ID: 977840662

View in Genome Browser
Species Human (GRCh38)
Location 4:101699756-101699778
Sequence TATAGCCAGAAAAGCCACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977840662_977840664 5 Left 977840662 4:101699756-101699778 CCTTAGTGGCTTTTCTGGCTATA 0: 1
1: 0
2: 0
3: 9
4: 214
Right 977840664 4:101699784-101699806 AGTCCTTACATCTACCTATCAGG 0: 1
1: 0
2: 0
3: 3
4: 92
977840662_977840667 19 Left 977840662 4:101699756-101699778 CCTTAGTGGCTTTTCTGGCTATA 0: 1
1: 0
2: 0
3: 9
4: 214
Right 977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977840662 Original CRISPR TATAGCCAGAAAAGCCACTA AGG (reversed) Intronic
901945657 1:12701605-12701627 TGTAGCCATAAAAGCCATAAAGG + Intergenic
902664113 1:17925561-17925583 TCTCGCCAGAAAAGCCAGTCAGG - Intergenic
903276020 1:22222367-22222389 TCTAGCCGGAAAAGCCTCTCTGG - Intergenic
906992653 1:50755432-50755454 TATACCCTGCAAAGCCACAAGGG - Intronic
907890986 1:58636229-58636251 TATACCCTGCAAAGCCACAAGGG + Intergenic
907974764 1:59421080-59421102 TCTAGCCTAAAAAGCCACTTAGG + Intronic
908141908 1:61193805-61193827 TATTTCCAGGAAAGGCACTAAGG - Intronic
908699367 1:66881379-66881401 TATACCCTGAAAAGCCACAGGGG + Intronic
908818182 1:68055572-68055594 TATAACCAGAAAAGTTACTGTGG + Intergenic
909058008 1:70845425-70845447 TATACCCTGCAAAGCCACTGAGG + Intergenic
909760425 1:79279355-79279377 TAATTCAAGAAAAGCCACTAAGG + Intergenic
916033648 1:160901640-160901662 GGTAGCCAGAAAAGGCACAAAGG - Intergenic
916094451 1:161336603-161336625 CATAACCAGAAAAGCAAATAAGG - Intronic
919188710 1:194188121-194188143 CATAGTCAGAAAAGCGACAATGG + Intergenic
919400567 1:197111552-197111574 TTGATCCAGAAAACCCACTACGG + Intronic
921775725 1:219097395-219097417 TATAACCTGCAAAGCCACAAGGG + Intergenic
922321668 1:224494068-224494090 TTTAGCCTTAAAAGCCACCAGGG + Intronic
1068452608 10:57211746-57211768 TATACCCTGCAAAGCCACTGGGG - Intergenic
1068600948 10:58955803-58955825 TACAGCCAGAAAATCCATAATGG - Intergenic
1068627601 10:59266075-59266097 TCTAGCCAGAACAGCAACTGAGG - Intronic
1069339924 10:67398214-67398236 TATACCCTGAAAAGCCACATGGG + Intronic
1071190829 10:83097841-83097863 TATAACCATAAAAGCAACAAAGG + Intergenic
1071873392 10:89818714-89818736 TATAACCTGCAAAGCCACGAGGG - Intergenic
1072608842 10:97003631-97003653 TCTAGCCTGCAAAGCCTCTAAGG + Intronic
1073675532 10:105643126-105643148 TATAGACAGAGAAGCCCCAAGGG - Intergenic
1073817504 10:107224038-107224060 TATAGCCTGCAAAGCCACAGGGG - Intergenic
1075354204 10:121756280-121756302 TATACCCTGAAAAGCCACAGGGG - Intronic
1076313934 10:129527612-129527634 TATAGCCAGAGCAGACTCTATGG + Intronic
1079916250 11:26371610-26371632 TATATCCTGCAAAGCCACAAGGG + Intronic
1080065172 11:28002557-28002579 TGTACCCTGAAAAGCCACAAGGG + Intergenic
1080380529 11:31767279-31767301 TGTAGCCAGAAGAGCCACTCTGG - Intronic
1080817489 11:35772473-35772495 TATACCCTGCAAAGCCACAAGGG + Intronic
1080845201 11:36020886-36020908 TGGAGCCAGGAAAGCCAGTAAGG + Intronic
1085182818 11:74550353-74550375 TATAGACAGAGAAGCCCCAAGGG - Intronic
1087699023 11:101414316-101414338 TCTAGCAAGAAAATCCAGTAGGG - Intergenic
1092296862 12:7207813-7207835 TCTAGCCAGAAATGAGACTATGG - Intronic
1092443778 12:8534091-8534113 TGTAGCCAGAAAGGCCACACCGG + Exonic
1094311310 12:29086832-29086854 AACAGCCAGAAAAGCCACAGGGG + Intergenic
1094785727 12:33846476-33846498 TATACCCTGCAAAGCCACAAGGG - Intergenic
1095303526 12:40614415-40614437 TCTAGGCAGAGAAGCCACTCAGG - Intergenic
1095454480 12:42368135-42368157 TATATACAGAAAGGCCTCTAAGG - Intronic
1095981321 12:47976343-47976365 TATGGCCAGAAAAGCGCCTGAGG - Intronic
1097174040 12:57132593-57132615 GACAGCCAGAAAAGCCAGGAAGG - Intronic
1098525624 12:71483406-71483428 GAAAGCCAGAAATGCCACGAAGG + Intronic
1099015085 12:77335009-77335031 TATAGGCAGAAAAGCCTTTATGG - Intergenic
1099781029 12:87195434-87195456 TATATACAGAAAAGAAACTATGG - Intergenic
1100958731 12:99938715-99938737 TATTGCCAAAATAGCCAGTATGG + Intronic
1102832429 12:116016645-116016667 TTTAGTCAGAAAAGTCTCTATGG - Intronic
1106719721 13:32426057-32426079 TAGAGCCAGAAAGGACCCTAAGG + Intronic
1107519583 13:41166564-41166586 TATATACAGAAAAGACACTGAGG - Intergenic
1107724099 13:43280277-43280299 TACAGCTAGAAAAACCCCTATGG + Intronic
1110377919 13:74814842-74814864 TATACCCTGCAAAGCCACAAGGG + Intergenic
1111313194 13:86517000-86517022 TATAGCCTGCAAAGCCACAAGGG - Intergenic
1111338926 13:86858162-86858184 TATTGCCAGAAAACCAACTGAGG - Intergenic
1111733889 13:92112786-92112808 TATAGGTTGAAAAGCCAGTAGGG + Intronic
1111770057 13:92585246-92585268 TATACCCAGCAAAGCCACAGGGG + Intronic
1114798084 14:25739731-25739753 TATACCCAGCAAAGCCACAGGGG - Intergenic
1115929809 14:38478347-38478369 TATACCCTGGAAAGCCACAAGGG + Intergenic
1117693119 14:58329534-58329556 TATAGCAAGAAAGGACATTAAGG + Exonic
1120105877 14:80493820-80493842 TATAGCAGGAGAAGCCAATAGGG + Intronic
1120131402 14:80811603-80811625 TATAGGCAGAAGAGAGACTAGGG + Intronic
1124001156 15:25761532-25761554 TGTACCCAGCAAAGCCACAAGGG + Intronic
1124062429 15:26306500-26306522 TATACCCTGCAAAGCCACAAGGG + Intergenic
1124234171 15:27972537-27972559 TACAGCCAGAATGGCCATTATGG - Intronic
1125054454 15:35341242-35341264 GATAGCCAGAATAGCCATTCTGG - Intronic
1125265055 15:37869305-37869327 TATATCCAGAAAATTCATTATGG + Intergenic
1126980105 15:54231679-54231701 TGTAGACAGAAAACTCACTAAGG - Intronic
1130416968 15:83702973-83702995 CATACCCTGAAAAGCCACAAGGG + Intronic
1132966098 16:2655494-2655516 TAAAGTCAGAAGGGCCACTAAGG + Intergenic
1135904018 16:26493794-26493816 AATGGCAAGAAAAGCTACTATGG - Intergenic
1138067101 16:53953746-53953768 TATAGCCACAGAAGCCATGAGGG + Intronic
1140996490 16:80264857-80264879 TATAGTCATCACAGCCACTACGG + Intergenic
1141234127 16:82199743-82199765 TAGAGCCAGTGAAGCCATTAGGG + Intergenic
1143320397 17:6064851-6064873 TCTAGCCAGAAAAGGAACTCAGG + Intronic
1146073414 17:29705117-29705139 TATAGGAAGGAAAGACACTAAGG - Intronic
1147757751 17:42780037-42780059 TATAGCAAAAACAGCCACTCTGG + Intergenic
1148103548 17:45107323-45107345 TAGAGCCAGCAACTCCACTAAGG + Exonic
1149109935 17:53016731-53016753 TATTGACAGAGAAGTCACTAAGG - Intergenic
1150285955 17:63954315-63954337 CAAAGGCAGAAAAGCCTCTAGGG - Intronic
1151086573 17:71387693-71387715 TATAGCCTGCAAAGCCACAGAGG - Intergenic
1151417569 17:73976452-73976474 TACAGCTAGAAGAGCCCCTAGGG - Intergenic
1155675699 18:28426088-28426110 TATACCCAGCAAAGCCACAGGGG + Intergenic
1156557868 18:38087947-38087969 TATGGCCAGAAAATTCTCTAGGG - Intergenic
1161221029 19:3118232-3118254 TATAACGAGAAAAGGCACTTTGG - Intronic
1165248462 19:34512074-34512096 TAGAGCCAGAAAAACAAGTAAGG - Exonic
1167415568 19:49369649-49369671 CAAAGCCAGAAAAGCCACTCTGG - Intronic
1167950626 19:53024327-53024349 TAAAGTCAGAAATGACACTAAGG - Intergenic
925476229 2:4219144-4219166 TAAAGTCAGAAAAGCTACAAAGG - Intergenic
925805096 2:7640956-7640978 TGTACCCTGAAAAGCCACAAGGG - Intergenic
928400749 2:30977074-30977096 AAAAGACAGAAAAGCCAATATGG - Intronic
929104819 2:38354585-38354607 TATAGCTTAAAAAGCCAATAAGG + Intronic
930253271 2:49060243-49060265 TATAAACAGTAAAGCCACTATGG + Intronic
930310317 2:49731956-49731978 TATACCCTGCAAAGCCACAAGGG - Intergenic
930351489 2:50261328-50261350 TATAACAAGGAAAGCCTCTAAGG + Intronic
931426178 2:62173755-62173777 GATATCCAGGAAAGCCACGAAGG + Intergenic
933007019 2:77007566-77007588 TATAGACAGCAAAAGCACTATGG - Intronic
933102878 2:78282445-78282467 TGTACCCAGAAAAGCTACTGGGG + Intergenic
938059293 2:128239643-128239665 TATAGTCAGGAAGCCCACTAGGG - Intronic
938313543 2:130310961-130310983 TAGAGCCAGAAAAGGCATTGAGG - Intergenic
939464841 2:142544042-142544064 TGTATCTAGAAAATCCACTACGG - Intergenic
939861561 2:147427290-147427312 TACAGCCAGAAAAAAGACTAAGG - Intergenic
940270267 2:151882626-151882648 TAGAACCAGAAGAGTCACTAGGG - Intronic
940543632 2:155054808-155054830 TGTAGCCAGAAGACCCACTTGGG - Intergenic
941142753 2:161805720-161805742 TATATCCTGCAAAGCCACGAGGG - Intronic
941439439 2:165514881-165514903 TAAGGCCAGTGAAGCCACTAGGG - Intronic
943092990 2:183396048-183396070 TATACCCTGAAAAGCCACAGGGG + Intergenic
943415034 2:187591166-187591188 TGTATCCTGAAAAGCCACAAGGG - Intergenic
943733007 2:191322912-191322934 TATAGACAGAGAAGCCCCAAGGG + Intronic
945851203 2:215009551-215009573 TATAGTCAGTAAAGCAAATAAGG + Intronic
1170822252 20:19764634-19764656 TCTATGCAGAAGAGCCACTAAGG - Intergenic
1172397258 20:34617337-34617359 TATACCCTGCAAAGCCACAAGGG + Intronic
1175401147 20:58700767-58700789 TTAAGCAAGAAAACCCACTAAGG - Intronic
1177165133 21:17592811-17592833 TAAAGCTAGAAAAGTCTCTAAGG + Intronic
1177260426 21:18722859-18722881 TATAGTTAGAAAAGCCAGTGTGG + Intergenic
1177717350 21:24856091-24856113 TATAGGAAGAAGAGACACTAGGG - Intergenic
1177808508 21:25899891-25899913 TATAGACATAAAAGGCACAATGG + Intronic
1179235253 21:39540091-39540113 TATAGCCTGCAAAGCCACAGGGG - Intergenic
1180645251 22:17333359-17333381 TATAGCGACAAAAGCCCCTAGGG - Intergenic
1181901107 22:26156479-26156501 TAAAGCCAGACCAGGCACTATGG - Intergenic
949362058 3:3242658-3242680 GAAAACCAGAAAACCCACTAGGG - Intergenic
950963412 3:17129036-17129058 TATACCCTGAAAAGCCACAGGGG + Intergenic
952334170 3:32391032-32391054 TATAGCCAGAAAAGAGATGAGGG + Intergenic
952833457 3:37584855-37584877 AATAGCCAACATAGCCACTAAGG - Intronic
953097085 3:39788772-39788794 TGTAGCCAGAAAATGGACTATGG + Intergenic
954651332 3:52165347-52165369 TACAGCCAATAAAGCCCCTAAGG + Intergenic
954932306 3:54294846-54294868 TAAAGCAAGAGAAGCCACTAAGG - Intronic
954934329 3:54313022-54313044 TGTAGCCAGAAATGCCAAGAGGG + Intronic
956069988 3:65438536-65438558 TTTAGCTAGAAAAGAGACTAAGG + Intronic
957843056 3:85695774-85695796 TCTATCCAGAAATCCCACTACGG - Intronic
957981784 3:87519959-87519981 TGTACCCTGCAAAGCCACTAGGG + Intergenic
958789688 3:98637055-98637077 TCTAGACAGAAAAGCAACAAAGG + Intergenic
959500549 3:107101857-107101879 TAAAGCCAGAAGACCCACTTTGG + Intergenic
960503456 3:118465197-118465219 TAGAGCAAGGAAAGCAACTAGGG - Intergenic
960564353 3:119117999-119118021 TATACCCTGGAAAGCCACAAGGG - Intronic
963072776 3:141318740-141318762 TATACCCTGCAAAGCCACTGGGG - Intergenic
963433682 3:145241596-145241618 TATACCCTGAAAAGCCACAGGGG - Intergenic
966035964 3:175415049-175415071 TATAGACAGAAAAGTCAAAAGGG - Intronic
967883602 3:194318389-194318411 TAGACCCAGAAAAGCCACAGGGG - Intergenic
971632314 4:29009391-29009413 TAGAGCCAGAAAAGGCCCTGAGG + Intergenic
972966117 4:44512481-44512503 TATAGGCAGAAATCCTACTAGGG - Intergenic
973183003 4:47291599-47291621 TATACCCAGCAAAGCCACAGAGG + Intronic
974525728 4:63047750-63047772 TATACCCAGCAAAGCCACTGAGG - Intergenic
974724233 4:65777963-65777985 TATACCCTGCAAAGCCACAAGGG + Intergenic
976129017 4:81864677-81864699 TTTAGAAAGAAAATCCACTAAGG + Intronic
977383609 4:96308830-96308852 TGTACCCTGAAAAGCCACAAGGG + Intergenic
977731191 4:100354078-100354100 TAGATCCAGCAAAGCCACAATGG - Intergenic
977840662 4:101699756-101699778 TATAGCCAGAAAAGCCACTAAGG - Intronic
978369412 4:108015585-108015607 TATTTCAAGAAAAGCCAATATGG + Intronic
981678811 4:147370567-147370589 TTGAGCCAGAGAAGCCAATAAGG + Intergenic
984936248 4:184891819-184891841 TATAGCCACAAAAATCACTCAGG + Intergenic
985875063 5:2587952-2587974 CAGAGCCAGAATATCCACTATGG - Intergenic
987661465 5:20883822-20883844 TAATGCAAGAAAAGCCACTGAGG + Intergenic
987664894 5:20924453-20924475 GGTAGCCAGAGAAGCTACTAGGG + Intergenic
987757740 5:22118841-22118863 TCTAGTCAGAAAAGCAATTAGGG - Intronic
988396360 5:30701415-30701437 TGTATCCAGAAAAGCCACAGAGG + Intergenic
988757791 5:34277713-34277735 GGTAGCCAGAGAAGCTACTAGGG - Intergenic
990417258 5:55598328-55598350 TATAGCCATAACAGACATTATGG - Intergenic
990484956 5:56249089-56249111 TACAGCCCGAAAAGCCAGTGTGG + Intergenic
990859272 5:60308565-60308587 TAGAGCCAGAAACCCCACGAAGG + Intronic
992131357 5:73695959-73695981 CATATCCAGGAATGCCACTAAGG + Intronic
992203957 5:74411806-74411828 TAAAGTCAGAAAAGTCACTTGGG - Intergenic
993162943 5:84313372-84313394 TACAGCAAGAAAAGAGACTATGG + Intronic
993499666 5:88651132-88651154 TCTAGCCACCAAAGCCACTATGG + Intergenic
997204011 5:132030909-132030931 GATAACCAGAAAAACCAATAAGG + Intergenic
997774433 5:136588020-136588042 TAAAGCTAGTACAGCCACTATGG + Intergenic
998870223 5:146544402-146544424 AATAGCCACACAAGCCACAATGG + Intergenic
999601648 5:153272694-153272716 TTTAGCAAGAAAGACCACTAAGG - Intergenic
1003432492 6:6052888-6052910 TGGAGCCAGAAAACCCCCTAAGG - Intergenic
1009532907 6:64843407-64843429 TATACCCTGAAAAGCCACAGGGG + Intronic
1010981668 6:82376314-82376336 TATACCCTGAAAAGCCACAGGGG - Intergenic
1011849088 6:91603599-91603621 TATACCCTGCAAAGCCACAAAGG - Intergenic
1012612864 6:101237082-101237104 TATTGCCAGAAAATCTACCAAGG + Intergenic
1013738803 6:113259434-113259456 GAGAGCCAGAAAACCCACCACGG - Intergenic
1016179488 6:141126594-141126616 TATAGCCAAAAAAGCAATTGAGG + Intergenic
1020576415 7:9935964-9935986 TATAACTAGAAAAGCAACTCAGG + Intergenic
1021432945 7:20582308-20582330 TACAGCCAGAAAAGACATGAGGG + Intergenic
1021750630 7:23795663-23795685 TGTAGCCTGCAAAGCCACTGGGG + Intronic
1022335193 7:29415467-29415489 TATAGCCAGAAGAGCCCGAATGG + Intronic
1023257752 7:38328942-38328964 TAAAGCCAGAAAAGCAGCCAAGG - Intergenic
1024416048 7:49108116-49108138 TATACCCTGAAAAGCCACAGGGG + Intergenic
1024674411 7:51625228-51625250 TATACACAGAAAAGTAACTATGG - Intergenic
1029948252 7:104556056-104556078 TATACCCTGAAAAGCCACAGGGG - Intronic
1031408566 7:121414795-121414817 AATAGCAAGCAAAGACACTATGG - Intergenic
1031893679 7:127323986-127324008 GAAAGCCAGCAAAGCTACTAAGG + Intergenic
1033256236 7:139804128-139804150 TATACCCAGCAAAGCCACAGAGG + Intronic
1033320121 7:140331810-140331832 ATTAGTCAGAAAAGCCAGTAGGG + Intronic
1033765585 7:144486637-144486659 TATAGCCATAAACGCAATTAAGG - Intronic
1034749993 7:153559740-153559762 TATACCCTGCAAAGCCACAAGGG - Intergenic
1038139093 8:24822874-24822896 TATACCCTGCAAAGCCACAAGGG + Intergenic
1038338897 8:26667701-26667723 TATAGGCAGAGAAGCCCCGAGGG - Intergenic
1039609281 8:38906172-38906194 TATAGGCTGTAAAGCCAGTATGG + Intronic
1040541571 8:48361893-48361915 TATAGCAAGAAAGGACACAAAGG - Intergenic
1044650728 8:94491638-94491660 TATTGCCTGAAAACCCACCACGG + Exonic
1044733400 8:95251624-95251646 TGTAGCCAGAAAAACCAGTGAGG + Intronic
1044863277 8:96544355-96544377 TACAGACAGAAAAGCTCCTATGG - Intronic
1045300500 8:100906734-100906756 CAGAGCCTGAAAAGCCACTGTGG - Intergenic
1046050188 8:109012996-109013018 TATACCCTGAAAAGCCACAGGGG + Intergenic
1051025548 9:12606416-12606438 GACAACCAGAGAAGCCACTAGGG - Intergenic
1051218922 9:14828188-14828210 TGTACCCAGAAAAGCCATAAAGG + Intronic
1052018309 9:23495878-23495900 TTTCTCCAGGAAAGCCACTATGG - Intergenic
1057645160 9:96866731-96866753 TATACCCTGCAAAGCCACAAGGG + Intronic
1059599115 9:115756850-115756872 TATAGCCAGAAAAGCTGCAGTGG + Intergenic
1060157439 9:121329423-121329445 TGTTGCCAGAAAAGTCTCTAAGG + Intronic
1186964307 X:14771503-14771525 GATAGCCAGAATAGCCAGTTTGG - Intergenic
1187637857 X:21252080-21252102 CAAGGTCAGAAAAGCCACTAAGG + Intergenic
1188105566 X:26143781-26143803 TAAAGCCTGCAAAGCCACAAGGG - Intergenic
1188731117 X:33647698-33647720 TGTACCCTGAAAAGCCACAAGGG - Intergenic
1189144642 X:38643311-38643333 TAAAGCAAAAAAAGCCACAAGGG + Intronic
1189176508 X:38963162-38963184 TGTAGCCTGCAAAGCCACAATGG - Intergenic
1189726423 X:43971730-43971752 GAAAGCCATAAAAGACACTATGG - Intronic
1189896213 X:45659068-45659090 TATACCCCGCAAAGCCACAAGGG + Intergenic
1190655254 X:52606495-52606517 AATAGCCAGAAAAGCCAGAGGGG + Intergenic
1191915886 X:66200773-66200795 TATACCCAACAAAGCCTCTAGGG - Intronic
1193195958 X:78631790-78631812 TGTACCCAGCAAAGCCACAAGGG + Intergenic
1193749833 X:85327816-85327838 TATAGAAAGAAAAGTGACTAGGG - Intronic
1194365208 X:93006215-93006237 TATAACCTGCAAAGCCACAAGGG - Intergenic
1194732306 X:97470142-97470164 TATAAAGACAAAAGCCACTAGGG + Intronic
1195689690 X:107614137-107614159 TATAGACAAAAAAGCCGATATGG + Intergenic
1196390589 X:115203747-115203769 TATACCCTGAAGAGCCACAAGGG - Intronic
1196818583 X:119685117-119685139 TATAGAATGAAAAGCCACTCTGG - Intronic
1197016508 X:121632306-121632328 TATAGCCTGCAAAGCCACAGGGG - Intergenic
1197023072 X:121715301-121715323 GATAGCCAGAATAGCCAGTTTGG - Intergenic
1199480972 X:148298004-148298026 TATAACCTGAAAAGCCACAGGGG + Intergenic
1201620228 Y:15948695-15948717 TAGAGCCAGAAAGGCCAAAAAGG + Intergenic