ID: 977848216

View in Genome Browser
Species Human (GRCh38)
Location 4:101791093-101791115
Sequence GAACCCTCTGGGCTGCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 230}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977848216_977848221 1 Left 977848216 4:101791093-101791115 CCGCCAGGCAGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 977848221 4:101791117-101791139 TCTGTCCCTGACTTCTCTGAGGG 0: 1
1: 0
2: 0
3: 25
4: 272
977848216_977848225 9 Left 977848216 4:101791093-101791115 CCGCCAGGCAGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 977848225 4:101791125-101791147 TGACTTCTCTGAGGGGCATCTGG 0: 1
1: 0
2: 2
3: 9
4: 149
977848216_977848222 2 Left 977848216 4:101791093-101791115 CCGCCAGGCAGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 977848222 4:101791118-101791140 CTGTCCCTGACTTCTCTGAGGGG 0: 1
1: 0
2: 1
3: 29
4: 250
977848216_977848226 20 Left 977848216 4:101791093-101791115 CCGCCAGGCAGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 977848226 4:101791136-101791158 AGGGGCATCTGGACGCCACGAGG 0: 1
1: 0
2: 1
3: 10
4: 132
977848216_977848228 24 Left 977848216 4:101791093-101791115 CCGCCAGGCAGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 977848228 4:101791140-101791162 GCATCTGGACGCCACGAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 87
977848216_977848227 23 Left 977848216 4:101791093-101791115 CCGCCAGGCAGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 977848227 4:101791139-101791161 GGCATCTGGACGCCACGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 95
977848216_977848220 0 Left 977848216 4:101791093-101791115 CCGCCAGGCAGCCCAGAGGGTTC 0: 1
1: 0
2: 1
3: 25
4: 230
Right 977848220 4:101791116-101791138 TTCTGTCCCTGACTTCTCTGAGG 0: 1
1: 0
2: 6
3: 31
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977848216 Original CRISPR GAACCCTCTGGGCTGCCTGG CGG (reversed) Intronic
900458246 1:2787594-2787616 GTACCGCCTGGGCCGCCTGGAGG - Exonic
900479727 1:2892109-2892131 GGCCCCACTGGGCTGGCTGGTGG - Intergenic
900687843 1:3959943-3959965 GAAGACTCGGGGCTGCCTGTGGG - Intergenic
900786220 1:4652597-4652619 GAACCCCTTGGGCAGCCTTGTGG - Intergenic
902405749 1:16182442-16182464 GAGCCCTGTGGCCTTCCTGGAGG + Intergenic
902490229 1:16776016-16776038 AAAGCCTCTGAGCTCCCTGGAGG + Intronic
903183729 1:21618198-21618220 GAAACCGCTGGACTGCCTGGAGG + Intronic
903228983 1:21910376-21910398 CAGCCCTGTGGGCTTCCTGGAGG - Intronic
903328373 1:22584316-22584338 GAGGGCTCTGGTCTGCCTGGGGG - Intronic
904478230 1:30777945-30777967 GAGCCCTCTGTGCAGGCTGGTGG + Intergenic
904998805 1:34652147-34652169 GCACCCTCTTGGCTGGCTGTGGG + Intergenic
905025604 1:34847348-34847370 AAACCCTCTTGGGTGCCTGCCGG - Intronic
906709896 1:47921500-47921522 GAGACATCTGGGATGCCTGGAGG - Intronic
913594320 1:120358997-120359019 GACTCCTCTTGGCTACCTGGGGG + Intergenic
914305588 1:146413886-146413908 GACTCCTCTTGGCTACCTGGGGG + Intergenic
914736262 1:150419988-150420010 AAACTCTCAGAGCTGCCTGGAGG + Intronic
915163204 1:153933751-153933773 GAGCCCCCTGGGCTGCCTCCAGG + Exonic
915488160 1:156236281-156236303 GATCCCGCTGGGGCGCCTGGAGG - Exonic
916275486 1:162989085-162989107 GAACCCTCTGAGGCACCTGGTGG + Intergenic
916520334 1:165557874-165557896 GAACCTTCTGGGCTGACTGGAGG - Intronic
917012314 1:170488419-170488441 AAACCCTCTGGGCTCCCTGTAGG - Intergenic
919982147 1:202648667-202648689 GCATCCACTGGGCTACCTGGGGG + Intronic
920531752 1:206707237-206707259 GAAGTCTCTGGAGTGCCTGGGGG - Intronic
922534720 1:226371301-226371323 GACCCTTCTGAGCTCCCTGGGGG + Intronic
923530209 1:234806514-234806536 AAAGCCTCTGAGCTCCCTGGAGG - Intergenic
924797666 1:247303987-247304009 CAACCCTGTGGACTGCATGGAGG + Intronic
1062890538 10:1056677-1056699 GACCCCTCGGGGCTGCGGGGCGG + Intronic
1064605721 10:17036586-17036608 GAACCAGCAGGGCTGCCAGGGGG + Intronic
1065785300 10:29207416-29207438 GACCTCACTGGCCTGCCTGGTGG + Intergenic
1066703680 10:38156481-38156503 CCACCCTCCGGGCTGCCTGTGGG - Intergenic
1067581673 10:47450389-47450411 GAACCCTCCTGGCTTCTTGGTGG - Intergenic
1068878086 10:62019002-62019024 CAAACCTCTGGGCTGCATGGTGG - Intronic
1069567616 10:69474224-69474246 GACCCCTCTGGGCTGCTGAGAGG - Intronic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1072252947 10:93595974-93595996 GAAGCCACAGGGCTGCCTGCTGG + Intronic
1072667769 10:97406876-97406898 GAACCCACTGGGCTGCTGTGAGG + Intronic
1073057644 10:100712603-100712625 AACCCCTCTGGGGGGCCTGGTGG - Intergenic
1073648617 10:105334680-105334702 GGACACTATGTGCTGCCTGGTGG + Intergenic
1074097392 10:110326076-110326098 GAAGCCACGGGGCTGCGTGGAGG - Intergenic
1074533075 10:114310330-114310352 TAAGCCTCTGCCCTGCCTGGAGG - Intronic
1075560095 10:123461802-123461824 GTGCCACCTGGGCTGCCTGGAGG + Intergenic
1076056983 10:127383828-127383850 GCTCCCACTGGGCAGCCTGGAGG - Intronic
1076698058 10:132256645-132256667 GACCCCTCTAGGCAGCCTGGGGG - Intronic
1076813000 10:132898843-132898865 GCACCCTCTGGGAGGCCTGTGGG + Intronic
1076857772 10:133126053-133126075 GAAGCCCCTGGGCTGCTTGGGGG - Intronic
1076889855 10:133278095-133278117 GGAGCCTCTCGGCAGCCTGGGGG - Intergenic
1078431539 11:11292152-11292174 GGAGCCTCAGGGCTGCCTGGGGG - Intronic
1082020982 11:47533035-47533057 GAACCCACTAGGATTCCTGGGGG + Intronic
1088663767 11:112074225-112074247 GGAGTCTCTGGGCTGCCTGTTGG + Intronic
1088910343 11:114186288-114186310 GAACCACGCGGGCTGCCTGGAGG - Intronic
1089879973 11:121764064-121764086 GAAGACTCTGGGCTCCCTAGGGG + Intergenic
1090774003 11:129947271-129947293 GACCCCTCTAGGCAGACTGGAGG - Exonic
1090939997 11:131379095-131379117 GAACACTCTGGGGAGCCAGGTGG - Intronic
1091302944 11:134519244-134519266 GCATCCTGCGGGCTGCCTGGAGG + Intergenic
1091940627 12:4477384-4477406 GAGGGCTCTGAGCTGCCTGGTGG + Intergenic
1092159792 12:6310183-6310205 GGACCGGCTGGCCTGCCTGGTGG - Intergenic
1092163587 12:6329374-6329396 GGACCTGCTGGGCTGCCTGGAGG - Exonic
1094025891 12:25959104-25959126 GGCCCCTCTGGGCGGCCTGCGGG + Exonic
1096650772 12:53060973-53060995 GACCCATCTGGGCTGTCGGGGGG - Exonic
1097255938 12:57674703-57674725 TCACCTCCTGGGCTGCCTGGCGG + Intergenic
1102212657 12:111138526-111138548 GAACCCTGGGGGCTGCCATGGGG - Intronic
1102817741 12:115881564-115881586 GATGTCTCTGGGCTGCCTTGTGG - Intergenic
1103555857 12:121766084-121766106 GAACCCTACGGGCCTCCTGGGGG + Intronic
1103931667 12:124453903-124453925 GATCCCTGTGGCCTTCCTGGAGG - Intronic
1104849956 12:131868131-131868153 GAACCCCATGGGCTGCCTCGAGG - Intergenic
1105005779 12:132719736-132719758 GCCTCCTCAGGGCTGCCTGGCGG - Intronic
1105926204 13:25011207-25011229 GAATCCTCTGGGCTGCTCTGAGG - Intergenic
1107692869 13:42969378-42969400 GAACCCTCTGTGCTGACTCTTGG - Intronic
1113604533 13:111595937-111595959 CCACCCTCTGGCCTGCCTGTGGG + Intronic
1113939134 13:114009605-114009627 GAGCCCGCAGGGCTGCCCGGAGG + Intronic
1113962345 13:114132820-114132842 GACCCCAGCGGGCTGCCTGGCGG + Intergenic
1121051161 14:90819826-90819848 GAACCCTCTGGGCTTCACCGTGG + Intergenic
1121544442 14:94753176-94753198 TCACCCTGTGGGCTGGCTGGCGG + Intergenic
1122088144 14:99320985-99321007 GCCTCCTCTGGGCTGGCTGGGGG - Intergenic
1123061864 14:105598124-105598146 CCACCCTCAGGGCTGGCTGGCGG - Intergenic
1123086604 14:105719855-105719877 CCACCCTCAGGGCTGGCTGGCGG - Intergenic
1124620694 15:31272335-31272357 GAACCCACTGGGCTGTGCGGTGG + Intergenic
1124906386 15:33872534-33872556 GAACTCTCTGGGTGGCGTGGGGG + Intronic
1128256291 15:66199505-66199527 GGAGCCTCTGGGCTGGCTTGGGG - Intronic
1128504631 15:68258867-68258889 GCACACTCAGGGCTGCCTAGTGG - Intergenic
1129293808 15:74588454-74588476 GGTCTCACTGGGCTGCCTGGTGG - Intronic
1129756302 15:78101218-78101240 GATCCCTGGGGGCTACCTGGAGG + Exonic
1130175044 15:81559577-81559599 AAACCCTCTGGGCTCCATGCAGG + Intergenic
1130653107 15:85773497-85773519 CCACCCGCTGAGCTGCCTGGAGG - Intronic
1132997457 16:2830588-2830610 GAACCATCCTGTCTGCCTGGAGG + Intronic
1133008256 16:2896544-2896566 GAACTTTCTGGGCTTCCTGGGGG - Exonic
1133013822 16:2929780-2929802 GAACTCCCTGGGCTTCCTGGGGG - Exonic
1136506078 16:30704187-30704209 GCACCATCTGGGGGGCCTGGAGG - Exonic
1137673884 16:50294334-50294356 GAAGGCTCCGGGCTGCCTGCAGG + Intronic
1137929562 16:52574093-52574115 GACCCCTCTGGGGTGCTTGGTGG - Intergenic
1139374243 16:66486936-66486958 GAGCCCTCAGGCCTGGCTGGAGG - Intronic
1140949064 16:79798356-79798378 GAAGCCTCTGGGCTGCTTCTGGG + Intergenic
1141395324 16:83699420-83699442 GAAGCCTCTGGGCTGCTACGGGG - Intronic
1141815815 16:86408611-86408633 GGCACCTCTGGCCTGCCTGGTGG - Intergenic
1141892333 16:86934749-86934771 GAACCCTCTGCCCTGGCTCGGGG + Intergenic
1142178238 16:88654864-88654886 CAACCCTCTGGTCTGCCAGGCGG + Intronic
1142804869 17:2366153-2366175 GCAGACTCGGGGCTGCCTGGGGG + Intronic
1143683359 17:8494136-8494158 GAGGCCTCGGGGATGCCTGGAGG - Intronic
1147600467 17:41742097-41742119 GGATGCTCTGGGCTTCCTGGAGG - Intergenic
1148242853 17:46011780-46011802 AAACCCTCTGGGCTGGATGCGGG - Intronic
1148782083 17:50128230-50128252 GCACCCTCTGGGCTGGATTGGGG + Intronic
1151802216 17:76385150-76385172 CACCCCTCGGGGCTGCCAGGGGG - Exonic
1152072081 17:78138885-78138907 CCACCCTCTGGGCTGCCATGGGG + Intronic
1152093310 17:78258577-78258599 GAGGCCACTGGGCTGGCTGGAGG + Intergenic
1152110264 17:78353776-78353798 GGGCCCTCTGGCCTGGCTGGGGG - Intergenic
1152287751 17:79422425-79422447 TGACCCCCTGGGCTTCCTGGAGG - Intronic
1152594153 17:81230104-81230126 GAACACTCTGAACTGCCTGGCGG - Intronic
1152609815 17:81310009-81310031 GGGCCCTGGGGGCTGCCTGGAGG - Intergenic
1155052784 18:22163435-22163457 AAACCCGCTGGGTTGCCTAGAGG + Intergenic
1157718330 18:49904737-49904759 GGACCCTCTGGTAGGCCTGGCGG + Exonic
1158667731 18:59447997-59448019 GGACCTCCTGGCCTGCCTGGGGG - Exonic
1159600797 18:70426970-70426992 GAACGCTCTGAGCTGCTTTGAGG + Intergenic
1160662662 19:308349-308371 TTACCCTCTGGGCTTGCTGGAGG - Intronic
1161014704 19:1977980-1978002 GAGCCCTTGGGGCTGCCTGCAGG + Intronic
1161296790 19:3524199-3524221 GCACTCTCGGGGCTGCCAGGAGG + Intronic
1161468019 19:4442867-4442889 GGGCCCTCTGGGCTCCCTGGGGG - Intronic
1161940373 19:7399206-7399228 GAAGCCTCGCAGCTGCCTGGAGG + Intronic
1162066145 19:8126493-8126515 CCACCCTCGGGGCAGCCTGGGGG - Exonic
1162500805 19:11052543-11052565 GCGCCCTCTGGGCTACCAGGAGG - Intronic
1163016452 19:14458348-14458370 GGAACCCCAGGGCTGCCTGGTGG + Exonic
1163430198 19:17262803-17262825 GCACACTCTGAGCTCCCTGGAGG - Exonic
1164465159 19:28481655-28481677 CAACCCGCAGAGCTGCCTGGGGG - Intergenic
1168121412 19:54254300-54254322 GGAGACTCAGGGCTGCCTGGGGG + Intronic
925603008 2:5628351-5628373 GACTCCTCTTGGCTACCTGGGGG + Intergenic
925674528 2:6346947-6346969 GAACCCTCTGAATTACCTGGAGG + Intergenic
926982246 2:18584661-18584683 GATCCCCCTGCGCTGGCTGGAGG + Exonic
927647538 2:24887474-24887496 GAACACTCGGGGCTGCCAAGAGG + Intronic
928896363 2:36268919-36268941 GAAGCCTCTGGGCTTCTTGCAGG + Intergenic
931587009 2:63840608-63840630 GAAGCGTCTGGGCTCCCTCGGGG + Intergenic
931789840 2:65654858-65654880 GAACACTATGGGCTGGCAGGTGG - Intergenic
932736676 2:74259432-74259454 GGGGACTCTGGGCTGCCTGGGGG - Intronic
934622923 2:95826520-95826542 AAACCCTCTGAGTTCCCTGGGGG - Intergenic
934810848 2:97275583-97275605 AAACCCTCTGAGTTCCCTGGGGG + Intergenic
934826844 2:97432356-97432378 AAACCCTCTGAGTTCCCTGGGGG - Intergenic
935832591 2:107016043-107016065 GAACCCTCGTGCCTTCCTGGTGG - Intergenic
943611320 2:190038316-190038338 GCACCCTCTTGGATACCTGGTGG + Intronic
946465077 2:219904603-219904625 GAGGCCTCCGGGGTGCCTGGGGG + Intergenic
948386900 2:237586095-237586117 GAACACACGGGGCTGGCTGGGGG + Exonic
1168805927 20:672323-672345 GCACCCTCTGTTCTGCCTGGCGG + Intronic
1168808639 20:688535-688557 GATCCCTCTGGGCTGGGTTGGGG - Intergenic
1169135514 20:3194899-3194921 GAACCCTGTGGGCTTGCTAGGGG - Intronic
1169168476 20:3443650-3443672 GAACAGTCTGTGCTACCTGGAGG + Intergenic
1170139458 20:13111267-13111289 ATACTCTCTGGGCTGGCTGGAGG - Intronic
1170792074 20:19516702-19516724 GAGCTCTCTGGGCTGCCACGTGG - Intronic
1173528341 20:43749885-43749907 GCAGCCTCTGGGCTCCCTGAAGG - Intergenic
1173728095 20:45310823-45310845 AAACACTCTGGCCAGCCTGGTGG + Intronic
1174373879 20:50112838-50112860 GGGCCCTCTGTGCTGTCTGGGGG - Intronic
1174842607 20:53914407-53914429 GAGCACACTGGGATGCCTGGTGG + Intergenic
1176215184 20:63944520-63944542 GAGCCTGCTGGGCTGCCTGTTGG - Intronic
1179251530 21:39675002-39675024 GAAGGGGCTGGGCTGCCTGGAGG - Intergenic
1180968241 22:19801526-19801548 GAAGCCTCAGGGCCACCTGGCGG - Intronic
1181616934 22:24061316-24061338 GAACATTCAGGGATGCCTGGTGG + Intronic
1182352659 22:29707513-29707535 GAAGCCTCTGAGCTGACTCGAGG + Intergenic
1183328632 22:37207644-37207666 GATCCCCCTGGTCTACCTGGTGG - Exonic
1183454702 22:37916139-37916161 GCCCTCTCTGGGCAGCCTGGTGG + Intronic
1183600958 22:38840439-38840461 AGACCCTTGGGGCTGCCTGGAGG + Intronic
1184607645 22:45583231-45583253 GAGCCCTTAGAGCTGCCTGGGGG - Intronic
1184668703 22:46001800-46001822 CAGCCCTCTTGGCTCCCTGGGGG - Intergenic
1185182330 22:49370491-49370513 AATCCCTGTGGACTGCCTGGAGG + Intergenic
1185413898 22:50699500-50699522 GAACCCTCAGGGGTCCCGGGAGG + Intergenic
950492544 3:13314729-13314751 ATTCCCTCTGGGCTGTCTGGTGG - Intergenic
952312392 3:32201745-32201767 GAAACCACTCTGCTGCCTGGTGG + Intergenic
953660442 3:44887800-44887822 GCACCCACTGGGCTGGCGGGTGG + Intronic
954419120 3:50409299-50409321 GGACCCTGGGGGCTGCCTGAAGG + Intronic
955015022 3:55061857-55061879 GAAGCACCTGGGCTGCCTGAGGG + Intronic
955223768 3:57044548-57044570 CAAACCTGTAGGCTGCCTGGTGG - Intronic
955762201 3:62298807-62298829 GAACCCACTGGGCTGTGTGCTGG - Intergenic
958460033 3:94383175-94383197 AAACCCTCTGGGCTCCATGCAGG - Intergenic
958557267 3:95696073-95696095 GAAACCTGAGAGCTGCCTGGTGG - Intergenic
959654851 3:108791650-108791672 GAACTCGCTGGGTTTCCTGGAGG - Intergenic
960591187 3:119367526-119367548 GAACCTTCTAGGCTGCCTGATGG - Intronic
961031937 3:123613712-123613734 GAACCCTCTGGGCTGAGCTGTGG + Exonic
961065441 3:123871088-123871110 GAAGCCTCAGGGCTCCCTGCTGG + Intronic
961357959 3:126350924-126350946 GGAATCTCTGGCCTGCCTGGGGG - Intronic
961461522 3:127053108-127053130 GCACCCACTGGGCTGCCTGCAGG - Intergenic
962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG + Intronic
963007871 3:140742748-140742770 GTACCCTCTGGACAGCCTGGTGG - Intergenic
964821551 3:160775883-160775905 GAACCATATCAGCTGCCTGGGGG + Intronic
967118155 3:186360757-186360779 GACCCCTCTGGTCTGGATGGGGG - Intronic
967252795 3:187560266-187560288 GATTCCACCGGGCTGCCTGGTGG - Intergenic
967891089 3:194365101-194365123 CGACGCTCTCGGCTGCCTGGGGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969906709 4:10403852-10403874 GACCCCTCAGTGCTTCCTGGTGG - Intergenic
973034680 4:45391033-45391055 GAACCCTCTGGGCTCCATGCAGG + Intergenic
974069365 4:57110201-57110223 GCCCCCGCTGGGCTGCCTGCTGG - Exonic
976140213 4:81983772-81983794 AAACCCTCTGTCCTCCCTGGAGG + Intronic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
982465282 4:155722852-155722874 GAACCCACTGAGGTGGCTGGAGG - Intronic
986645879 5:9915547-9915569 GTTCCCTCAGGGCTGCCTGTTGG + Intergenic
991647413 5:68815086-68815108 GAACCTGCTGGACTTCCTGGAGG + Intergenic
991930396 5:71748416-71748438 GCATCCTCTGAGCTGCCTGCGGG + Intergenic
995016668 5:107317692-107317714 GCAGCCTCTGGGCTATCTGGGGG + Intergenic
995047603 5:107669815-107669837 GAACCCACTGGGGTGGGTGGAGG + Intronic
999226607 5:150030598-150030620 GAGCCCTCTGGACTGCCAGTTGG - Intronic
1000656104 5:163880032-163880054 GATCAATCTGGGCTGCTTGGAGG + Intergenic
1002200368 5:177524496-177524518 GGAACCTCTAGGCTGGCTGGGGG + Exonic
1002412120 5:179089229-179089251 GAACCCAGTGGGGTTCCTGGAGG + Intergenic
1007079328 6:39087555-39087577 GAACCCTCTGCTCTCCCCGGAGG - Exonic
1007368562 6:41411685-41411707 GGACCCTCGTGGCTGCCTGCTGG + Intergenic
1007618491 6:43196838-43196860 GCACGCTCAGGGCTGCCCGGCGG - Exonic
1011041778 6:83037264-83037286 GAACACACTTGGCAGCCTGGAGG - Intronic
1012277639 6:97293218-97293240 GAACCCCCTTCTCTGCCTGGTGG - Intergenic
1018736342 6:166689613-166689635 GGTCCCCCTGGCCTGCCTGGGGG - Intronic
1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG + Intergenic
1019616890 7:1967621-1967643 GAAGGCTCCGGGCTCCCTGGAGG + Intronic
1023103218 7:36739795-36739817 GAGCCCTCTGCACTGCCTGCTGG + Intergenic
1023513248 7:40975684-40975706 GAACCCTGTGGGCTGCAAGATGG - Intergenic
1023785698 7:43705693-43705715 AAACCCTCTGGGCTCCATGCAGG + Intronic
1024233386 7:47379753-47379775 TCACCCTCTGAGCTGCCAGGAGG + Intronic
1024244708 7:47460469-47460491 GAAAGCTCTGAGATGCCTGGTGG + Intronic
1024281512 7:47723081-47723103 GAACCCCATGGGCTGGATGGCGG - Intronic
1025021163 7:55481257-55481279 GAGCCCGCTGGGCAGCCAGGAGG + Intronic
1031979137 7:128113073-128113095 GACTCCTCTGGGCTCCCTGTGGG + Intergenic
1032536928 7:132672175-132672197 CAACCCACTGGGCCGCCTGTGGG + Intronic
1032683642 7:134209755-134209777 GAAGACTGTGGGCTGCCTGGGGG - Intronic
1035018534 7:155787313-155787335 GGACCCTCGGGGCAGCCAGGCGG - Intergenic
1036201237 8:6773196-6773218 CACCCCTGGGGGCTGCCTGGTGG + Intergenic
1038162173 8:25050132-25050154 GAACCCTCTGGCCTCTCTGCTGG - Intergenic
1039894575 8:41707423-41707445 CAAGCCTCTGGGCAGCCTGCGGG - Intronic
1039911863 8:41832684-41832706 GAACCCTCTGGGAACCCTGGGGG - Intronic
1042039333 8:64576260-64576282 GCCCACTCGGGGCTGCCTGGTGG - Intergenic
1043147215 8:76673765-76673787 GAACTCTCTGGAATGTCTGGAGG + Intergenic
1046711283 8:117514675-117514697 GAACCCACTGTGCTGACTTGTGG + Intergenic
1049170261 8:141155941-141155963 TAAACGTCTGGGCTGCCAGGAGG - Exonic
1049371104 8:142267778-142267800 TAAACATTTGGGCTGCCTGGGGG + Intronic
1049604093 8:143521105-143521127 GAACCCTCTGGGCTGGGCAGGGG - Intronic
1049665901 8:143842375-143842397 GCACCCTCTGGGCTGCGGGTTGG - Intergenic
1050336880 9:4597878-4597900 GAGCCCGCTGGGCTCTCTGGAGG - Intronic
1052995523 9:34549914-34549936 GAACCCTGAGTTCTGCCTGGGGG - Intergenic
1055990771 9:82102798-82102820 AAACCTTCTGGGCTCCATGGAGG + Intergenic
1057004671 9:91546837-91546859 GAACCTGCTGGGGTTCCTGGAGG - Intergenic
1057190374 9:93083939-93083961 GCTCCATGTGGGCTGCCTGGCGG - Intronic
1057310910 9:93942697-93942719 GAACCCGCTGAGCTGCCCAGCGG + Intergenic
1058887572 9:109333147-109333169 GAACCCTCAGGCATTCCTGGTGG + Intergenic
1061288543 9:129637990-129638012 CCACCCTGTGGGCAGCCTGGCGG - Exonic
1061291000 9:129650148-129650170 AAACCCTCCTGGCTGTCTGGGGG + Intergenic
1061610270 9:131740959-131740981 GGAGCCTCTGGGCTGGCAGGAGG - Intergenic
1061990536 9:134156334-134156356 GAAGCCTCAGGCCTGGCTGGAGG + Intronic
1062035033 9:134379228-134379250 GATCCCTGTGGGCTCCCTGAGGG + Intronic
1062278187 9:135740427-135740449 AGCCCCTCTGGGCTGACTGGGGG - Intronic
1062365361 9:136205619-136205641 CACCCCTCCGGGCTGCCAGGAGG + Intergenic
1062421913 9:136486736-136486758 CCACCCTCTGGCCAGCCTGGTGG - Intergenic
1062507450 9:136885450-136885472 GAGTCCTGTGGGCTGCATGGGGG - Intronic
1062513820 9:136922291-136922313 GAACAGTCTGGGCAGCCTGCAGG + Intronic
1062596970 9:137303869-137303891 GGAGCCGCTGGGCTGCCTGCTGG + Intergenic
1186466451 X:9787012-9787034 GCACCTGCGGGGCTGCCTGGAGG + Intronic
1187859561 X:23667898-23667920 GCACCCCCTGGGCTGCCTCCGGG + Intronic
1189259495 X:39668393-39668415 CAACCCTGTGGGCTGCCTATGGG + Intergenic
1189510391 X:41656085-41656107 GAACCCTGTGTGCTCCCTCGAGG + Intronic
1190152301 X:47958463-47958485 CAACCCCCTGGGCAGACTGGCGG - Intronic
1190249511 X:48711607-48711629 GAGGTCTCTGGGCTGTCTGGTGG - Intergenic
1190604478 X:52126651-52126673 AAACCCTCTGGGCTCCATGCAGG - Intergenic
1191604905 X:63050733-63050755 GAATCGTCTGGTCTGCCTGGAGG - Intergenic
1192584039 X:72306373-72306395 GAACCCTCCGGCCCGCCTGGCGG + Intronic
1195971725 X:110480571-110480593 AAACCCTCTGGGCTCCATGCAGG + Intergenic
1197785091 X:130190852-130190874 CAACCCACTGGGCTTCCTGGAGG - Intergenic
1199827865 X:151517100-151517122 AAACCCTCTGGGCTCCATGCAGG + Intergenic