ID: 977840663

View in Genome Browser
Species Human (GRCh38)
Location 4:101699780-101699802
Sequence ATAGGTAGATGTAAGGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977840663_977840667 -5 Left 977840663 4:101699780-101699802 CCAAAGTCCTTACATCTACCTAT 0: 1
1: 0
2: 5
3: 11
4: 172
Right 977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977840663 Original CRISPR ATAGGTAGATGTAAGGACTT TGG (reversed) Intronic
903255579 1:22096590-22096612 GCAGGCAGAGGTAAGGACTTTGG + Intergenic
906621775 1:47286907-47286929 ATATGTAGATTTAAGGATGTTGG + Intronic
907684201 1:56594088-56594110 AAAGGTAGAAGCAAGGAGTTTGG + Intronic
908068223 1:60431103-60431125 ATAGGTAGATCCAAAGATTTTGG - Intergenic
908183269 1:61627004-61627026 ATTAGTAGAAGTAAGGACTTAGG + Intergenic
908594052 1:65667099-65667121 GTGGGTGGGTGTAAGGACTTTGG + Intergenic
909346539 1:74594565-74594587 ATAGGTAGAAGCAAGGACCAAGG - Intronic
911906933 1:103581432-103581454 ATAGATAAAAGTTAGGACTTAGG - Intergenic
912869052 1:113286715-113286737 GGAGGTAGAGGTAGGGACTTGGG - Intergenic
914429626 1:147609108-147609130 ATAAGTAGATCTAAGGTGTTAGG + Intronic
915058159 1:153156283-153156305 ATAGGTAGGTGTGTGGATTTTGG - Intergenic
915568463 1:156730201-156730223 ATAGGTAATAGTAAGGAGTTAGG - Intronic
917693144 1:177489715-177489737 ATGGGGAGAGGAAAGGACTTGGG + Intergenic
918708829 1:187702928-187702950 ATAGGTAGATGAAATAATTTTGG - Intergenic
919438100 1:197589236-197589258 ATAGTTAGAACTAGGGACTTGGG - Intronic
919691673 1:200533357-200533379 ATAGACATTTGTAAGGACTTTGG - Intergenic
920864355 1:209739358-209739380 TTAGGTCTCTGTAAGGACTTTGG - Intergenic
921045743 1:211476815-211476837 ATAGGTACATGTAAGGTGATAGG + Exonic
921480415 1:215658536-215658558 GTAGGAAGATGTAAAGAGTTTGG - Intronic
921961730 1:221042304-221042326 ATAGGTATATGTAAGGTTTTTGG + Intergenic
924395090 1:243609927-243609949 ATAGATAGATGGTGGGACTTTGG - Intronic
1063240943 10:4168621-4168643 AGAGTTTGTTGTAAGGACTTGGG - Intergenic
1065426800 10:25614788-25614810 CTAGGTATTTGAAAGGACTTGGG + Intergenic
1066217180 10:33299247-33299269 ATAGGTAGTTCTAAGGATTGGGG - Intronic
1068234123 10:54210389-54210411 ATAGGTAGGTGTAGGGGCATGGG + Intronic
1071385891 10:85121083-85121105 ATAGGTCAATGTAAAGCCTTGGG + Intergenic
1073817926 10:107227961-107227983 AATGGTAGTTGTAAGGACTGTGG + Intergenic
1074230285 10:111527042-111527064 ATAAGCAAAGGTAAGGACTTAGG + Intergenic
1078480070 11:11667859-11667881 AGAGGTAGATGGGAGGAGTTTGG + Intergenic
1080136665 11:28863003-28863025 ATAGGTATAGCTAAGGATTTAGG - Intergenic
1080702560 11:34656694-34656716 GGAGATAGATGTATGGACTTGGG - Intronic
1081787579 11:45758011-45758033 ATAGGGAGTGGTAAGGACTGTGG + Intergenic
1083460921 11:62811224-62811246 AGTGCTAGAGGTAAGGACTTAGG - Intronic
1086190035 11:84068168-84068190 ATAGGAAGAAGTATGGGCTTCGG + Intronic
1087130113 11:94661783-94661805 ATAAGTTGATGTAAGGACTTTGG - Intergenic
1088864690 11:113836546-113836568 CTAGGAGGATGTCAGGACTTGGG - Intronic
1093082771 12:14832181-14832203 GAAGGCAGTTGTAAGGACTTTGG - Intronic
1093588485 12:20871563-20871585 TTAGGTATATGAAGGGACTTTGG + Intronic
1093976466 12:25427281-25427303 ATAGGTAGATGTAGGTAGGTAGG - Intronic
1094172343 12:27506712-27506734 ACAAGTAGTTGAAAGGACTTTGG - Intergenic
1096860625 12:54525140-54525162 ATATGTCATTGTAAGGACTTCGG + Intronic
1096871746 12:54596993-54597015 AGAGGCAGAAATAAGGACTTTGG + Intergenic
1097666808 12:62487438-62487460 ACAGGTAGATGTAACCACTACGG - Intronic
1098515573 12:71372814-71372836 ATAGGTAGATGTCAGGACATAGG - Intronic
1098836745 12:75432900-75432922 ATACTTACATGAAAGGACTTTGG - Intergenic
1104496491 12:129245224-129245246 ATCGGTAGTTGTTAGGAGTTGGG - Intronic
1106535050 13:30632952-30632974 ATAGGTAAATGTAAGTTATTGGG - Intronic
1107092373 13:36495749-36495771 GTAGGTAGAAGTGAGGATTTAGG + Intergenic
1108115137 13:47119162-47119184 ATAGGAAATTGTAAGGACTTTGG + Intergenic
1108255815 13:48610522-48610544 CTAGGTATTTGAAAGGACTTCGG + Intergenic
1109298805 13:60568467-60568489 AAAAGAATATGTAAGGACTTTGG + Intronic
1109320830 13:60807955-60807977 ATAGGAAAATGTAAGGAGTGTGG - Intergenic
1113186824 13:107696447-107696469 AAGGGTAGCTTTAAGGACTTGGG + Intronic
1115089076 14:29552017-29552039 ATGGGTGGATGTCAGGACTGGGG + Intergenic
1116696107 14:48180679-48180701 GTATGTAGATTTAAGGATTTTGG - Intergenic
1119098132 14:71853361-71853383 AGAGATATATGGAAGGACTTTGG + Intergenic
1119677086 14:76563850-76563872 ATAGATAGATTGAAGGGCTTGGG + Intergenic
1202844401 14_GL000009v2_random:154590-154612 TTAGATAGAAGTGAGGACTTTGG - Intergenic
1202913796 14_GL000194v1_random:144829-144851 TTAGATAGAAGTGAGGACTTTGG - Intergenic
1131237662 15:90710995-90711017 GTAGTTAGAGGTATGGACTTGGG - Intergenic
1137507401 16:49066053-49066075 ATATGTATATGAAAGAACTTTGG - Intergenic
1137509357 16:49085151-49085173 ATGGGTAGATGTAAGCACATGGG - Intergenic
1138887894 16:61102506-61102528 ATAAGAAGATATAAGGACATTGG - Intergenic
1139178803 16:64721574-64721596 ATAGGGAGATGTAGGGACTGTGG + Intergenic
1142296374 16:89225446-89225468 AAAGATAGATTTAAGGAGTTTGG - Intronic
1142723560 17:1794464-1794486 ATAGCTAGATTTAACTACTTAGG - Intronic
1150054155 17:61996431-61996453 ATAGGATGGTATAAGGACTTTGG - Intronic
1151057316 17:71048664-71048686 CCAGGTAGAAGTAAGGACGTAGG - Intergenic
1151320512 17:73349715-73349737 ATAGGTATAAATAAGGACCTGGG + Intronic
1160016149 18:75142080-75142102 ATAGGTAGCTGGAAGGATGTAGG + Intergenic
1160300764 18:77676079-77676101 ATATGTAGCTGTAAGAATTTGGG + Intergenic
1161258614 19:3323337-3323359 AGGGGTAGAGGAAAGGACTTGGG - Intergenic
927057737 2:19382577-19382599 GTAGGTAGATGTATTGTCTTTGG + Intergenic
927058686 2:19392252-19392274 ACAGATAGATGCAAGGCCTTAGG - Intergenic
928107449 2:28480091-28480113 ATACGAAGATTTAAGGAATTTGG + Intronic
929098536 2:38286668-38286690 ATAGGTACAGGTAGAGACTTGGG + Intergenic
933373996 2:81455596-81455618 ATAGGATTATGTAATGACTTAGG + Intergenic
937246128 2:120495033-120495055 TCAGGTACATGGAAGGACTTGGG + Intergenic
937647291 2:124279872-124279894 ATATGTATATGTAGGGACTGGGG - Intronic
939506608 2:143054099-143054121 ATTGGTGGTTGTAAGGACATAGG - Exonic
939522971 2:143255920-143255942 ATAGGTAGATGAAATGATTGGGG - Intronic
942892266 2:181005571-181005593 ATAGGAAGAGGTAAGGACTATGG - Intronic
946101296 2:217326722-217326744 AAAGGAAGATGTAGGAACTTAGG + Intronic
948634112 2:239323232-239323254 ATAGGTACAGGTATGGACATGGG + Intronic
1169671464 20:8107196-8107218 ATAGGTGAATTCAAGGACTTTGG - Intergenic
1169955332 20:11096527-11096549 ATGGGTCAATGAAAGGACTTTGG + Intergenic
1170269615 20:14510560-14510582 ATAGAATGATGTAATGACTTTGG + Intronic
1170301210 20:14886396-14886418 GTTGGTTGCTGTAAGGACTTTGG + Intronic
1172424649 20:34847060-34847082 ACAGGTAGCAGTAAGTACTTTGG - Intronic
1173940977 20:46910965-46910987 ATAGGGAAAGGTGAGGACTTGGG - Intronic
1174679280 20:52389617-52389639 ATAGGCAGAGGTAAGGGCTATGG - Intergenic
1176633152 21:9159504-9159526 TTAGATAGAAGTGAGGACTTTGG - Intergenic
1178054735 21:28785465-28785487 ATAGGGAGAAGTAAAGAATTGGG - Intergenic
1178535706 21:33408543-33408565 ATAGGTAGATCAAAGGTGTTGGG + Intronic
1179079502 21:38157788-38157810 ATATGTACTTGTAAGGATTTGGG + Intronic
1183071862 22:35401807-35401829 AGAGGAAGGTGAAAGGACTTAGG + Intronic
951853009 3:27163980-27164002 ATAGGTGGATGCAAAGATTTTGG - Intronic
952990105 3:38824202-38824224 AAAGGTAGATTTGAGAACTTGGG + Intergenic
953858036 3:46516773-46516795 ACATGAAGATGTAAGGAATTTGG - Exonic
955889071 3:63631469-63631491 ATGGGAACATGTAGGGACTTAGG - Intergenic
956387381 3:68734481-68734503 AGAGTTAAATGCAAGGACTTTGG + Intronic
957100024 3:75815457-75815479 TTAGATAGAAGTGAGGACTTTGG - Intergenic
957987043 3:87585717-87585739 ATCAGTGGATGTGAGGACTTTGG - Intergenic
960367979 3:116796761-116796783 ATAGGTAGATAAAAGAACATAGG - Intronic
960582771 3:119294769-119294791 ATCGGAAGATGGAAGAACTTGGG - Exonic
963346942 3:144106180-144106202 TTGGGTAAATGTAAGGACTCAGG + Intergenic
964394869 3:156234625-156234647 ATGGGAAGATGAAAGGACTAGGG + Intronic
965255471 3:166402860-166402882 ATAGTTAGATGGAAGGAATAAGG - Intergenic
966463623 3:180204303-180204325 ATAGGTATTTGAAGGGACTTGGG - Intergenic
970552177 4:17193302-17193324 ACAGGTAGATGGATGGATTTGGG + Intergenic
974782521 4:66571942-66571964 ATACTTAGATGTAAGGAGATGGG + Intergenic
975618007 4:76266720-76266742 GAAGGCAGTTGTAAGGACTTTGG - Intronic
977840663 4:101699780-101699802 ATAGGTAGATGTAAGGACTTTGG - Intronic
979297355 4:119048841-119048863 GTAGGTCAATGAAAGGACTTTGG + Intronic
979726086 4:123963373-123963395 ATAGGTCATAGTAAGGACTTGGG + Intergenic
984245923 4:177275257-177275279 ATAGCTTGATGGAAGGACTTTGG + Intergenic
984633292 4:182083015-182083037 ATTAGTAGCTGGAAGGACTTTGG + Intergenic
1202755061 4_GL000008v2_random:53716-53738 TTAGATAGAAGTGAGGACTTTGG + Intergenic
985796617 5:1966781-1966803 AAAGGTAGAGGTATGGGCTTGGG - Intergenic
989976017 5:50588263-50588285 AAAGGTAAATGTAAGCACCTTGG + Intergenic
990441339 5:55848527-55848549 AAAGGTTGATTTCAGGACTTGGG - Intergenic
991132160 5:63134988-63135010 ATAGGTCTTTGTAAGGACTTTGG + Intergenic
993485162 5:88475086-88475108 ATAGGTTGTGCTAAGGACTTAGG - Intergenic
994388322 5:99159459-99159481 AGAGCTAGAGGCAAGGACTTAGG + Intergenic
995870069 5:116735076-116735098 ATTGGTATTTGAAAGGACTTTGG - Intergenic
996646197 5:125820812-125820834 ATAGATGTATGTAAAGACTTAGG + Intergenic
997898990 5:137746351-137746373 GTAGGTTGTTGTAAGGATTTTGG - Intergenic
998068972 5:139181755-139181777 AAAGGTAGATGCAAGGGCTTTGG - Intronic
1000375476 5:160576925-160576947 ATAGGTAGATGTTGGCACATTGG + Intronic
1001490608 5:172152142-172152164 AGAAGTAGATGAGAGGACTTGGG - Intronic
1002123161 5:177021634-177021656 GTTGGTCGAAGTAAGGACTTTGG + Intronic
1002944451 6:1747755-1747777 ATAGGTAGGTCTTAGGTCTTTGG + Intronic
1004350863 6:14889098-14889120 ATATGTAGATGTAAACACATAGG + Intergenic
1004758419 6:18638979-18639001 AAAGCAAGATGTAATGACTTTGG + Intergenic
1010500632 6:76594877-76594899 ACAAGTAGAAGAAAGGACTTTGG + Intergenic
1011681722 6:89789995-89790017 ATAGGTAGGTGTAAGTAAGTAGG + Intronic
1014635262 6:123838242-123838264 AAAGGTTGACTTAAGGACTTTGG - Intronic
1014901133 6:126966935-126966957 CTAGGTAGATCTAAGCAATTGGG + Intergenic
1015010709 6:128343802-128343824 CTTGGGAGATATAAGGACTTTGG - Intronic
1015684917 6:135849099-135849121 CTAGGTCATTGTAAGGACTTTGG - Intergenic
1016532662 6:145075484-145075506 ATAGGTCAATGTAAGGACTTGGG + Intergenic
1017556390 6:155575653-155575675 ATAGGACAATGCAAGGACTTCGG - Intergenic
1020362139 7:7338714-7338736 ATAAGTAGATGTAAAGAATAAGG - Intergenic
1023813142 7:43927673-43927695 GTAGGTAAAAGTATGGACTTGGG + Intronic
1023846284 7:44122622-44122644 ATAGGCAGTTGTAAGGACTTGGG - Intronic
1024565827 7:50679785-50679807 ATAGAAATGTGTAAGGACTTTGG - Intronic
1028406726 7:90483385-90483407 ATAGATAGAGGCAAGGACTAAGG - Intronic
1029241937 7:99169241-99169263 GAAGGTAGGTGTAAGGACTCTGG + Intergenic
1030342647 7:108398271-108398293 GTAGGAAAATGTCAGGACTTGGG - Intronic
1030739803 7:113095323-113095345 ATTTGTAGATGTAAGGCATTTGG - Intergenic
1035173001 7:157030501-157030523 ATAGGTAGTTGTAAGCTCCTAGG + Intergenic
1038480978 8:27901744-27901766 AGATGCAGATGTAAGGACCTTGG - Intronic
1041941811 8:63397027-63397049 AAAGGAAGATGTAAAAACTTTGG + Intergenic
1043199982 8:77354780-77354802 ATATGTGGAGGTAAAGACTTTGG - Intergenic
1044251270 8:90006228-90006250 GTAGGGAGATGTCAGGACTGGGG + Intronic
1044484327 8:92732945-92732967 ATAGGTATTTTTAAGGACTAAGG - Intergenic
1044547750 8:93478309-93478331 GCAGGTCAATGTAAGGACTTTGG + Intergenic
1045159796 8:99525969-99525991 ATAGGTCGTTGTGTGGACTTTGG + Intronic
1045530808 8:102983630-102983652 ACTGGTAGTTTTAAGGACTTAGG + Intergenic
1046954246 8:120046879-120046901 ATAGGAAGCCGTAAGGACTGTGG + Intronic
1050717112 9:8542390-8542412 TTAGGAAGATGTAAGGAGATAGG + Intronic
1051949058 9:22608636-22608658 ATTTCTAGATGTAAGGCCTTAGG + Intergenic
1052506545 9:29361300-29361322 ATAAGTAAATGTAAGCACCTAGG - Intergenic
1052574177 9:30270215-30270237 TTAGGTGTATTTAAGGACTTGGG + Intergenic
1053110349 9:35454254-35454276 ACAGGTATGTGAAAGGACTTGGG - Intergenic
1054716868 9:68565225-68565247 ATAGTCAGAGGTCAGGACTTGGG + Intergenic
1057157218 9:92853631-92853653 AGAGGCAGGTGTAAGGGCTTTGG - Intronic
1059799579 9:117736772-117736794 ATAGGTCTATGTAAGGACTTTGG - Intergenic
1061492881 9:130956023-130956045 ATAGGGAGATGTGAGGACTGTGG + Intergenic
1203686669 Un_GL000214v1:673-695 TTAGATAGAAGTGAGGACTTTGG + Intergenic
1203755989 Un_GL000218v1:127131-127153 TTAGATAGAAGTGAGGACTTTGG - Intergenic
1203448384 Un_GL000219v1:83707-83729 AAAGGTACATATAATGACTTTGG + Intergenic
1203535857 Un_KI270743v1:38426-38448 TTAGATAGAAGTGAGGACTTTGG + Intergenic
1203649606 Un_KI270751v1:103380-103402 TTAGATAGAAGTGAGGACTTTGG - Intergenic
1188455628 X:30362170-30362192 GTAGGTCATTGTAAGGACTTTGG - Intergenic
1188589679 X:31818773-31818795 AGAGTTAGATTTAACGACTTTGG - Intronic
1189291845 X:39891818-39891840 ACAGGGAGAGGTAAAGACTTGGG - Intergenic
1194066560 X:89268806-89268828 AAAGGAAAATGTAAGGACTAAGG - Intergenic
1194967203 X:100302150-100302172 ATAGAAAGATATAAGGACCTTGG + Intronic
1195881620 X:109598696-109598718 AGAGGTAGATGTAAGGTAGTTGG - Intergenic
1196340349 X:114587648-114587670 ATATGTAGATGAAATGACATAGG - Intronic
1197100188 X:122644181-122644203 ATAGGCTGTTGTAAGAACTTTGG - Intergenic
1197307443 X:124861062-124861084 ATAGGGAGAAGTAAGGATTTGGG - Intronic
1197424435 X:126277993-126278015 ATAGGTAGAAGGGAGGACTGAGG + Intergenic
1198567834 X:137923107-137923129 ACAGGCAGATATAATGACTTTGG + Intergenic
1199542112 X:148968659-148968681 AAAGGCAGATGTAAGGACCATGG - Intronic
1200375095 X:155771625-155771647 GTATGTAGATGTAGGAACTTGGG - Intronic
1200720728 Y:6602927-6602949 AAAGGAAAATGTAAGGACTAAGG - Intergenic
1201357033 Y:13108329-13108351 ATAACTAGATGAGAGGACTTGGG - Intergenic