ID: 977840661

View in Genome Browser
Species Human (GRCh38)
Location 4:101699755-101699777
Sequence ATAGCCAGAAAAGCCACTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977840661_977840664 6 Left 977840661 4:101699755-101699777 CCCTTAGTGGCTTTTCTGGCTAT 0: 1
1: 0
2: 0
3: 8
4: 160
Right 977840664 4:101699784-101699806 AGTCCTTACATCTACCTATCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
977840661_977840667 20 Left 977840661 4:101699755-101699777 CCCTTAGTGGCTTTTCTGGCTAT 0: 1
1: 0
2: 0
3: 8
4: 160
Right 977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977840661 Original CRISPR ATAGCCAGAAAAGCCACTAA GGG (reversed) Intronic
901909431 1:12443804-12443826 ATTGCCATAAGAGCCACAAAAGG - Intronic
902664112 1:17925560-17925582 CTCGCCAGAAAAGCCAGTCAGGG - Intergenic
906723702 1:48028074-48028096 TTAACTAGAAAAGGCACTAAGGG - Intergenic
915680872 1:157581074-157581096 AGACCCAGAAAAGCCCCTGAGGG + Intronic
917106944 1:171501923-171501945 ATGGCAAGAAAAGCCACTGGAGG - Intronic
919989376 1:202698494-202698516 AGAGCCACAAAAGCCACAGAAGG + Intronic
921255232 1:213332861-213332883 ATGGTTAGAAAAGCCACTGAGGG - Intergenic
921788076 1:219256850-219256872 ATAGCCAGAAAATTCCCAAAAGG - Intergenic
1063038230 10:2310390-2310412 ATAACCAGAAAAGACAGGAAAGG + Intergenic
1065794392 10:29292485-29292507 AAAGCCAGAAACGCCAGCAAAGG - Intronic
1065948165 10:30626275-30626297 AAAGCCAGAAACGCCAGCAAAGG + Intronic
1068264824 10:54632941-54632963 ATAGCCTGAATTCCCACTAATGG + Intronic
1072334896 10:94389230-94389252 AAAGCGAGAAAAGCCCCTTATGG + Intergenic
1073915907 10:108403216-108403238 ATTGCCTGAAAAGCCTGTAAAGG + Intergenic
1074032184 10:109700040-109700062 AGAGCCAGATAAGGGACTAAAGG + Intergenic
1080584673 11:33670802-33670824 ATAGTCACAGAAGCCACAAAAGG + Exonic
1081217038 11:40413725-40413747 AAAGCCAGAAAAGCCCAGAATGG + Intronic
1081226196 11:40525525-40525547 ATACCTAGAAAAGCATCTAATGG + Intronic
1082309914 11:50633843-50633865 ATAGCCAGAATTGCCATTACTGG + Intergenic
1082845306 11:57720197-57720219 AGAGCCCCAAAAGTCACTAATGG + Intronic
1085069598 11:73531290-73531312 ATAACCAGAAATATCACTAATGG + Intronic
1086202953 11:84225558-84225580 ATAGCAAGAGAGTCCACTAAAGG - Intronic
1088058358 11:105611691-105611713 ATAGCAAGAAAAGCCAAGGATGG - Intronic
1088648328 11:111936048-111936070 TTAGCCAGAAAAGTCAGTAATGG - Intronic
1090301192 11:125641060-125641082 ATAACCAAAACAGCTACTAAGGG - Intronic
1092140143 12:6178202-6178224 ATAGCCAGCACACCCACTTAAGG + Intergenic
1095132962 12:38565404-38565426 ACAGCCAGAAAAGACAAGAATGG + Intergenic
1097174039 12:57132592-57132614 ACAGCCAGAAAAGCCAGGAAGGG - Intronic
1097407899 12:59213846-59213868 ATAGGCAGAAAAGCTAATATAGG - Intergenic
1099848980 12:88067001-88067023 ATGGCAAAAAAAGCCACTGAAGG + Intronic
1100551610 12:95651087-95651109 AGAGCCAGAAAAGCTACAGAAGG - Intergenic
1100700437 12:97141760-97141782 ATAGGCAGAAATGCCTCAAAAGG - Intergenic
1105495109 13:20923605-20923627 AGAGCCAGAAGAGCTGCTAAGGG - Intergenic
1105749248 13:23407069-23407091 AAAGCCAGGACAGCCACTAGAGG + Intronic
1106062192 13:26304505-26304527 ATCTCTAGAAAAACCACTAAAGG - Intronic
1108688343 13:52840104-52840126 AAAGGCAGGAAAGCCAATAAAGG + Intergenic
1109297235 13:60549105-60549127 ATAGCTTGAAAAGACACTCAAGG + Intronic
1113036415 13:106054220-106054242 ATAAACAGAAATGTCACTAATGG + Intergenic
1114051385 14:18921614-18921636 AAAGCCAGAAAAGCCTAGAATGG - Intergenic
1114111176 14:19480311-19480333 AAAGCCAGAAAAGCCTAGAATGG + Intergenic
1114235940 14:20823908-20823930 AAAGCAAGAGAAGCCACTTACGG - Intergenic
1115834484 14:37383856-37383878 ACAGCAACAAAAGCCAGTAAAGG - Intronic
1118913385 14:70080527-70080549 ATTGCTAGAGAAGCCACTTAAGG - Intronic
1119607606 14:76034283-76034305 ATACCAAGAAAAGACACTTAAGG - Intronic
1120153076 14:81059310-81059332 AAAGCCAGAAAAGAAATTAAAGG + Intronic
1124174548 15:27410999-27411021 ATGCCCAGAAAAGGCACAAATGG - Intronic
1125710522 15:41781867-41781889 AAGACCAGAAGAGCCACTAAAGG - Intronic
1126581498 15:50246438-50246460 ATAGGCAGAAAAGCTTCTAGTGG + Intronic
1132966099 16:2655495-2655517 AAAGTCAGAAGGGCCACTAAGGG + Intergenic
1144057125 17:11553334-11553356 AGAGCCAGAAAAGGCACGCAAGG + Intronic
1149118789 17:53135067-53135089 GCAGCCAGAAAAGGCACAAAGGG - Intergenic
1150285954 17:63954314-63954336 AAAGGCAGAAAAGCCTCTAGGGG - Intronic
1150446721 17:65232124-65232146 ATAGCCAGGAGAGCCACATAAGG - Intergenic
1154374502 18:13797933-13797955 ATAGCAGAAAAAGCCAGTAAGGG - Intergenic
1155288856 18:24320652-24320674 ATAGGATGAAAAGCCACTGAAGG + Intronic
1159841190 18:73401115-73401137 ATTACCACAAAAGCCTCTAAAGG + Intergenic
929104820 2:38354586-38354608 ATAGCTTAAAAAGCCAATAAGGG + Intronic
929341339 2:40822375-40822397 ATATACAGAAAAGCCAATAAAGG - Intergenic
930844207 2:55884096-55884118 ACAGCCAGAGAAGCCATAAATGG - Intronic
932955200 2:76343852-76343874 AAAGGAAGAAAAGCCAATAAAGG - Intergenic
937085121 2:119166529-119166551 ATAGAGAGAAAAGCCGCTCAGGG - Intergenic
938287071 2:130127851-130127873 AAAGCCAGAAAAGCCTAGAATGG + Intronic
938313542 2:130310960-130310982 AGAGCCAGAAAAGGCATTGAGGG - Intergenic
938428522 2:131211019-131211041 AAAGCCAGAAAAGCCTAGAATGG - Intronic
938469424 2:131545037-131545059 AAAGCCAGAAAAGCCTAGAATGG - Intergenic
938625766 2:133107242-133107264 ATAACCTAAAAAGCCACCAATGG + Intronic
938729460 2:134135153-134135175 ATTGACAGAAAAGACAATAAAGG - Intronic
939126771 2:138186967-138186989 ATAAATAGAAAAGCCACTCATGG - Intergenic
939253348 2:139711909-139711931 ACAGCAAGAAAACCCACTTAGGG - Intergenic
939328062 2:140721108-140721130 ATAGCCAGAAGAGATCCTAAAGG - Intronic
939861560 2:147427289-147427311 ACAGCCAGAAAAAAGACTAAGGG - Intergenic
945289833 2:208116149-208116171 AAAGCGAGAAAAGCCCCTTATGG + Intergenic
945679044 2:212890880-212890902 ATAGTCAGAAAAGGCAATAATGG + Intergenic
945833958 2:214816998-214817020 ATAGTGAGAAAAGTAACTAAAGG - Intergenic
1171096195 20:22334534-22334556 CTAGCCAGAAAAGCCAGTCTAGG + Intergenic
1171355333 20:24540859-24540881 AAAGCCAGAAAAGACACCATAGG - Intronic
1173721025 20:45258318-45258340 ATAGCCAGATAATCAACTATTGG + Intergenic
1175042332 20:56065670-56065692 ATAGACATAAAAGCCAATGAAGG + Intergenic
1175401146 20:58700766-58700788 TAAGCAAGAAAACCCACTAAGGG - Intronic
1176885745 21:14253762-14253784 ATACCTTGAAAAGCCACTAGAGG + Intergenic
1178631993 21:34269529-34269551 ATAGAGAGAAAAGTCACCAAAGG - Intergenic
1182686428 22:32123885-32123907 AAAGCCAGAAAAGCCTAGAACGG - Intergenic
950942544 3:16908074-16908096 AGAGACAGAAAACCCACGAAAGG - Intronic
950958258 3:17078204-17078226 ATAACCGAAACAGCCACTAAAGG - Intronic
951428378 3:22576642-22576664 ATAAAAAGAAAAGACACTAATGG + Intergenic
951625052 3:24651172-24651194 ATAGCCAGAAAAATGAATAATGG - Intergenic
952474300 3:33690815-33690837 ATAACCAAAACAGCTACTAAGGG - Intronic
952833456 3:37584854-37584876 ATAGCCAACATAGCCACTAAGGG - Intronic
955348993 3:58180305-58180327 AAGGCCAGAAAAGCAACTCAGGG + Intergenic
960313909 3:116152228-116152250 ATAGACAGAAAACACACTGAGGG + Intronic
962631702 3:137282906-137282928 CTTTCCAGAAAAGCCACCAAAGG - Intergenic
965740915 3:171873663-171873685 ATAACCAGAACACCCAATAATGG + Intronic
966163841 3:176994965-176994987 ATGCCCAGAGAAGCTACTAATGG + Intergenic
969084089 4:4642311-4642333 AGAGCCAGAGAAGCCAGAAAAGG + Intergenic
972960212 4:44445952-44445974 ATGGTCAGAAAAGCCACCCAAGG - Intronic
977840661 4:101699755-101699777 ATAGCCAGAAAAGCCACTAAGGG - Intronic
978076668 4:104539636-104539658 ATAGCAAGAAAGCACACTAATGG + Intergenic
978783861 4:112586743-112586765 ATAGCAAGAATAGCTACGAATGG + Intronic
978878953 4:113676991-113677013 CTAGCCAGAAAAAACCCTAAAGG + Intronic
978960121 4:114667108-114667130 AGAGTCAGAAAAGCCACTTGTGG + Intronic
981678812 4:147370568-147370590 TGAGCCAGAGAAGCCAATAAGGG + Intergenic
982213176 4:153057594-153057616 GTTGCCACAAAAGCCCCTAAAGG + Intergenic
982422868 4:155218324-155218346 ATAGCTAGAAAAGCCATTGCAGG + Intergenic
984595436 4:181662078-181662100 ATAGCCAGAGAAGCAAAGAATGG + Intergenic
987003441 5:13684991-13685013 AGAACCAGAAAAGCCCCTCAGGG + Intergenic
990978929 5:61584375-61584397 AGAGACAGATAAGCCACTTAGGG + Intergenic
991643803 5:68780393-68780415 ATTGCCTGAAACACCACTAATGG + Intergenic
991696379 5:69277171-69277193 ATAGCCAAAAAGGCAAATAATGG + Exonic
993659004 5:90607241-90607263 TTATACAGAATAGCCACTAAAGG + Intronic
994163464 5:96583095-96583117 ACAGCCATAAAAACCATTAAAGG - Intronic
994493713 5:100482841-100482863 ATTGCCAGTTAAGCCAATAAAGG + Intergenic
994540267 5:101086175-101086197 CTAGCAAGAAAAGCCTCTAATGG + Intergenic
997170638 5:131716235-131716257 ATAGCCAAAAGAACTACTAAGGG + Intronic
998854997 5:146386108-146386130 ATAGCCACAAAAACAACTAGTGG + Intergenic
999714435 5:154348577-154348599 ACACCTAGAAAAGTCACTAATGG - Intronic
1000420740 5:161035326-161035348 ATAGCCAGAAAAGCCTATTCAGG + Intergenic
1001201310 5:169719819-169719841 ATAGCCAGGTCAGCCACTTATGG + Intronic
1002336009 5:178478756-178478778 GTAGCCAGGAAAGACACTGATGG + Intronic
1003106083 6:3217104-3217126 ATAGCCAGAGTGGCCACTGAGGG - Intergenic
1003432491 6:6052887-6052909 GGAGCCAGAAAACCCCCTAAGGG - Intergenic
1004024767 6:11807611-11807633 ATGGCCAGAAAGGCCCCAAATGG + Intergenic
1012059110 6:94454989-94455011 AGAACCACAAAAGACACTAATGG - Intergenic
1012613287 6:101243132-101243154 ATTGCCAAAAAAGCTACTATAGG + Intergenic
1013738802 6:113259433-113259455 AGAGCCAGAAAACCCACCACGGG - Intergenic
1017160982 6:151365929-151365951 TTATCCAGAAAAGCCACTGGAGG - Exonic
1018217772 6:161547043-161547065 CTACCCAGCAAAGCCACTCACGG + Intronic
1020604069 7:10313268-10313290 ATTACCAGAAAAGCCACTTTAGG + Intergenic
1021254173 7:18369592-18369614 ATAGTTAGAAATTCCACTAAAGG - Intronic
1022874974 7:34519370-34519392 ACAGCCATAAAAACCATTAAAGG - Intergenic
1023350146 7:39312486-39312508 CTAACCAGTAAAGCCACTACAGG + Intronic
1024042086 7:45563717-45563739 ACAGCCAGGAAACCCACTTATGG - Intergenic
1025607460 7:63049654-63049676 ATAATCAGAAGAGGCACTAAAGG + Intergenic
1025764734 7:64432806-64432828 ATAGACAGAAAATAAACTAATGG - Intergenic
1027878493 7:83801842-83801864 ATGGCCAGAGAAGCCATGAAGGG + Intergenic
1028890346 7:95980236-95980258 ATTTGCAGAAAAGCCATTAATGG - Intronic
1031488448 7:122358405-122358427 AGAGAAAGAAAAGCCACAAATGG - Intronic
1031684072 7:124710379-124710401 ATTGCCCCATAAGCCACTAAAGG + Intergenic
1033468534 7:141621331-141621353 ACAGCCAGAAGAGTAACTAAAGG - Intronic
1033502942 7:141971985-141972007 ATAGCCAGAAAGCCCACACAGGG + Intronic
1033678305 7:143566907-143566929 AAAGCAAAAAAGGCCACTAAAGG + Intergenic
1033693536 7:143762542-143762564 AAAGCAAAAAAGGCCACTAAAGG - Intergenic
1034870907 7:154683122-154683144 CTGGCCATAAAAGCCATTAAAGG - Intronic
1035846265 8:2868183-2868205 ACAGACAAAAAAGCCACTTATGG + Intergenic
1037471802 8:19217810-19217832 ATTGCCAGAAAAGGAACTGAAGG - Intergenic
1038106909 8:24445602-24445624 ATAGCCAGGAAAACCATTTAAGG - Intronic
1038861341 8:31392130-31392152 AGAGAGAGAAAAGCCAATAAGGG + Intergenic
1040541570 8:48361892-48361914 ATAGCAAGAAAGGACACAAAGGG - Intergenic
1041515562 8:58695483-58695505 AAAGCAAGAAAAGCCCCTTATGG + Intergenic
1043936575 8:86149230-86149252 ATAGGCAGAGGAGCCCCTAAAGG + Intronic
1046751518 8:117931785-117931807 ATAGCCTTAAAAGTCACTCAAGG + Intronic
1046798848 8:118402519-118402541 CTAGCCAGAAAAGCCCCTTATGG + Intronic
1052054633 9:23890431-23890453 AAAGCCAGAAAACTCTCTAAGGG - Intergenic
1052826887 9:33183243-33183265 ATAACCAAAACAGCTACTAATGG - Intergenic
1053814298 9:41889861-41889883 GTTGTCAGAACAGCCACTAACGG - Intergenic
1054616298 9:67297579-67297601 GTTGTCAGAACAGCCACTAACGG + Intergenic
1055836050 9:80443298-80443320 TTACCCAGAAACCCCACTAAAGG - Intergenic
1057519453 9:95749982-95750004 GCAGCCATAAAACCCACTAAAGG - Intergenic
1058180927 9:101797829-101797851 ACATCCAGAAAACCCACTGATGG - Intergenic
1060157440 9:121329424-121329446 GTTGCCAGAAAAGTCTCTAAGGG + Intronic
1185855329 X:3529339-3529361 GTAGTAAGAAATGCCACTAAAGG - Intergenic
1187696869 X:21931281-21931303 AAAGCCATAAAAGCCATTATTGG - Intergenic
1188128695 X:26403231-26403253 ATAGCTTGAAAAACCAATAATGG + Intergenic
1189111085 X:38289767-38289789 ATAGCAAGAACAGCCAGAAACGG - Intronic
1191690314 X:63932637-63932659 CTAGCCAGAAATGCCCCAAAAGG - Intergenic
1192897722 X:75461062-75461084 ATAGCCAGAATAGCCACTTTAGG + Intronic
1194124600 X:89999895-89999917 ATGAGAAGAAAAGCCACTAAAGG - Intergenic
1198744745 X:139878309-139878331 GTAGCCAGAAAAGCCCACAAAGG + Intronic
1198894271 X:141434154-141434176 ATAAATGGAAAAGCCACTAAAGG - Intergenic
1199016403 X:142820632-142820654 AAAGTCAGAAAAGACACAAAGGG - Intergenic