergenic
1187950769 X:24467961-24467983 GCATAAACAAAATAGATGGATGG + Intronic
1188649584 X:32615272-32615294 AGATATAGAAAATAGTGGGCTGG + Intronic
1188676952 X:32952975-32952997 AAATACAAAAAATAGTTGGGTGG + Intronic
1188844322 X:35054715-35054737 TCATTTATAAAATAGTGGCAAGG - Intergenic
1189606934 X:42688780-42688802 ACATATTTAAAATAGATATATGG - Intergenic
1191611826 X:63124073-63124095 AAATATATAAAGTGGTTGAAGGG + Intergenic
1192776106 X:74246938-74246960 AAATATATATAATAGTAGCAAGG + Intergenic
1192776920 X:74254903-74254925 ACAGAGAGAAAATAGTTGGGGGG + Intergenic
1192838897 X:74833525-74833547 AAAGATATAAAATAGCTGAATGG - Intronic
1193330444 X:80230127-80230149 ATATATGTAAAATAGGTGAAAGG - Intergenic
1194101794 X:89715446-89715468 ACATGTATATCATAGTTTGATGG + Intergenic
1194799606 X:98255432-98255454 ACATATATAAAATGCCTGAAAGG + Intergenic
1194864255 X:99046987-99047009 GCATATAAAAAATAGGTAGAGGG - Intergenic
1195485050 X:105395005-105395027 ACACATATAAAATAATTAGAAGG - Intronic
1196889230 X:120276287-120276309 ACAAATAGAAAAGATTTGGAAGG + Intronic
1196988468 X:121300967-121300989 ACATCTATAAAAAAGTGGCATGG - Intergenic
1197043538 X:121969651-121969673 ACACATAGAAAATAGTAGGAAGG + Intergenic
1197154451 X:123255031-123255053 ACATATATAATATGGTTTCAAGG + Intronic
1197231893 X:124014335-124014357 ACATATATATAAAGGATGGAAGG - Intronic
1197395882 X:125926669-125926691 ACATATATATAGTACTTTGAAGG + Intergenic
1197433455 X:126395363-126395385 AAATATAAACATTAGTTGGATGG + Intergenic
1197560909 X:128020501-128020523 ATATATTTAAAATATTTGTATGG + Intergenic
1198012265 X:132569397-132569419 ATATAAATAAAATCTTTGGAGGG - Intergenic
1198669238 X:139060890-139060912 AGAAATATAGAATAGTTGGAAGG - Intronic
1199015073 X:142805408-142805430 ACATACAAAAAATAGAGGGAGGG - Intergenic
1200580809 Y:4948179-4948201 ACACATACAAAATAGATGTAAGG - Intergenic
1200596694 Y:5150332-5150354 TAATATATCAAATAGTTAGAAGG - Intronic
1200832564 Y:7701432-7701454 ACATATATATATTATTTGAAGGG - Intergenic
1202579491 Y:26364753-26364775 CCTTATATAAAATTATTGGAGGG - Intergenic