ID: 977840667

View in Genome Browser
Species Human (GRCh38)
Location 4:101699798-101699820
Sequence CCTATCAGGTCCCACGTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977840661_977840667 20 Left 977840661 4:101699755-101699777 CCCTTAGTGGCTTTTCTGGCTAT 0: 1
1: 0
2: 0
3: 8
4: 160
Right 977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG 0: 1
1: 0
2: 0
3: 3
4: 30
977840663_977840667 -5 Left 977840663 4:101699780-101699802 CCAAAGTCCTTACATCTACCTAT 0: 1
1: 0
2: 5
3: 11
4: 172
Right 977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG 0: 1
1: 0
2: 0
3: 3
4: 30
977840662_977840667 19 Left 977840662 4:101699756-101699778 CCTTAGTGGCTTTTCTGGCTATA 0: 1
1: 0
2: 0
3: 9
4: 214
Right 977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG 0: 1
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977840667 Original CRISPR CCTATCAGGTCCCACGTAAT TGG Intronic
901896292 1:12315689-12315711 CCTATCAGGTGTCTCGTCATTGG + Intronic
904117863 1:28175642-28175664 CCTATCAGGTCCCAGGTGCTGGG - Intronic
904187007 1:28713324-28713346 CTTATCAGGTACTAAGTAATAGG + Intronic
920050171 1:203159743-203159765 CCTATCAGGTGCCAGGTTCTAGG - Intronic
1066593243 10:37019260-37019282 CCTAGCAGGTCCCACCTGAAGGG + Intergenic
1096223861 12:49851688-49851710 CCTAGGAGGTCTCACATAATAGG + Intergenic
1105053152 12:133073080-133073102 CCTATAATGTTCCACGCAATAGG + Intergenic
1108114576 13:47112801-47112823 CCTATCTGGTCCTACATAATAGG - Intergenic
1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG + Intronic
1123948915 15:25252110-25252132 CCTCTATGGACCCACGTAATGGG - Intergenic
1125200138 15:37095803-37095825 CGTACCAGGTCCCCCTTAATGGG - Intronic
1149553304 17:57555706-57555728 CCTATTATGTCCCAGGTACTGGG - Intronic
1160588281 18:79925180-79925202 CCTCCCAGGTCCCTCGGAATAGG - Intronic
937126105 2:119476056-119476078 CCTGTCAGGACCCATGTAGTAGG + Intronic
940137468 2:150455006-150455028 CCTATTAGGTTCCAGGTACTGGG + Intergenic
944681948 2:202085255-202085277 CCTCTCAGGTCCCAGGGATTAGG - Intronic
1169967135 20:11230198-11230220 CCTATGAAGTCCCAGGTAAAAGG + Intergenic
1171988985 20:31681117-31681139 CCTACCAGGCCCCACACAATCGG - Intronic
1179779788 21:43692042-43692064 CTTAACAGGTCCCAGGCAATTGG - Intronic
956311445 3:67885065-67885087 CCTTTCAGGTTCCACGTCCTCGG - Intergenic
960194730 3:114751478-114751500 CCTAGCAGGTGCCACATAGTAGG - Intronic
974874399 4:67685626-67685648 CCCATTAGGTCCTACGTAACGGG - Intronic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
979115140 4:116814375-116814397 CTTATAAGGTCCCCAGTAATTGG + Intergenic
984408219 4:179362099-179362121 CTTATCAGGTCACAGGTGATGGG - Intergenic
1002412784 5:179096559-179096581 CCTATCTGGGCCAACATAATGGG - Intergenic
1015605943 6:134954756-134954778 CCTGTCAGGCCCCACGCATTTGG - Intergenic
1026284042 7:68947597-68947619 CCTATCATGTACCATGTACTTGG - Intergenic
1046082463 8:109387907-109387929 ACTATCAGCTTCCAAGTAATAGG + Intronic
1056900790 9:90597458-90597480 CCCATCAGGTGCCGCGTCATGGG + Intergenic
1188907056 X:35801811-35801833 CCTATCAGGTGCCAAGTTACTGG + Intronic
1191586519 X:62833284-62833306 CCCATTAGGTCCCACCTAATTGG + Intergenic
1199601612 X:149544517-149544539 TCTATTAGGTGCCACGTACTGGG + Intronic