ID: 977851081

View in Genome Browser
Species Human (GRCh38)
Location 4:101830574-101830596
Sequence AACCTTGAACTGCTACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977851081 Original CRISPR AACCTTGAACTGCTACTGAC TGG (reversed) Intronic
902297704 1:15479759-15479781 AACCTTGAGCAGAGACTGACAGG + Intronic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
903934988 1:26889532-26889554 AATCTGGCTCTGCTACTGACTGG - Intronic
903945884 1:26962146-26962168 AACACGGAAATGCTACTGACAGG + Intergenic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
911836814 1:102630198-102630220 CACCTTGAACTGCTGCTGGCTGG - Intergenic
918661009 1:187088995-187089017 AACTTTGAAGTGCTAGTCACAGG - Intergenic
923966387 1:239144655-239144677 AAACTTGAACTGTTACTAAAAGG + Intergenic
1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG + Intergenic
1082834449 11:57641241-57641263 AACATTGCACTGCTAGTGACAGG - Intergenic
1084893625 11:72249976-72249998 AACCTAGTACTGCAACTGGCAGG - Intergenic
1090487021 11:127122278-127122300 AACCTTGAATTCCAAGTGACTGG + Intergenic
1091928856 12:4378615-4378637 TAGCTTGACTTGCTACTGACTGG + Intronic
1095513803 12:42983620-42983642 AAACTGGAAATGCTACTGTCTGG + Intergenic
1096530265 12:52238141-52238163 AAGCTTAAACTCCTACGGACAGG - Intronic
1102073188 12:110038689-110038711 AACCTTGTATTGCTACTGATGGG - Exonic
1103240736 12:119411327-119411349 AACCTAGAAAGGCTACTGTCTGG - Intronic
1103737998 12:123072667-123072689 AACCTTGAGCAGCTGTTGACAGG - Intronic
1108324137 13:49313616-49313638 AACCACGATCTGATACTGACTGG + Intronic
1109624846 13:64961761-64961783 AACCCTGACCTGATACTTACTGG + Intergenic
1113095834 13:106663005-106663027 AACCCAGGACTGCTATTGACGGG - Intergenic
1115061114 14:29191277-29191299 AACCTGAAACTGCAACTGAAAGG - Intergenic
1115170527 14:30500438-30500460 AGCCTTGAAGTGCTATTCACTGG - Intergenic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1115935528 14:38548071-38548093 AACCTGGAGTTGCTACTGGCAGG + Intergenic
1117098232 14:52318697-52318719 AACCTAGAACTACTAATGTCAGG + Intronic
1118064480 14:62175899-62175921 AACCATGAACAACTACAGACAGG - Intergenic
1141602005 16:85132699-85132721 AACCTTGAATGGCTATTTACAGG + Intergenic
1145899733 17:28482793-28482815 AACCTTGAGCGGGTACTGAGGGG - Intronic
1146765788 17:35520309-35520331 AACCATGGACTGCTTCTGGCTGG + Intronic
1147912713 17:43865802-43865824 CACCTTGAAGTGATACTGGCGGG - Intergenic
1156567111 18:38204307-38204329 AACCTTCATATGCTACTGATTGG - Intergenic
1159354408 18:67319063-67319085 AACCTTTAATTGTTTCTGACTGG - Intergenic
1163644845 19:18483298-18483320 AACCCTGCACTGCAACTGCCAGG - Intronic
1166713890 19:44954473-44954495 ACCCTTGTGGTGCTACTGACTGG - Intergenic
936733586 2:115412774-115412796 AACCTTTAACTCTTACTGAGAGG + Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1180697953 22:17765463-17765485 AACCTTGGACTGATACTAAATGG - Intronic
1182064045 22:27417812-27417834 AGCCCTGAACTGCAACTGATGGG + Intergenic
950999997 3:17547034-17547056 CACCTAGATCTGCTACTGATTGG - Intronic
954406040 3:50345551-50345573 GACCTGGAACTGCTGCTGCCCGG - Exonic
959914630 3:111802859-111802881 AACCTTTAACTTTTCCTGACAGG - Intronic
960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG + Intronic
968076963 3:195821296-195821318 AAGGTTGACCTGCTATTGACTGG + Intergenic
969177830 4:5412685-5412707 ATCCTTCAAGTGCTACTGAGAGG - Intronic
970225108 4:13849670-13849692 AAACCTGAACTGCTACCAACCGG + Intergenic
972051004 4:34733302-34733324 AACCATGGAATGCTAATGACAGG - Intergenic
975904078 4:79188807-79188829 AAGCTTCCACTGCTACTGAGAGG - Intergenic
976315670 4:83656347-83656369 AACCTAGCACTGCTACTTATTGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979543542 4:121914332-121914354 AACCTTGGATTTCTTCTGACAGG + Intronic
981866481 4:149426241-149426263 AACCAGGAACTCCCACTGACTGG - Intergenic
982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
990620509 5:57554119-57554141 AACCTTGAGATTCTACTTACAGG + Intergenic
992073535 5:73170605-73170627 AAACTGGAACTGTTACTGCCAGG + Intergenic
995990759 5:118236314-118236336 AACCTCAAGCTGCTACTTACTGG + Intergenic
997250063 5:132381820-132381842 AACCCTGAACTGCCAAGGACTGG + Intronic
997405837 5:133645885-133645907 CACCTTGAACTGGGACTAACTGG + Intergenic
1002952374 6:1826983-1827005 AACCTTGAACTCCTACGCTCAGG - Intronic
1005077867 6:21926232-21926254 AAACATGAACTGCTGCTGTCTGG - Intergenic
1008270571 6:49483974-49483996 AAAATAGGACTGCTACTGACAGG - Intronic
1008567220 6:52781201-52781223 AACCTTGAATGGCTTCTGTCTGG + Intergenic
1008570662 6:52813521-52813543 AACCTTGAATGGCTTCTGGCTGG + Intergenic
1019842936 7:3466533-3466555 AGCCTTGCACTGCTTCTGGCAGG + Intronic
1021299316 7:18952784-18952806 AACCTTGTACTGCCACAGAGCGG + Intronic
1024696008 7:51857366-51857388 AACCCTGACCTGATCCTGACAGG + Intergenic
1028708274 7:93876055-93876077 AACATTTAACTGCTAATAACAGG - Intronic
1034541017 7:151758197-151758219 ACCCAGTAACTGCTACTGACAGG - Intronic
1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG + Intronic
1037799838 8:22026327-22026349 AACCATTCACTGCTAGTGACAGG + Intronic
1038231079 8:25700848-25700870 GACCATGAACTGGTTCTGACTGG + Intergenic
1044345341 8:91098158-91098180 CACCTTGAACTTCTATGGACAGG + Intergenic
1045761784 8:105617328-105617350 AAACTTGAACTTCTGCTGGCAGG + Intronic
1048760778 8:137792685-137792707 AGGCTTGGACTGCTAATGACTGG - Intergenic
1050871546 9:10577446-10577468 AACCTCCAACTGATATTGACTGG + Intronic
1051757035 9:20412861-20412883 AACCTTACACTTCTAGTGACAGG - Intronic
1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG + Intronic
1058663266 9:107284459-107284481 CCCCTTGAACTGCTACTGTTTGG - Intronic
1059490914 9:114666684-114666706 AAACTTAAACCGCTACTGCCAGG - Intergenic
1062610125 9:137369791-137369813 CACTTTGAACTGCCTCTGACGGG - Intronic
1187431290 X:19227720-19227742 AACTAAAAACTGCTACTGACTGG + Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1192763822 X:74123101-74123123 AACCTTTCACTGCTATTGATGGG + Intergenic
1192923709 X:75734469-75734491 AAGTTTGAACTGCTGCTGGCTGG + Intergenic