ID: 977847096

View in Genome Browser
Species Human (GRCh38)
Location 4:101779251-101779273
Sequence AGCAATCTGCAGATGATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 356}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977847095_977847096 4 Left 977847095 4:101779224-101779246 CCAAGAACTGTTTCTCAAAAAGA 0: 1
1: 8
2: 57
3: 347
4: 1575
Right 977847096 4:101779251-101779273 AGCAATCTGCAGATGATGTCAGG 0: 1
1: 0
2: 1
3: 17
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977847096 Original CRISPR AGCAATCTGCAGATGATGTC AGG Intronic
901788515 1:11640797-11640819 AGCAATGTGCAGATGAGGAAAGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904972210 1:34427830-34427852 AGCAAGCTGGAGGTGGTGTCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909783574 1:79581620-79581642 AGGAATCTGCAGATTATTTGGGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924631386 1:245744050-245744072 AGCAATCTACAGATGATTTAAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063772434 10:9219552-9219574 AGCAATCTGCAGGTATTTTCAGG + Intergenic
1064519447 10:16186075-16186097 TTAAATCTGCAGATGATGTCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065293798 10:24256173-24256195 CGCAAAGTGCAGATGAGGTCTGG + Intronic
1066321876 10:34310975-34310997 TGCAATCTGCTGATGATTTAAGG - Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073587803 10:104727448-104727470 GGAAATATGCAGATGATGACTGG - Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076540892 10:131214141-131214163 AGGACCCTGCAGAGGATGTCAGG - Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078688185 11:13552269-13552291 AGCAATTGTCAGATGATATCAGG - Intergenic
1079888975 11:26026469-26026491 AGCAATCTGAGAATGGTGTCTGG - Intergenic
1079993001 11:27266323-27266345 AGCATTATGGAGATGGTGTCTGG - Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080926162 11:36758379-36758401 AGCAAACTGCAGATGAGGCAGGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083375085 11:62213812-62213834 AGCAATCAACAGATGAGTTCTGG - Exonic
1083576610 11:63796430-63796452 AGCAAGCTCCAGGTGATGACAGG - Intergenic
1083662937 11:64260218-64260240 AGCCAACTACAGATGAGGTCAGG + Exonic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1085806486 11:79641559-79641581 AAAAATCTGCAGATGGTGTAAGG - Intergenic
1087454754 11:98370601-98370623 TGGAATCAGCTGATGATGTCTGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097248628 12:57620404-57620426 AGCAAGCTGTAGATGAGGACGGG - Exonic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098148563 12:67522822-67522844 AGTAATCTAGAGATGATGTAAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099123376 12:78720644-78720666 AGTAATCTACAGATGATTTAAGG + Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103244726 12:119446890-119446912 AGCAATCTGCACATGATTACAGG + Intronic
1106075646 13:26458752-26458774 AACAATCAGCAAATGATTTCTGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1109914047 13:68956168-68956190 AGTAATCTGCTGATGTTGGCTGG + Intergenic
1110493142 13:76133272-76133294 AGCCATCAGCTGTTGATGTCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115630759 14:35242813-35242835 AGCACTCTGCAAATAATGTCAGG - Intronic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117219398 14:53587077-53587099 AGCTTCCTGAAGATGATGTCTGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118232427 14:63965602-63965624 AACAAGCTGCAGATACTGTCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120926663 14:89803956-89803978 AGAGATATGCAGATGATTTCTGG + Intronic
1122720381 14:103718589-103718611 AGGAAGCTTCAGATGATCTCTGG + Intronic
1124804193 15:32864527-32864549 AAAAATTTGCATATGATGTCAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128267498 15:66279530-66279552 ATCAATCTGGAGGTGATGCCAGG - Intergenic
1128390685 15:67180594-67180616 CTCAGTCTGCAGATGATGCCTGG + Intronic
1128855581 15:71011066-71011088 AGCCATCTGCTGAAGATGTTGGG + Intronic
1129752768 15:78077516-78077538 GGCTATCTGCAGAAGCTGTCGGG - Exonic
1130697602 15:86146344-86146366 AGTAATCTAGAGATGATGTAAGG + Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1131901208 15:97089703-97089725 AACAATCTGAAGATGATGTCGGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140945598 16:79765302-79765324 AGGAAGCTGCAGTTGAGGTCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1144812336 17:18008497-18008519 CTCATTCTGCAGATGATGCCTGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149852819 17:60050832-60050854 AGCAATCTGCCGGTAATGTGAGG - Exonic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151377167 17:73697820-73697842 GGCAATCTGCAGATGGAGTGTGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157429663 18:47614257-47614279 AGCAATGTGCAGAAGCTGACTGG - Intergenic
1157890955 18:51417497-51417519 AGCAATTTTTAGATGATGTGCGG + Intergenic
1158409132 18:57188994-57189016 AGCTTTTTGCAGAGGATGTCTGG - Intergenic
1159259883 18:66000736-66000758 AGCATTCTGCATTTCATGTCAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1163879970 19:19910781-19910803 TGGAATCTGCAGATAAGGTCTGG + Intronic
1167325604 19:48823044-48823066 GGCAATATGCAAATGTTGTCGGG + Intronic
1167778795 19:51581804-51581826 AGCATTCTGAAGATGACCTCTGG - Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
927992635 2:27458863-27458885 AGCAATCTGTAGTTGATGGGAGG + Exonic
928687017 2:33760303-33760325 AGCCATATGCTGATGATGGCAGG - Intergenic
929187462 2:39110228-39110250 AGTAATCTGGAGATGATTTAAGG - Intronic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931812111 2:65864091-65864113 AGCAGTGTGCAGAAGATGGCAGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933997230 2:87679005-87679027 GGCAATCAGCTGATGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935633400 2:105231063-105231085 AGCTATCTGCAGATCACATCTGG + Intergenic
936156942 2:110053212-110053234 AGTAATGTTCATATGATGTCTGG - Intergenic
936296622 2:111271905-111271927 GGCAATCAGCTGATGATGGCAGG - Intergenic
937019367 2:118636118-118636140 AGCACTCTGCATAGGAAGTCGGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
938811521 2:134857472-134857494 AACAATCTGCAAAAGATATCAGG - Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940480689 2:154227195-154227217 TGCACTCTGCTGATGATGTGGGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943374599 2:187060195-187060217 AGTAATCTAGAGATGATGTAAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944350583 2:198722460-198722482 AACAATCTGGAAATGATATCAGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946474077 2:219991134-219991156 AGAAGTCTGCTGAGGATGTCTGG + Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1170429229 20:16261419-16261441 ACCACTCTGCAGCTGATGTGGGG + Intergenic
1170643136 20:18173680-18173702 AGCACTCAACAAATGATGTCAGG - Intronic
1170994260 20:21336883-21336905 AGCACACTGCAGATGTTTTCAGG + Intronic
1171055346 20:21901187-21901209 TGCTAACTGCAGATGATGCCTGG - Intergenic
1173054255 20:39595947-39595969 TTTAATCTGCAGATGAAGTCAGG - Intergenic
1173961760 20:47078605-47078627 AACAATTTGCAGATGATTACAGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177466591 21:21491133-21491155 ATGAATCTGCTGATGATGTATGG - Intronic
1177470044 21:21548709-21548731 AGCTATCTTCAGATAATGCCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1182796263 22:32993828-32993850 AGAACTCTGCAGATGCTGTGGGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952618763 3:35309699-35309721 TGCAATTTGCAGATTCTGTCAGG + Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955156594 3:56422591-56422613 AGCATGCTGAAGATGCTGTCAGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957961856 3:87265749-87265771 AGTAATCTGGAGATGATTTAAGG + Intronic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
960768659 3:121167611-121167633 AGCAATCTGGAGAGGCAGTCTGG - Intronic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964724944 3:159804997-159805019 AGAAATCTGCTGAGGATGACTGG - Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
968149216 3:196323931-196323953 AGCCCTCTGCAGCTGTTGTCTGG - Exonic
969084947 4:4649371-4649393 AGGAATGTGGATATGATGTCTGG + Intergenic
971771403 4:30901668-30901690 AACCAACTGCAGATAATGTCTGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972608567 4:40635971-40635993 AGAAATCTGCAGATCGTCTCTGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973143678 4:46798576-46798598 AGCTTTCTGCAGATCATGGCAGG - Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976407957 4:84680780-84680802 AGTAATCTGGAGATGATTTAAGG + Intronic
976894676 4:90095037-90095059 AGCAATGTGCTGATTATGTAGGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977847096 4:101779251-101779273 AGCAATCTGCAGATGATGTCAGG + Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979062938 4:116089033-116089055 AGCATTCTGCAAATGTTGGCTGG - Intergenic
979404636 4:120294688-120294710 AGCCTTCTGCAGATGATGGAGGG + Intergenic
979848150 4:125543261-125543283 AGGACTCAACAGATGATGTCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
982012696 4:151122163-151122185 TGGAATCTGTAGATGATGACTGG - Exonic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983840883 4:172455641-172455663 AGGAATCTAGAGATGAGGTCTGG - Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986537688 5:8808643-8808665 AGTAATCTAAAGATGATGTAAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986913657 5:12588895-12588917 AGCTATCTGCAGCTCATGTAGGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
989040635 5:37224735-37224757 AGCAATCTGCACATAAAATCAGG + Exonic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990462740 5:56044992-56045014 AGCAATCCCCAAATGATGTATGG - Intergenic
991550487 5:67830790-67830812 AGCAATCTGGAGATGAACTCTGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993766906 5:91871102-91871124 AGCAATTTGCAAATTATTTCAGG - Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993841621 5:92886988-92887010 AGTAATGTGCAGATGTTATCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001967402 5:175920914-175920936 AACATTTTGCAGATGATTTCAGG + Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004016255 6:11734601-11734623 AGAAAACAGCAGATGAGGTCTGG + Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016874573 6:148852013-148852035 AGGAATCCGAGGATGATGTCTGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018045573 6:159963265-159963287 AGCATTTTGCAGAAGATCTCAGG + Intergenic
1018581235 6:165309984-165310006 AGTAATCTAGAGATGATGTAAGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021365161 7:19769790-19769812 AGTAATCTAGAGATGATGTAAGG + Intronic
1023844969 7:44115442-44115464 AGCACTCTGCACAGGATGTGGGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032105991 7:129030360-129030382 AACAATCTACATGTGATGTCAGG + Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1035718819 8:1775220-1775242 AGTAATCTACAGATGATTTAAGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039695447 8:39905598-39905620 AGAACTATGAAGATGATGTCTGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044481420 8:92693749-92693771 AACAATCTCCAGATACTGTCTGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046883810 8:119340504-119340526 TGCATTTTGCAGAGGATGTCTGG - Intergenic
1047233725 8:123020077-123020099 AGCAATATGCAGAAGAAGTTAGG + Intronic
1047757255 8:127928209-127928231 ACCACCCTCCAGATGATGTCTGG + Intergenic
1049564211 8:143329687-143329709 AGAAAGCTGCAGAAGATTTCAGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050992795 9:12173759-12173781 GGCTAGCTGTAGATGATGTCTGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052549187 9:29926293-29926315 AGAAACCTCCAGATGATTTCAGG - Intergenic
1052738259 9:32367738-32367760 AGCAATCTAGAGATGATTTAAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057007265 9:91571438-91571460 AGCAATGTGCAGAAGATGATGGG - Intronic
1057787308 9:98096635-98096657 AGGAATCCCCAGATGATGCCTGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058239796 9:102542463-102542485 AGTTATTTACAGATGATGTCAGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059424128 9:114210333-114210355 AGGAATCAGCAGATGGTTTCTGG - Intronic
1061461166 9:130740429-130740451 AGCAAGGAGCTGATGATGTCTGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1190144198 X:47875666-47875688 AGCAATCTGCTGATGAGGATGGG - Intronic
1191119759 X:56891055-56891077 AGGAATCTGGAGAGGAAGTCTGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192094037 X:68191405-68191427 AGAACTCATCAGATGATGTCTGG + Intronic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196010345 X:110880295-110880317 ATCCATCTGCAGATGGTGACAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200780001 Y:7206110-7206132 AGGAACCTGCAGAAGAGGTCAGG - Intergenic
1201751133 Y:17433202-17433224 AGCACCCTCAAGATGATGTCTGG + Intergenic