ID: 977859586

View in Genome Browser
Species Human (GRCh38)
Location 4:101940716-101940738
Sequence GAGGAGAAAGACCATGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 10, 3: 78, 4: 734}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977859586 Original CRISPR GAGGAGAAAGACCATGGAGG TGG Intronic
900502321 1:3012541-3012563 GAGAGGCAGGACCATGGAGGAGG - Intergenic
900697321 1:4020458-4020480 ATGGAGAATGACCGTGGAGGGGG - Intergenic
901026336 1:6280550-6280572 GAGGAGAAAGGCCAAGGGGCTGG + Intronic
901295464 1:8157804-8157826 GAGGAGGAAGAAGAAGGAGGAGG + Intergenic
901755982 1:11441863-11441885 GAGGAGGAAGATGAGGGAGGAGG + Intergenic
901762115 1:11478474-11478496 AAGGAGAAAGAGCCTGGGGGAGG - Intergenic
901881358 1:12195691-12195713 GAGGAGGAGGACAAGGGAGGGGG + Intronic
902139710 1:14342679-14342701 GAGGAGAAAGAGGTTGGGGGAGG + Intergenic
902563463 1:17294112-17294134 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
902714721 1:18264774-18264796 GAGGAGACAGAGCATAGAGGAGG - Intronic
903220958 1:21869512-21869534 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
903269621 1:22179142-22179164 GAGGAGAATGGCCATAGGGGAGG - Intergenic
903772170 1:25770805-25770827 GAGAAGAAAGAAAATGGGGGTGG - Intronic
904894457 1:33803745-33803767 AAGGAGAAAGACCAGTTAGGAGG - Intronic
905469267 1:38179576-38179598 GAGGAGACAGAACGTGGAGCTGG - Intergenic
905866135 1:41377728-41377750 GAGGCCAGAGGCCATGGAGGAGG - Intronic
906102358 1:43271705-43271727 GAGCAGAAAGACCAGTGAGGAGG + Intronic
906180845 1:43817591-43817613 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
906843487 1:49164946-49164968 GAGTAGAGAGACTATGGAGCTGG - Intronic
907531647 1:55104779-55104801 GAGGACAATGGCCATGGAGCTGG + Intronic
907761106 1:57361312-57361334 AATGAGAAAGAGCATGGACGTGG + Intronic
907934266 1:59028187-59028209 GAGAACAAAGGCCATGGGGGAGG + Intergenic
908491508 1:64648924-64648946 GAAAAGTAAGAACATGGAGGAGG - Intronic
909070299 1:70985647-70985669 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
909771374 1:79426314-79426336 GAGGAGAAAGGCGATGAAGCAGG + Intergenic
909976929 1:82056737-82056759 GAGGAGAAGGACAATGGCAGGGG - Intergenic
910333027 1:86097585-86097607 AAGGAGAAGGACGAGGGAGGAGG - Intronic
910554598 1:88517452-88517474 GAGAAGAAAGAAGAAGGAGGAGG + Intergenic
910865529 1:91784880-91784902 GAGGATGAAGACAATGAAGGGGG - Intronic
911105567 1:94128810-94128832 GAAGAGCAAGACCCTGGAGATGG + Intergenic
911710804 1:101070497-101070519 GAGAAGAAAGAGAAAGGAGGTGG - Intergenic
912331277 1:108822251-108822273 GAGCAGACAGAAAATGGAGGGGG - Intronic
913026686 1:114850291-114850313 GAGGAAAAAAAACAGGGAGGAGG - Intergenic
913380201 1:118202254-118202276 CAGGAGCAAGAGCATGAAGGGGG + Intergenic
913960585 1:143335752-143335774 GAAGACAAAGGCCATGGAGAGGG + Intergenic
914249107 1:145907210-145907232 AAAGGGAAAGAGCATGGAGGTGG + Intronic
914442677 1:147720934-147720956 GGGGAGAAAGACCATGGAATAGG - Intergenic
916368190 1:164057772-164057794 GAGAAGAAAGAGGAAGGAGGAGG - Intergenic
916512206 1:165482375-165482397 AAGGAGAAAAACCACAGAGGAGG + Intergenic
916550144 1:165842259-165842281 GAGAATACAGAACATGGAGGGGG - Intronic
916853631 1:168727944-168727966 GAGGAGGCAGTCCAGGGAGGAGG - Intronic
916934480 1:169613455-169613477 GAGGAGACAGATGATAGAGGGGG + Intronic
916946839 1:169737809-169737831 GAGGGGAAAGAGCAAGCAGGAGG - Intronic
917176319 1:172239605-172239627 GGAGACAAAGACCATGGAAGAGG - Intronic
918047462 1:180950108-180950130 ATGGAGTTAGACCATGGAGGAGG + Exonic
919422327 1:197385478-197385500 GAGGAGAAAGACTCTGGAGGAGG - Intronic
919682359 1:200448266-200448288 GAAGAGAAATACCAGGCAGGTGG + Intergenic
920739713 1:208569041-208569063 ATGGGGAAAGACCCTGGAGGGGG + Intergenic
920926094 1:210343229-210343251 GGGCAGAAAGAGCAGGGAGGAGG - Intronic
921163928 1:212492373-212492395 GATGAGAAAGGAGATGGAGGAGG + Intergenic
921221442 1:212976810-212976832 GGGGAGAAAGACCAGGGAAAGGG + Intronic
921226406 1:213024346-213024368 GAGGAGAGAGAGCAGGGACGGGG - Intergenic
921525350 1:216210449-216210471 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
922180869 1:223231728-223231750 GAGGAGAAGCAGCACGGAGGAGG - Intronic
922249476 1:223834960-223834982 GAGGAGGAAAACCAGGGAGGAGG - Intronic
922474751 1:225899231-225899253 GAGGAGGAGGACCAGGTAGGAGG - Intronic
922574888 1:226654943-226654965 GAGGAGGAAGAGGAGGGAGGAGG + Intronic
923373037 1:233331394-233331416 CAGGATAAAGACCATGTATGAGG - Intronic
923882289 1:238116957-238116979 GAGGAGGAAGTCCATGCAGGTGG - Intergenic
923900956 1:238325935-238325957 GAGTAGAATGAGCAGGGAGGAGG + Intergenic
924074911 1:240323761-240323783 GAGGAGGAAGAACAGGAAGGAGG - Intronic
924306835 1:242698271-242698293 GAGAAAAAAGTCAATGGAGGTGG + Intergenic
924560590 1:245154519-245154541 GAAGAGAAAGAACTTGGGGGCGG + Intergenic
924721721 1:246629237-246629259 GAGCAGAAAGAACATGGGGTTGG - Intronic
924903879 1:248431926-248431948 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
924923990 1:248660079-248660101 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1062795699 10:343428-343450 GAGGTGAGAGAACTTGGAGGTGG + Intronic
1062900276 10:1138898-1138920 GAGGAGAAAGAGAAAGGATGAGG + Intergenic
1063201489 10:3788202-3788224 GAGAAGAAAAACAGTGGAGGAGG - Intergenic
1063233417 10:4088366-4088388 GAGGTGACTGATCATGGAGGTGG - Intergenic
1063233441 10:4088518-4088540 GAGGTGACTGATCATGGAGGTGG - Intergenic
1063267278 10:4467418-4467440 GAGGAGATAGAACAAAGAGGAGG - Intergenic
1063434256 10:6017955-6017977 GATTAGAGAGAGCATGGAGGGGG + Intronic
1064272671 10:13879669-13879691 GAAGAGAAAGAAGAAGGAGGAGG - Intronic
1064297150 10:14089081-14089103 GAGGAGGAAGCCCATGGAGTTGG + Intronic
1064325299 10:14345312-14345334 GGGGAGAAAGATCACGGAGGTGG - Intronic
1065325399 10:24546154-24546176 GAGGAAAATGACAAAGGAGGGGG - Exonic
1065480567 10:26189612-26189634 GAGGAGAAAGTCCATTTGGGGGG + Intronic
1065672759 10:28139191-28139213 GGGTAGAAAGAGCATGGAGGAGG + Intronic
1065727495 10:28679819-28679841 GAGGAGAAAGAGCAGAGAAGTGG + Intronic
1066100674 10:32115695-32115717 GAGGAGGAAGAAGAAGGAGGAGG - Intergenic
1066379531 10:34889471-34889493 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1066388964 10:34963616-34963638 GAAGAGAAAGCCCATGGAGAGGG + Intergenic
1067534468 10:47098924-47098946 GATCACAAAGACCATGGACGAGG + Intergenic
1068416472 10:56729677-56729699 GAGGAGAAAGTCAGTGGAGCAGG - Intergenic
1068853696 10:61774282-61774304 GAGAGGAGAGAACATGGAGGAGG - Intergenic
1069780039 10:70949623-70949645 GAGGAGAGGGACCTGGGAGGGGG + Intergenic
1069931536 10:71885436-71885458 AAGGAGAAAGAGCAGGCAGGAGG - Intergenic
1070019265 10:72567818-72567840 GACTAGAAGGACCCTGGAGGAGG - Intronic
1070398709 10:76034358-76034380 GAGGAAAAAGAGAAAGGAGGAGG + Intronic
1070605961 10:77898719-77898741 CAGGAGCCAGGCCATGGAGGGGG - Intronic
1070680553 10:78446086-78446108 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1071003053 10:80852906-80852928 GATGATAATGAACATGGAGGAGG + Intergenic
1071157606 10:82709059-82709081 GAGAAGAGAGGACATGGAGGGGG - Intronic
1071396150 10:85225964-85225986 GAGCAGAGAGAGCATGGAGGGGG + Intergenic
1071570653 10:86694947-86694969 GAGGAGAAAGAGAAGGTAGGTGG - Intronic
1071787820 10:88922152-88922174 GAGGAGAGAAACCCAGGAGGAGG - Intronic
1072749148 10:97964310-97964332 GTGCAGAATAACCATGGAGGAGG - Intronic
1072930167 10:99655676-99655698 GAGAAGAATGCCCAGGGAGGAGG - Intergenic
1073371661 10:102995196-102995218 GAGGAGGAAGAGGAAGGAGGAGG - Intronic
1074430421 10:113389684-113389706 GAGGAAAGAGGCCATGGAGAGGG - Intergenic
1074853340 10:117455999-117456021 AAGGAGAAAGAGCAAGCAGGAGG + Intergenic
1074963566 10:118469363-118469385 GCGGAGAAGGTTCATGGAGGTGG + Intergenic
1075335846 10:121608589-121608611 GGGGAGAAAGACCATCAAGTGGG + Intergenic
1075602600 10:123781378-123781400 GAGGAGCAAGAACAAGAAGGAGG + Intronic
1077198355 11:1292893-1292915 GAGGAGAACGGCCAGGGAAGAGG + Intronic
1077864685 11:6212269-6212291 GAGGAGAAATAGCTTGGTGGTGG - Intronic
1078120518 11:8504104-8504126 GAGGAGATAAAACATGGAGCGGG - Intronic
1078423040 11:11228114-11228136 CAGTAGAAAGAACATGGAGGAGG - Intergenic
1078593375 11:12665240-12665262 GAGGAGAAAGAAGGAGGAGGTGG + Intergenic
1078612942 11:12837732-12837754 GAGGAGGAAGAAGAAGGAGGAGG - Intronic
1078648584 11:13166074-13166096 GAAAAGAAAGAGCATGGGGGAGG + Intergenic
1078676058 11:13415490-13415512 GGGGAGAAGGAGCAGGGAGGAGG - Intronic
1078729084 11:13959679-13959701 AAGGAGAAAGAAGAAGGAGGAGG + Intergenic
1079810943 11:24999340-24999362 GAGGAAAAAGAAGAAGGAGGAGG + Intronic
1080219606 11:29886078-29886100 AAGGAAAAAGACCAAGCAGGAGG - Intergenic
1080300139 11:30775142-30775164 GAGGATACAGACCACGGAGGAGG + Intergenic
1080494865 11:32807056-32807078 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1080608440 11:33884194-33884216 GAGGAGAAAGAGCCTGGTGCTGG + Intronic
1080894219 11:36435646-36435668 GAGGATCAAGACCCAGGAGGAGG + Intronic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1082090875 11:48088800-48088822 CAGTAGAAAAACCAAGGAGGGGG - Intronic
1082637581 11:55615227-55615249 CCGGAGAAAAACCATGGAGGAGG + Intergenic
1082762090 11:57136897-57136919 GAGGAGGAAGAGGAAGGAGGAGG + Intergenic
1083014311 11:59437108-59437130 GGGGAGATTGATCATGGAGGAGG - Intergenic
1083179894 11:60978433-60978455 GAGGAGAAGGAACCTTGAGGAGG + Intronic
1083252134 11:61475226-61475248 GAGGGGAAGGACCTTGGAAGGGG + Intronic
1083274920 11:61591406-61591428 GAGGAGGAGGCCCAAGGAGGAGG - Intergenic
1084395167 11:68904512-68904534 GCGGGGAAAGAGCCTGGAGGAGG + Intronic
1084429328 11:69102501-69102523 AAGGAGAAAAAGCAGGGAGGGGG - Intergenic
1084715799 11:70872682-70872704 GAGGAGATACACCAGGGAGCCGG - Intronic
1085251529 11:75147308-75147330 GGGGCGAAAGAGCCTGGAGGTGG + Intronic
1085336710 11:75702158-75702180 GGGCAGAAAGATCAGGGAGGTGG + Intergenic
1085383199 11:76139235-76139257 GAGGAGAGAGAGCAGGGAGCTGG + Intronic
1085474138 11:76778948-76778970 CAGGGGAAAAAGCATGGAGGTGG + Intergenic
1085621366 11:78040282-78040304 AAGGAAAAAGAACATGGAGCAGG - Intronic
1085807674 11:79651147-79651169 GAAGAGAAAGAACGAGGAGGAGG - Intergenic
1086871450 11:92042256-92042278 GAGAAGGAAGAGCATGGATGAGG - Intergenic
1086998905 11:93392942-93392964 GAGGAGGAAGAGGAGGGAGGAGG - Intronic
1086998919 11:93392988-93393010 GAGGAGAAAGAAGGAGGAGGAGG - Intronic
1087081324 11:94173691-94173713 AAGGAGAGAGACCAGGCAGGAGG - Intronic
1088129277 11:106467587-106467609 GAGGAGGAAGTCCATTCAGGTGG - Intergenic
1088578640 11:111296883-111296905 GAGGGGAAGGACAATGGGGGTGG - Intergenic
1088949624 11:114554313-114554335 GAGGAAAGAGAACCTGGAGGAGG - Intronic
1089419498 11:118320491-118320513 GGGGAGAGACACCACGGAGGTGG - Intergenic
1090202604 11:124866837-124866859 GGGGAGAAAGACGATGGGGGAGG + Intronic
1090527329 11:127551514-127551536 AAGAAGAAAAACAATGGAGGAGG - Intergenic
1090618228 11:128536667-128536689 GAGGAGAAAGAGCTTGGAATTGG + Intronic
1091382326 12:69964-69986 CAGGAGCAATACCAGGGAGGGGG - Intronic
1092080825 12:5714662-5714684 GAGGAGGAAGAAGAAGGAGGAGG - Intronic
1092944101 12:13437086-13437108 CAGGAGAAAAGCCATGGATGTGG - Intergenic
1093530405 12:20155052-20155074 GAAGAGAAAGAAGAAGGAGGAGG + Intergenic
1093954449 12:25200304-25200326 GAGAAAAAAGAAAATGGAGGAGG + Intronic
1095196861 12:39329458-39329480 GAGGAGAAAGATGAAGAAGGGGG + Intronic
1096131381 12:49161502-49161524 AAGGAGAAAGAGCAAGCAGGAGG + Intergenic
1096200887 12:49681965-49681987 CAGGAGAAAGACCCTGTAAGTGG + Intronic
1096281370 12:50257581-50257603 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1096367000 12:51036471-51036493 GAGGAGAAAAAGCTTGGAGTGGG + Intergenic
1096568393 12:52500650-52500672 GTGTAGAAAGAGCAGGGAGGAGG + Intergenic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096760484 12:53837654-53837676 GATGAGAAAGAACATACAGGGGG - Intergenic
1097342637 12:58456379-58456401 GAGCAGAAAGGCAATGGAGCTGG + Intergenic
1098495864 12:71135216-71135238 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
1098850848 12:75594259-75594281 GAGGAGAAAGGCAATGGAGAGGG - Intergenic
1099051427 12:77785746-77785768 CATGAGAAAGACCATGAAGCAGG - Intergenic
1099101642 12:78448649-78448671 GAGGATTAAGGCCAGGGAGGAGG - Intergenic
1099761202 12:86922437-86922459 GAGGAGAAAGTCCATTCAGATGG + Intergenic
1100021538 12:90074994-90075016 GAGGAGGAAGAGGATGAAGGAGG - Intergenic
1100551972 12:95654563-95654585 GAGGAGAAAGTGCATGTAGCAGG + Intergenic
1101365393 12:104065135-104065157 TAGGAGGAAGACCATCTAGGGGG + Intronic
1101856533 12:108448168-108448190 AAGGAGAAAGAGCAAGGAGTGGG - Intergenic
1102071265 12:110021912-110021934 CAGGAGAAAGGCTATGAAGGTGG - Intronic
1102230330 12:111257497-111257519 GAGGAGGAAGAAGAGGGAGGGGG - Intronic
1102230361 12:111257614-111257636 GAGGAGGAAGAGCAGGGAGGAGG - Intronic
1102295256 12:111731349-111731371 GTGGAGAAAGAAGATGGAGGAGG - Intronic
1102490167 12:113285825-113285847 GAGGAGACCGAGCATGGGGGAGG + Intronic
1102559917 12:113754656-113754678 AAGCAGAGAGACCAGGGAGGAGG + Intergenic
1102571931 12:113832012-113832034 GAGGAGAAAAATCAAGGAGAGGG - Intronic
1102807465 12:115794542-115794564 GAGAAGAGTGACCAAGGAGGTGG + Intergenic
1102976018 12:117207726-117207748 GAGGAGAAGGAGCAGAGAGGAGG - Intergenic
1103044842 12:117727465-117727487 GAGGAGAAAGAAGAAGGAGGAGG + Intronic
1103720583 12:122973166-122973188 GAGGAGAGGGTCCATGGAGAGGG + Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1104182897 12:126399490-126399512 GAGGAGAAAGGCCAGTGTGGTGG - Intergenic
1104386140 12:128353297-128353319 GAGGAGAAAGACCAGAGATGTGG + Intronic
1104609335 12:130215574-130215596 GAGGATAAAGAAGAGGGAGGGGG - Intergenic
1105899885 13:24745220-24745242 GAGGAGAGAGAGGAGGGAGGTGG - Intergenic
1106218817 13:27727550-27727572 GAGGACGATGACCAAGGAGGAGG + Intergenic
1106629033 13:31451439-31451461 GAGCAGAAAGACCAATGTGGAGG + Intergenic
1107598891 13:41992379-41992401 GATCAGAAAGACCATGGATGAGG - Intergenic
1107636119 13:42394372-42394394 GAGGAAGAAGACCATGAAGTAGG + Intergenic
1107651797 13:42552439-42552461 GAGGAGAAAGAACAGGGAGAGGG + Intergenic
1108144471 13:47462580-47462602 GGGCAGAAAGAGCAGGGAGGAGG + Intergenic
1108370738 13:49765026-49765048 AAGGAGGAAGACCAAAGAGGAGG - Intronic
1108552238 13:51558039-51558061 AAGCAGGAAGACCAGGGAGGAGG - Intergenic
1108848082 13:54699160-54699182 GAGGAGAAGGTGCCTGGAGGAGG + Intergenic
1109284537 13:60396289-60396311 GAGGTGAAAGACCAAGAAGGTGG + Intergenic
1109617201 13:64851035-64851057 AAGCAGAAAGAGCATGTAGGAGG - Intergenic
1109682433 13:65770518-65770540 AATGAGAAAGAAAATGGAGGTGG + Intergenic
1110543362 13:76729777-76729799 GAGGATGAAGAACATGAAGGAGG + Intergenic
1110732014 13:78889687-78889709 GAGGCGTGAGACCATGGGGGTGG - Intergenic
1110866053 13:80397786-80397808 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1110866351 13:80400159-80400181 GAGTAGAAAGAGCAGGGAGGAGG - Intergenic
1111231719 13:85353264-85353286 GAGGAGAGAAACAATGGAGAAGG - Intergenic
1111371714 13:87327906-87327928 GACCAGATAGACCATCGAGGAGG - Intergenic
1111517306 13:89351330-89351352 GAGGAGAAAGTCCATTCAGATGG - Intergenic
1111622849 13:90746713-90746735 GAGGAGAAGGAGGAGGGAGGAGG - Intergenic
1112634230 13:101197317-101197339 GAAGAGAAAGATGAAGGAGGAGG - Intronic
1112795797 13:103055319-103055341 GAGGAGGCAGACCATGCAGCTGG - Intronic
1113061704 13:106329306-106329328 CAGGAGTAAGACAGTGGAGGGGG + Intergenic
1113258653 13:108535107-108535129 GAGGAGGAAGAAAAAGGAGGAGG - Intergenic
1113450295 13:110404624-110404646 GAAGAGCAGGACCAGGGAGGTGG + Intronic
1113573117 13:111372846-111372868 GAGGAGGAAGAGCGTGAAGGGGG - Intergenic
1113734054 13:112664483-112664505 GAGGAGAAAGAAGAGGAAGGTGG - Intronic
1113921139 13:113912558-113912580 GAGGAGAAAGAGGATGGAGCTGG - Intergenic
1115409911 14:33062148-33062170 GAGAAGAATTACCCTGGAGGTGG + Intronic
1115491202 14:33960053-33960075 CAGGAGGAATACCAGGGAGGGGG - Intronic
1115801769 14:37002255-37002277 GAGAACAAAGACCCTGGAGCTGG - Intronic
1115815571 14:37160963-37160985 GAGGAGAAAGAGGAAGGGGGTGG + Intronic
1115963798 14:38864719-38864741 AAGGAGAGGGAGCATGGAGGGGG - Intergenic
1116508337 14:45713649-45713671 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1116508620 14:45715999-45716021 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1117008025 14:51442295-51442317 GAAGAGAAAGAGAAAGGAGGAGG - Intergenic
1117033343 14:51699185-51699207 GAGGCTAAAGAGCATGGAGCAGG + Intronic
1117334132 14:54742327-54742349 GAGGAGAAATAGAATGGGGGGGG + Intronic
1117761673 14:59035449-59035471 GAGGAGGAAGAAGAAGGAGGAGG - Intergenic
1118202693 14:63691471-63691493 GAGAAGAAAGTTTATGGAGGAGG - Intronic
1118547387 14:66906488-66906510 GAGGAGGAACATCATGGATGTGG + Intronic
1118979106 14:70701722-70701744 GAGAAGAAAGAGGAAGGAGGAGG + Intergenic
1119067382 14:71542574-71542596 GAGGAGGAAGAAGAAGGAGGAGG - Intronic
1119549533 14:75498243-75498265 GCTGAGAAAGACAATGGTGGGGG + Intergenic
1119590475 14:75882811-75882833 GAGGCGCAAGAACTTGGAGGTGG - Exonic
1120184107 14:81374785-81374807 GAGGAGAAAGAAAATGGTAGAGG + Intronic
1120294527 14:82622985-82623007 GAGGAGGAGGAGAATGGAGGAGG + Intergenic
1120818054 14:88883784-88883806 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1120945717 14:89994846-89994868 GAGGACAAAGGCCATGGAGGTGG + Intronic
1121735716 14:96216707-96216729 GAGGAGGAAGAGGAAGGAGGAGG + Intronic
1121827229 14:97020263-97020285 GTGGAAAAAGACCATGAAGCAGG + Intergenic
1122047522 14:99034550-99034572 GCGCAGAAAGAGCAGGGAGGGGG - Intergenic
1122251353 14:100442059-100442081 GAGGAGCAGGAACATGGAGAGGG + Intronic
1122322218 14:100861964-100861986 GAGGAGGAAGAGGAGGGAGGAGG - Intergenic
1122359738 14:101152194-101152216 CAGCAGTGAGACCATGGAGGGGG - Intergenic
1123428501 15:20193410-20193432 GAGGAGAAAGAACTTGAAGGAGG - Intergenic
1124181240 15:27477364-27477386 GAAAAGAAAAACCATGGAGACGG + Intronic
1124897963 15:33795127-33795149 GATGAGAAAAACCAGGGAAGAGG - Intronic
1125398777 15:39278167-39278189 CAGGAGAAGGACCAAGGTGGGGG - Intergenic
1125995241 15:44153596-44153618 GATGAAAAAGACTGTGGAGGTGG + Intronic
1126345548 15:47690014-47690036 GAGGCGGATGGCCATGGAGGGGG - Intronic
1126360573 15:47841690-47841712 GAGAAGAAAGAGCTTGGGGGTGG - Intergenic
1126361066 15:47846572-47846594 GAGGAGGAAGATAATTGAGGAGG + Intergenic
1127662443 15:61112857-61112879 GAGGAGACAGACAATAGAGTTGG - Intronic
1128005394 15:64234937-64234959 GAGGAGAAGGGCTATGCAGGAGG + Intronic
1128550141 15:68592812-68592834 GGGGATATTGACCATGGAGGTGG + Intronic
1128601646 15:69000097-69000119 GAGGAGAAAGTCCATTCAGATGG + Intronic
1128733291 15:70035063-70035085 GATGAGGAAGGCCATGGAGGAGG - Intergenic
1128754266 15:70170751-70170773 TAGGAGAAAGGCTAGGGAGGAGG + Intergenic
1129145085 15:73639817-73639839 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1129872130 15:78947317-78947339 GAGGAGAGAGACTGTGGGGGAGG - Intronic
1130093925 15:80842283-80842305 GGGGAGAAAGGCCAAGTAGGAGG - Intronic
1131087471 15:89588972-89588994 GTGGAAAAAGAGCATGGCGGGGG + Intronic
1131105687 15:89732760-89732782 GAGAAGCAAGAGCATGGAGGAGG - Intronic
1131353123 15:91719466-91719488 TAGGAGAAAGACCATGTGGAGGG - Intergenic
1131842634 15:96453924-96453946 GAGGAGAAAGACAATACAAGAGG + Intergenic
1132575640 16:662525-662547 GAAGAGAAAGCCCATGGAGCTGG - Intronic
1132678490 16:1130389-1130411 GGGGAGAAAGACCAAGGGTGTGG + Intergenic
1133325622 16:4940573-4940595 GGGGAGAAAGACCCTGGGAGAGG + Intronic
1133729202 16:8565613-8565635 GAGGAGAAAGAACTCGGAGCAGG - Intergenic
1133816180 16:9199015-9199037 GTGGAGCAAGGCCAGGGAGGTGG - Intergenic
1133982011 16:10640005-10640027 GAAGAGAAAGACTGAGGAGGAGG - Intronic
1133982020 16:10640054-10640076 AAGGAGAAAGAAAAAGGAGGAGG - Intronic
1134329615 16:13238525-13238547 GAGGAGAAGGAGCATGCAGAAGG - Exonic
1134758818 16:16695045-16695067 GAGGAGTTAGACTATGGAGAAGG - Intergenic
1134987257 16:18664126-18664148 GAGGAGATAGACTATGGAGAAGG + Intergenic
1135213136 16:20541032-20541054 GAGGAGAAAGAAGATACAGGGGG + Intronic
1135534644 16:23283918-23283940 GAGAAGCTAAACCATGGAGGAGG + Intronic
1135728744 16:24877032-24877054 AAGCAGGAAGACCATTGAGGAGG + Intronic
1136157345 16:28392020-28392042 GAGGAGGAGGACAATGAAGGCGG - Exonic
1136205741 16:28723261-28723283 GAGGAGGAGGACAATGAAGGCGG + Exonic
1136452169 16:30359608-30359630 GAAGAGCAAGAACAAGGAGGAGG + Intronic
1136482972 16:30554315-30554337 CAGTAAAAAGACAATGGAGGTGG + Exonic
1136491886 16:30613942-30613964 GAGAAGAAAGAAGAAGGAGGAGG + Intronic
1136855816 16:33656352-33656374 GAGGAGAAAGAACTTGAAGGAGG + Intergenic
1137044711 16:35644262-35644284 CAGAAGACAGAGCATGGAGGAGG + Intergenic
1137277319 16:46944409-46944431 GAGGAGTAAGAAGAAGGAGGAGG + Intergenic
1137299965 16:47139513-47139535 GAGCAGAGAGACCAGGTAGGTGG - Intronic
1137339887 16:47591251-47591273 CAAGAGAAAGAGGATGGAGGTGG - Intronic
1138028482 16:53540538-53540560 AAGGAGAAAGAGAATGAAGGTGG + Intergenic
1138332477 16:56226149-56226171 GAGCAGGGAGACCAAGGAGGGGG + Intronic
1138437245 16:57009932-57009954 GTGGACAGAGACCAGGGAGGAGG + Intronic
1139196297 16:64922018-64922040 AAGGAGAAAGAGAAAGGAGGAGG - Intergenic
1139330321 16:66183556-66183578 GAGGAGAAGGAGGAAGGAGGAGG + Intergenic
1140093704 16:71857476-71857498 GAGGGGAAAGACCATGCTTGAGG - Intronic
1140322225 16:73964213-73964235 GAGGAAAAAGATTTTGGAGGTGG + Intergenic
1140457070 16:75111805-75111827 AAGGACAGAGACCCTGGAGGGGG + Intergenic
1140963253 16:79937888-79937910 GAAGAGAAAGAAGAAGGAGGAGG - Intergenic
1141376981 16:83540448-83540470 GGGTAGAAAGAGCAAGGAGGAGG - Intronic
1141845192 16:86603748-86603770 GAGGAGGAAGACGAAGTAGGAGG - Intergenic
1142441159 16:90098364-90098386 GAGGAGATAGATGATGCAGGAGG - Intergenic
1203117401 16_KI270728v1_random:1504831-1504853 GAGGAGAAAGAACTTGAAGGAGG + Intergenic
1142806110 17:2372117-2372139 GAGGAGAGAGAGAAGGGAGGAGG - Intronic
1143309247 17:5974970-5974992 GAGGACAAAGACCATCAAAGTGG + Intronic
1143391287 17:6560768-6560790 GAGGAGAATGAGAAAGGAGGAGG - Intergenic
1143554804 17:7653362-7653384 GAGGATAAAGGCTAGGGAGGAGG - Exonic
1144495742 17:15743595-15743617 CAGGAGGAAGACCAGGTAGGAGG - Intronic
1146144493 17:30401265-30401287 GAGGAGAAGGAAGAAGGAGGAGG - Intronic
1146465697 17:33084464-33084486 GAGCAGAAAGAGCATGGGTGCGG + Intronic
1146889045 17:36493125-36493147 GATGAGAAAGGCCATGGCTGTGG + Intronic
1146921139 17:36712900-36712922 CAGGAGAGAGACCAGAGAGGTGG - Intergenic
1147374584 17:40016144-40016166 GAGGGGAAAGACCAGAGAGTCGG + Intronic
1147452646 17:40515407-40515429 GGGGAGGAAGCCAATGGAGGAGG - Intergenic
1147498816 17:40942567-40942589 GAGGAGGAAGATGAAGGAGGAGG - Intergenic
1147567453 17:41546471-41546493 GAGGGGAAGGACCCTGCAGGTGG - Intergenic
1147720374 17:42536260-42536282 CAGGACTGAGACCATGGAGGCGG + Exonic
1147816707 17:43215832-43215854 CAGGAAAAAGACGATGAAGGAGG - Exonic
1148162036 17:45455760-45455782 GGGGAGAAAGACCAGTTAGGAGG - Intronic
1148197741 17:45726849-45726871 GAGAAGAAAGCACATGTAGGAGG - Intergenic
1148559634 17:48598424-48598446 GAGGAGAAAGGCGAAGGAGAAGG - Intronic
1149129590 17:53282063-53282085 CAGGATAAAGTCCATGGAAGTGG + Intergenic
1150393268 17:64802409-64802431 GGGGAGAAAGACCAGTTAGGAGG - Intergenic
1151684899 17:75640590-75640612 GAGAAGACACAACATGGAGGAGG + Intronic
1152084063 17:78206656-78206678 GAGAAGAAAGAAGATGAAGGAGG - Intronic
1152406961 17:80103339-80103361 TAGGAGCAAGGCCATGGGGGAGG - Intergenic
1152894864 17:82905271-82905293 CAGGAGAGGGAGCATGGAGGAGG - Intronic
1153150732 18:2089692-2089714 GGGGAGAGAGTCCATGGTGGTGG - Intergenic
1153185234 18:2478829-2478851 GAGGAGGAGGAAGATGGAGGAGG + Intergenic
1153185238 18:2478851-2478873 GAAGAGGAAGAAGATGGAGGAGG + Intergenic
1153185242 18:2478873-2478895 GAGGAGGAAGAAGATAGAGGAGG + Intergenic
1153185248 18:2478895-2478917 GAGGAGGAAGAAGAGGGAGGAGG + Intergenic
1153549131 18:6242386-6242408 GAGGAGAAGGATAATGGCGGTGG - Intronic
1154002250 18:10491941-10491963 GAGGCCATAGGCCATGGAGGTGG - Intergenic
1155500414 18:26481918-26481940 GAGCAGAGAGACCAACGAGGAGG + Intronic
1156382888 18:36579900-36579922 GAGGAGAAGGACCACGGAGGAGG + Intronic
1156390825 18:36648960-36648982 GAGGAGAAAAACCACAGAGGAGG + Intronic
1156598845 18:38579814-38579836 GAGGAGAAAGGAGAAGGAGGAGG + Intergenic
1156956314 18:42968878-42968900 GAGGAGAAGTACATTGGAGGAGG + Intronic
1157315881 18:46589302-46589324 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1157322581 18:46645942-46645964 CAGGAGAAACACCATGAAAGAGG + Intronic
1157919124 18:51697749-51697771 GAGGAGAAAGGCAATCAAGGTGG - Intergenic
1158861350 18:61595052-61595074 GAGGAGAAAGAAGGAGGAGGAGG + Intergenic
1159156889 18:64595550-64595572 GAGTAGAATGAGCAGGGAGGAGG + Intergenic
1160005447 18:75065479-75065501 GAGGACACAGACCATGCTGGTGG - Exonic
1160183282 18:76654636-76654658 GGGTAGAAAGAACAGGGAGGAGG + Intergenic
1160222970 18:76990593-76990615 GAGGACAAGGCCCATGGAGGAGG + Intronic
1160965736 19:1746201-1746223 GAGGAGGAGGAGGATGGAGGAGG + Intergenic
1160965754 19:1746258-1746280 GAGGAGGAAGGAAATGGAGGAGG + Intergenic
1160965800 19:1746372-1746394 GAGGAGGAGGAGGATGGAGGAGG + Intergenic
1161146787 19:2683721-2683743 CAAGAGAGAGACCCTGGAGGAGG + Intronic
1161415798 19:4145665-4145687 GAGGGAAAAGGCCAAGGAGGAGG + Intergenic
1161635120 19:5383659-5383681 GAGGAAAAAGAAGAAGGAGGAGG - Intergenic
1162620958 19:11843863-11843885 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1162661054 19:12169337-12169359 GAGAATTAAGACCCTGGAGGAGG + Intronic
1162872551 19:13597595-13597617 TGGGAGAAAGAACAGGGAGGTGG + Intronic
1163564893 19:18045233-18045255 GAGGAGAAGGAGGGTGGAGGAGG + Intergenic
1164013766 19:21234044-21234066 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1164014219 19:21237883-21237905 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1164833958 19:31345111-31345133 AAGGAGAAAAACAAAGGAGGTGG - Intronic
1164957814 19:32402237-32402259 GAAGAGAAAGAGAAGGGAGGAGG + Intergenic
1164972248 19:32542560-32542582 GAGGAGAAAGAGAATGAAGTAGG + Intergenic
1165324949 19:35109069-35109091 GAGCAGGGAGACCAGGGAGGAGG + Intergenic
1165387304 19:35518131-35518153 GAGTAGAGAGACCAGGGAGGAGG + Intergenic
1165733915 19:38163927-38163949 GTGCAGAGAGACCAGGGAGGAGG + Intronic
1166052374 19:40268022-40268044 GAGGAGAAACACGAGAGAGGTGG + Intronic
1166400288 19:42473787-42473809 AAGGAGAAAGAACAGGCAGGAGG + Intergenic
1166545476 19:43632374-43632396 GTGGAGAATGGCCCTGGAGGAGG - Intronic
1166817170 19:45553297-45553319 GAGGTGAAGGATGATGGAGGGGG + Intronic
1167645836 19:50704320-50704342 AAGGAGACAGGCCGTGGAGGGGG - Intronic
1167700710 19:51043525-51043547 GAGGAGAAAGACCCTGGTGCTGG + Intergenic
1167783381 19:51615535-51615557 GAGGAGAAGGAGAACGGAGGTGG + Intronic
1167795515 19:51705636-51705658 GTGGAGAGAGGCCAAGGAGGTGG - Intergenic
1167799229 19:51729580-51729602 GAGGAGGAGGAGAATGGAGGAGG + Intergenic
1168035271 19:53714287-53714309 GATGAGCAAGAGCACGGAGGTGG + Intergenic
1168036401 19:53723037-53723059 GATGAGCAAGAGCACGGAGGTGG + Intergenic
1168038003 19:53735693-53735715 GATGAGCAAGAGCACGGAGGTGG + Intergenic
1168039086 19:53743677-53743699 GATGAGCAAGAGCACGGAGGTGG + Intergenic
1168254264 19:55157313-55157335 AAGGAGAGAAACCAAGGAGGGGG + Intronic
924972101 2:137627-137649 GAGAAGAAAGAACAGGGAGAAGG - Intergenic
925623325 2:5816624-5816646 GAGGCGATTGATCATGGAGGTGG + Intergenic
925691579 2:6529461-6529483 GAGGTGACAGACCAGGAAGGAGG + Intergenic
925940841 2:8816289-8816311 GAGGAGAAAGCCTTTGGAGCAGG + Intronic
926221596 2:10939461-10939483 CAGGAGGAAGACAATGAAGGAGG + Intergenic
926266780 2:11330706-11330728 AAGGAGGAAGACAAGGGAGGAGG + Intronic
926273459 2:11385670-11385692 TAGGAGAAAGAGCATGTAGGAGG - Intergenic
926516801 2:13856501-13856523 TAGGAGAGAGACCATGGAAAAGG - Intergenic
927239909 2:20912382-20912404 GAGGGGAAACACCATGGAGCTGG + Intergenic
927324673 2:21790679-21790701 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
927876213 2:26656949-26656971 GAGGAGGGTGACCAGGGAGGAGG + Intergenic
929015007 2:37485221-37485243 GAGGAGAAGGAATATGGAGGAGG - Intergenic
929869969 2:45750869-45750891 AAGGAGAAAGACCACTGAAGGGG - Intronic
930994516 2:57700232-57700254 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
931141928 2:59468859-59468881 GAGGAGAAAAAACAGGGATGAGG + Intergenic
931144124 2:59498066-59498088 GAGGAGAAGGAGAAAGGAGGAGG - Intergenic
931487234 2:62705755-62705777 GAGGAGAAAGGCGGGGGAGGGGG + Intronic
931799295 2:65742831-65742853 AAGGAGTAAGAATATGGAGGAGG + Intergenic
931940136 2:67242954-67242976 TAGGAGAAAGACCATGGAACTGG - Intergenic
931992826 2:67808075-67808097 GAGGAAAAAGAAGAAGGAGGAGG - Intergenic
932706653 2:74031233-74031255 GAGGAAAAGGAGAATGGAGGAGG + Intronic
932841392 2:75086121-75086143 GAGGAGAGAGAAAATGGAAGAGG + Intronic
933469604 2:82704875-82704897 GAGGAGAATAACAGTGGAGGAGG - Intergenic
933577862 2:84090336-84090358 GAAGAGGAAGACGAAGGAGGAGG - Intergenic
933582872 2:84147294-84147316 GAGAAGAGAGAGCATGCAGGAGG + Intergenic
933781010 2:85801178-85801200 GAGGAGCAACAACATAGAGGGGG + Intergenic
934566214 2:95343032-95343054 GAGGAGAACCACAGTGGAGGTGG + Intronic
934574634 2:95392185-95392207 GAGAGGAAAGTACATGGAGGAGG - Intergenic
934584711 2:95481055-95481077 GAGGAGAAACACAATGGAATGGG - Intergenic
934594744 2:95595664-95595686 GAGGAGAAACACAATGGAATGGG + Intronic
934600918 2:95657718-95657740 GAGAAGACAGAAGATGGAGGTGG - Intergenic
934670035 2:96206375-96206397 GAGGAGAAAGACCAGGAAAAGGG - Intronic
934788033 2:97029970-97029992 GAGGAGAAACACAATGGAATGGG - Intergenic
935692600 2:105744818-105744840 GAGGAGGAAGAGCGCGGAGGAGG + Intergenic
935936450 2:108189638-108189660 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
936379437 2:111970822-111970844 GAGGAGAAGGAGGAGGGAGGAGG - Intronic
936521075 2:113212539-113212561 CGGGAAGAAGACCATGGAGGAGG + Intergenic
936619630 2:114082111-114082133 GAGGAGAAAGGCTATGCGGGTGG - Intergenic
937164081 2:119795422-119795444 CAGGAGAAAGGCCGAGGAGGGGG - Intronic
937294499 2:120801679-120801701 GAGGAGAGAGGACATGAAGGGGG + Intronic
937625186 2:124035847-124035869 GAGGAGAGAGACCACGAAGTAGG - Intronic
937637767 2:124176102-124176124 GAGGAGAAAGATCCTGGAAATGG - Intronic
937884654 2:126891553-126891575 GAGGATAAAGAGCAGGGAGGAGG + Intergenic
938238257 2:129723606-129723628 GAGGAGAGGGGCCAAGGAGGTGG + Intergenic
938377547 2:130818776-130818798 AAGGACAAAGACAATGGAGGTGG + Intergenic
938786925 2:134638524-134638546 ATGGAGAAAGACCATTTAGGAGG + Intronic
939145070 2:138403815-138403837 GGGGACAAAGAGCAGGGAGGAGG - Intergenic
939566366 2:143790646-143790668 GAGAAGAAAGATAATGGAGCAGG + Intergenic
939734522 2:145827417-145827439 GAGGAAGAAGAACAAGGAGGAGG - Intergenic
939984119 2:148813717-148813739 GAGAAGCAAAACCCTGGAGGGGG + Intergenic
940420039 2:153470320-153470342 GAGGAGAGAGAACATGGGGGAGG - Intergenic
940439134 2:153693625-153693647 GAGGAGAAAGGGCAAGCAGGAGG + Intergenic
942776991 2:179593888-179593910 CAGGAGAAAGATTATGAAGGGGG - Intronic
944253334 2:197599505-197599527 AAGGAGAAAGAGGAAGGAGGTGG + Intronic
945758640 2:213882957-213882979 GAGGAGAATGGCCTGGGAGGCGG - Intronic
946488974 2:220129505-220129527 GAGAAGAAAGCGCATGGTGGTGG + Intergenic
946773881 2:223117524-223117546 AAGGAAAAACACCATGGAGATGG + Intronic
947713778 2:232330041-232330063 GAAGAGAAAGACCTGGAAGGTGG + Intronic
948494746 2:238340111-238340133 GAGGAGAAAGACAAGGGACCGGG - Intronic
948558384 2:238834031-238834053 GAGGAAAAAGAAACTGGAGGAGG + Intergenic
948616995 2:239205554-239205576 GAGGATCAACAACATGGAGGTGG + Intronic
948979528 2:241485776-241485798 GGGGAGGAAGACCATGGGGAGGG - Intronic
1168862060 20:1052650-1052672 CAGGACAAAGAACAGGGAGGTGG + Intergenic
1169056587 20:2626959-2626981 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1169798048 20:9486252-9486274 GAGGAGGAAGAAGAAGGAGGGGG - Intergenic
1170189460 20:13630063-13630085 TTGGAGAATGACCATGGAGAAGG - Exonic
1171189251 20:23147097-23147119 GAGGAGAAAGTCAATGGAGGAGG - Intergenic
1172436200 20:34930559-34930581 AAGCAGAAAGACCGTGGAAGAGG - Intronic
1173578395 20:44128500-44128522 CAGGAGAAAGCCCATGGGGTGGG + Intronic
1173926273 20:46783688-46783710 GATTAGAAAGACCAGGCAGGAGG - Intergenic
1174036552 20:47672144-47672166 GAGGAGAGAGACCATGCCTGGGG - Intronic
1174099278 20:48114839-48114861 GAGGTGAGAGACCAGTGAGGGGG - Intergenic
1174353567 20:49984063-49984085 GAGGAGAAGGACGAAGGAGCCGG - Exonic
1175013719 20:55765836-55765858 CAGGAGAGAGAGCATGAAGGAGG + Intergenic
1175372596 20:58502021-58502043 GGGGAGAGTGACCAGGGAGGTGG - Intronic
1175661421 20:60816269-60816291 GAGGAAAAAGAAGAAGGAGGAGG - Intergenic
1178189664 21:30265901-30265923 GAGTAGAAAGAGCAGGGAGGAGG - Intergenic
1178294367 21:31396457-31396479 TAGGAGAATAAACATGGAGGGGG - Intronic
1178299809 21:31442869-31442891 AAGGAGAAAGACCATGCACCAGG + Intronic
1178423449 21:32460199-32460221 GTTGAGAAATACCCTGGAGGGGG - Intronic
1178505254 21:33157395-33157417 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1178505259 21:33157414-33157436 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1178505264 21:33157433-33157455 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1179080201 21:38163676-38163698 GAAGAGAAAGAGGAAGGAGGAGG - Intronic
1179189114 21:39108292-39108314 GATGAGAAACAGGATGGAGGAGG + Intergenic
1179393685 21:41017538-41017560 GAGGAGAAAGGACAGAGAGGAGG - Intergenic
1179831097 21:43996570-43996592 GAGTAGAATGAGCAGGGAGGAGG + Intergenic
1180230387 21:46423751-46423773 GAGGAGGAAGAGAAGGGAGGGGG + Intronic
1180868864 22:19134849-19134871 GAGGAAAGAGAAGATGGAGGGGG + Intronic
1180877378 22:19180901-19180923 CAGGAGAATGACAGTGGAGGAGG + Intronic
1181077292 22:20389362-20389384 GAGTAGAAAGAGCAGGGAGCAGG + Intronic
1181361791 22:22343328-22343350 GAGGAGGAAGAGCAGGGATGGGG - Intergenic
1181387814 22:22558130-22558152 GAGAAGAAAGACAGTGGGGGGGG + Intronic
1181729049 22:24831426-24831448 AAGGAGCAAGACCTTGGAGGAGG + Intronic
1181856996 22:25789069-25789091 GAGGAGGAAGAAGAAGGAGGAGG - Intronic
1181856999 22:25789085-25789107 GAGGAGGAAGAAGAAGGAGGAGG - Intronic
1181859369 22:25806230-25806252 AAGGAGAGGGACCATGCAGGAGG + Intronic
1181860337 22:25813140-25813162 GAGGAGAAGGAAGAAGGAGGAGG - Intronic
1181990566 22:26833742-26833764 AGGCAGGAAGACCATGGAGGAGG + Intergenic
1182065127 22:27425593-27425615 GGGGAGGAAGACGATGGAGAAGG - Intergenic
1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG + Intergenic
1182720743 22:32397069-32397091 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1182766997 22:32764876-32764898 GAGGAGAGAGACTATGAGGGAGG - Intronic
1183095792 22:35551600-35551622 GAAGAACAAGACCAAGGAGGCGG + Exonic
1183655505 22:39182332-39182354 GAGGAGAGAGACAATGGAGGAGG + Intergenic
1183909701 22:41069217-41069239 AAGGAGCCAGTCCATGGAGGTGG - Intergenic
1184449805 22:44576118-44576140 GAGGAGGAAGAGGAAGGAGGAGG + Intergenic
1184934830 22:47713751-47713773 GAGGAGAAGGACCCTGGGGTTGG + Intergenic
1185371040 22:50461105-50461127 CAGGAGAAAGACCAGGGCGGGGG + Intronic
1203296392 22_KI270736v1_random:46632-46654 GAGAAGGAAGACAGTGGAGGAGG - Intergenic
949128823 3:477104-477126 AATGAGAGAGAACATGGAGGTGG - Intergenic
949823712 3:8142012-8142034 GAAGTGAAGGACCTTGGAGGAGG + Intergenic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
950525039 3:13518517-13518539 GAGGAGAAAGTGCAGGGTGGAGG + Intergenic
950992718 3:17458173-17458195 GAGGAGAAGGATCATGGAGAAGG - Intronic
952125305 3:30292657-30292679 GTAGAGAAAGACTTTGGAGGTGG + Intergenic
952241202 3:31532887-31532909 GAGGAGGAAGAAAAAGGAGGAGG - Exonic
952298948 3:32086880-32086902 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
952299248 3:32089356-32089378 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
952460428 3:33519497-33519519 GAGGAGAAAGTGCATGGGGGAGG + Intronic
952716123 3:36482730-36482752 GAGAACAAAGGGCATGGAGGAGG + Intronic
953851577 3:46469251-46469273 GAGGAGAAAGCCCCTGGCTGTGG - Intronic
953875185 3:46662584-46662606 CAGCAGGAAGACCAGGGAGGAGG + Intergenic
953973933 3:47368550-47368572 GAGGAAAAAGAAGAAGGAGGAGG - Intergenic
954099072 3:48355574-48355596 GTGGAGGAAGACCGTGGGGGTGG + Intergenic
954277241 3:49550577-49550599 GAGGAGGAAGACAATAGAGAAGG - Intergenic
954436358 3:50498418-50498440 GGAGAGAAAGGTCATGGAGGTGG - Intronic
954914687 3:54138874-54138896 GAGGAGAAATCCTAAGGAGGAGG - Intronic
956000767 3:64727892-64727914 TAGGAAAAAGAATATGGAGGTGG - Intergenic
957501708 3:81066515-81066537 GAGGAGGAAGAGGAGGGAGGAGG - Intergenic
957694479 3:83617360-83617382 AAGGAGAAAGAGCAAGCAGGAGG + Intergenic
957762637 3:84578159-84578181 GAGGAGGAAGAGGAAGGAGGAGG + Intergenic
958094057 3:88918744-88918766 GAGGAGACAGACCCAGTAGGTGG - Intergenic
958718300 3:97814096-97814118 AAGGTGAAAGACCAAGGAGAAGG + Intergenic
959462829 3:106648379-106648401 ATGAAGAAAGAGCATGGAGGGGG - Intergenic
959984219 3:112555718-112555740 GAGTAGAATGAGCCTGGAGGAGG - Intronic
959991786 3:112639007-112639029 GAGGGGAATGACGGTGGAGGGGG - Exonic
960590780 3:119363442-119363464 GAGGCCAGAGACCATAGAGGTGG - Intronic
960737403 3:120795607-120795629 GAGGATAAAGCCAATGCAGGGGG + Intergenic
961110361 3:124278343-124278365 TGGGAGAAAAAGCATGGAGGTGG + Intronic
961313802 3:126020567-126020589 GAGGAGGAAGTCCATTCAGGTGG - Intronic
961925357 3:130473788-130473810 GAGTAGCAAGAGCAGGGAGGAGG - Intronic
962467718 3:135675695-135675717 GAGGAGAAAGTCCATTTAGATGG - Intergenic
963391026 3:144664549-144664571 GAGAAGAAAAACCATGTTGGAGG - Intergenic
964734381 3:159901249-159901271 AAGGAGAAAGAGAATGGAGAGGG - Intergenic
965176900 3:165346442-165346464 AAGGAGAAAGACCAAAGATGAGG - Intergenic
966709832 3:182959933-182959955 GAGGAGAGAGACCAAACAGGAGG - Intronic
967588056 3:191238315-191238337 AAGGGGAAAGAGCATGCAGGAGG + Intronic
967815956 3:193798270-193798292 GAGGAGGTAGAACCTGGAGGGGG + Intergenic
967979199 3:195055377-195055399 CAGGAGAAAGCCCAGGTAGGGGG - Intergenic
968361421 3:198149336-198149358 GAGGAGATAGACGATGCAGGAGG - Intergenic
969054033 4:4390559-4390581 GGGGAGAAAGAGCTTGGAGGTGG + Intronic
969360512 4:6660455-6660477 GAGGAGAAAGAAGAAGAAGGAGG + Intergenic
969360562 4:6660673-6660695 GAGGAGAAAGAAGAAGAAGGAGG + Intergenic
969511394 4:7620043-7620065 GAGGAGGAAGAGGAAGGAGGAGG - Intronic
971622324 4:28871421-28871443 GAGGAAAAAGAGCAAGGAGAAGG - Intergenic
973176573 4:47213118-47213140 GAGTATAAGGACCATGGGGGTGG - Intronic
973892286 4:55379098-55379120 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
974183370 4:58412254-58412276 GAAGAGAAAGACAATGAAAGAGG - Intergenic
974589607 4:63927221-63927243 CAGGAGAAAGACCATGGTCCAGG + Intergenic
974600335 4:64071425-64071447 GAAGAGAGAGAGCATGAAGGAGG - Intergenic
975365179 4:73520834-73520856 GCAGAGAAAGACCATCGAGTGGG + Intergenic
975961075 4:79906103-79906125 GAGCAGAAACACCGTGGGGGAGG - Intronic
976011462 4:80494110-80494132 CAGGAAGAAGAGCATGGAGGTGG - Intronic
976243531 4:82984835-82984857 CGGGAGAACGATCATGGAGGTGG - Exonic
977155509 4:93568109-93568131 GAGGAAACAGAACCTGGAGGAGG - Intronic
977428175 4:96896370-96896392 GAGGAGAAAGAGCAGGGAGTTGG + Intergenic
977842870 4:101730167-101730189 AGGAAGAAAGAACATGGAGGAGG - Intronic
977859586 4:101940716-101940738 GAGGAGAAAGACCATGGAGGTGG + Intronic
977861080 4:101960614-101960636 GTGGTGAAAGAACATGGAGATGG + Intronic
978884436 4:113750227-113750249 GAAGTTAGAGACCATGGAGGAGG + Intronic
979181139 4:117728907-117728929 GAAGAGAAAAACCAGGGAGAAGG + Intergenic
979441684 4:120757710-120757732 GAAGAGAAAGAAGAAGGAGGAGG - Intronic
979910610 4:126361352-126361374 GAGGAGAAAGTCCATTCAGATGG - Intergenic
980018920 4:127684637-127684659 GAGGAGAAGGAAGAAGGAGGAGG - Intronic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981394302 4:144229125-144229147 GAGGAGGAAGAAAAAGGAGGAGG + Intergenic
981590796 4:146358236-146358258 GAGGAGGTAGACCAAGGATGAGG + Intronic
982941229 4:161559331-161559353 GAGAAGAAAGAACAAGGAGGAGG - Intronic
982970795 4:161983104-161983126 GAGAAAAAACACCATGGAGAAGG + Intronic
983515288 4:168649549-168649571 AAGGAAAAAGACCATTGTGGAGG - Intronic
983523415 4:168734943-168734965 GAGGAGAAAGAGGAGGGAGAGGG + Intronic
984463014 4:180059233-180059255 GAGGAGAGAGTCGGTGGAGGTGG - Intergenic
985327113 4:188783295-188783317 GAGGACAAAGATCTTCGAGGAGG + Intergenic
985510206 5:309225-309247 GAGGAGAAAGACCTTGGCAAGGG + Intronic
985545057 5:505227-505249 GGGGAGAGTGACCATGGGGGGGG + Intronic
985547651 5:518147-518169 GAGCCAAAAGACCTTGGAGGAGG + Intronic
986284057 5:6347148-6347170 GAGGAGAGGGAACCTGGAGGAGG - Intergenic
986581329 5:9269376-9269398 CAGTAGAAAGACAATGGAGATGG + Intronic
987917041 5:24228176-24228198 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
988219493 5:28324440-28324462 GAGGTGAGGGATCATGGAGGGGG - Intergenic
988790442 5:34602761-34602783 AAGGGAAAAGATCATGGAGGTGG + Intergenic
989143474 5:38225057-38225079 GAGGAGAAGGAGAAAGGAGGAGG + Intergenic
989395270 5:40948781-40948803 GAAGAGAAAGACCTTGAAGAGGG - Intronic
989586036 5:43074479-43074501 GAGGAGAAAGACAATCAGGGTGG + Intronic
989683502 5:44057798-44057820 AAGGAGAAAGATCTTGGAAGGGG + Intergenic
990814243 5:59765618-59765640 CAGGAGAAAGACCATGAAAGAGG - Intronic
990886255 5:60597670-60597692 TAGGAGAAAGACTTTGGTGGTGG - Exonic
991046028 5:62223758-62223780 GAGGAGAAAGAACTTGAAGGAGG - Intergenic
991366814 5:65877149-65877171 GAGGAGGAAGAAGAAGGAGGAGG - Intergenic
992090647 5:73312965-73312987 GAGGAGAAGGAAGAAGGAGGAGG - Intergenic
992090675 5:73313093-73313115 GAGGAGGAAGAAAAAGGAGGAGG - Intergenic
992132716 5:73709558-73709580 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
992189647 5:74278861-74278883 GAGGAGAAAGAAGATGGAGGTGG - Intergenic
992586830 5:78249446-78249468 GAGGAGAAAGAGATTGGAGTAGG - Intronic
992737869 5:79742028-79742050 GAGGAGAAAGAGGGAGGAGGAGG - Intronic
992750326 5:79855330-79855352 AAGGAGAAAGAGAATGTAGGTGG + Intergenic
992849912 5:80796862-80796884 GAGTAGAGAATCCATGGAGGTGG - Intronic
993514529 5:88814149-88814171 GTGGAGAAAGAGCATTTAGGAGG - Intronic
993717001 5:91284993-91285015 AAGGAGAAAGAGCAGGCAGGTGG + Intergenic
994032514 5:95160660-95160682 GAAGAGACAAACCATGGAGTGGG + Intronic
994661835 5:102663085-102663107 GAGGTAAAAGATCATGGAGAAGG - Intergenic
995183814 5:109251979-109252001 GAGGAGATGGTCCATAGAGGAGG - Intergenic
995264770 5:110145815-110145837 GAGGAAAAAGAAGAAGGAGGAGG - Intergenic
995780206 5:115767360-115767382 AAGAAGAAAGTCCATGGAGAGGG + Intergenic
996531699 5:124533939-124533961 GAGGAGAAACACAGTGGAGAAGG - Intergenic
999743832 5:154576698-154576720 GAGGAGAGAGCTCAAGGAGGGGG + Intergenic
999889370 5:155960139-155960161 GAGGAGAAGGAAGATGGAAGGGG - Intronic
1001379274 5:171292771-171292793 AAGGAGAAAGACCAGGGATGAGG - Intronic
1001442153 5:171751201-171751223 GGGGAGACGGACCATGGTGGTGG - Intergenic
1001769884 5:174286312-174286334 GAGGAGAAAGATGGGGGAGGAGG + Intergenic
1001809887 5:174619538-174619560 GAGGAGGTCGACCCTGGAGGAGG - Intergenic
1002042275 5:176523456-176523478 GAGGAGGAAGAAGAAGGAGGAGG - Intergenic
1002419701 5:179139232-179139254 GAGGAGACAGGCAGTGGAGGAGG + Intronic
1002427187 5:179183361-179183383 GAGGAGAAAGGCCAGGGATGAGG + Intronic
1002567446 5:180119798-180119820 GAGGAGAAAGCCCAGGGCTGGGG - Intronic
1002844884 6:937358-937380 GAGGAGGAGGAGGATGGAGGGGG - Intergenic
1003730550 6:8818071-8818093 GAGGAGAAAGAGCCAGGAGAGGG + Intergenic
1004184545 6:13410805-13410827 GAGGAGAAAGAGGAAGAAGGAGG + Intronic
1004507419 6:16258385-16258407 AAGGACAAAGACCAGGAAGGAGG + Intronic
1004588807 6:17029174-17029196 GAGGAGAGAGTCCATAGAAGTGG + Intergenic
1004873876 6:19935776-19935798 AAGGAGAAAGAGTGTGGAGGTGG - Intergenic
1005118701 6:22367053-22367075 AAGGGGAAAGACAATGGAGGAGG - Intergenic
1005276410 6:24223969-24223991 TAAGAGAAAGACCAAGGATGAGG - Intronic
1005622552 6:27633408-27633430 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1005711150 6:28503800-28503822 GAGGAGAGAGGCTATGAAGGAGG + Exonic
1005763267 6:28987029-28987051 CAGGAGAAAGAGCAGGGGGGCGG + Intergenic
1006446783 6:34084213-34084235 GAGGAGGAAGCCCAGGGAAGAGG + Intronic
1006752415 6:36387070-36387092 GTGGAGAAAGGCCTTGGAGTGGG + Intronic
1007299158 6:40853261-40853283 GAGGAGAAAGACCAGAAAAGCGG + Intergenic
1007600658 6:43078841-43078863 GAGGAAAGAAACCAGGGAGGGGG - Intronic
1007748971 6:44060390-44060412 GAGGAGAAATACCTAGAAGGAGG + Intergenic
1008117616 6:47570485-47570507 GAGGAAAAAGGGCATGCAGGAGG - Intronic
1008970636 6:57363844-57363866 GAGGAGAAAGAACAGGTAGAGGG - Intronic
1009159599 6:60265653-60265675 GAGGAGAAAGAACAGGTAGAGGG - Intergenic
1009830553 6:68926367-68926389 GAGGAGACAGTTCATGGAGGTGG + Intronic
1010773680 6:79861349-79861371 GAGGAGGAAGACCTTGGATAAGG + Intergenic
1011484755 6:87829998-87830020 GAGGAGAAGGAGGAAGGAGGAGG - Intergenic
1011626709 6:89289117-89289139 AAGGAGCAAGACCATGCAGAGGG + Intronic
1011712201 6:90066201-90066223 GAGGAGAAAGAGCATCTATGTGG + Intronic
1011718703 6:90133169-90133191 GAGGAGAAGGACAAAGGATGAGG - Intronic
1011822694 6:91271824-91271846 GAGGAGAGAGGCCAGGGAGCAGG + Intergenic
1011934443 6:92757621-92757643 GAGGAGGAAGAGGAAGGAGGGGG + Intergenic
1012681253 6:102184006-102184028 GAGGAGAAATGAGATGGAGGTGG - Intergenic
1012881205 6:104792859-104792881 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1013226190 6:108120753-108120775 GAGGAGCAAGGCGAGGGAGGTGG - Intronic
1013633198 6:112005087-112005109 CAGGAGAATGAGCATGGAAGTGG - Intergenic
1013788872 6:113813339-113813361 GAGGAGAAAGATACTGCAGGAGG + Intergenic
1014034036 6:116744704-116744726 GAAGAGAAAGCCCATGGATTAGG - Intergenic
1014281158 6:119443702-119443724 GAGGAGAAAGGACAAGGAGCAGG - Intergenic
1014444852 6:121515094-121515116 GAGCAGATAGAGTATGGAGGAGG + Intergenic
1014494366 6:122102247-122102269 GAGGAGGAAGAGAAAGGAGGAGG + Intergenic
1015381615 6:132576492-132576514 GAGGAGGAAGACCTAGGAAGAGG + Intergenic
1015468680 6:133577336-133577358 GTGCAGTAAGACCATGGAAGTGG - Intergenic
1015644205 6:135368487-135368509 GTAGAGAAAGACCATGGTGGTGG + Intronic
1015959383 6:138631471-138631493 GAGGAGAGAGAACAGTGAGGAGG + Intronic
1016270019 6:142277984-142278006 GATGAGAGCGACCATGGAGATGG + Intergenic
1016292164 6:142537990-142538012 GAGAAGAAAGAACCTGGAAGTGG - Intergenic
1016348268 6:143139681-143139703 GAGGAGAGAGAGAAAGGAGGGGG - Intronic
1017237840 6:152135873-152135895 GAGAAGAAAGACTGAGGAGGTGG - Intronic
1018038066 6:159898620-159898642 GAGGAGGAAGAAGAGGGAGGAGG - Intergenic
1018038078 6:159898659-159898681 GAGGAGGAAGAGGAAGGAGGAGG - Intergenic
1018172183 6:161152004-161152026 GAGGGGAAGGACCTCGGAGGTGG + Intronic
1018468101 6:164070701-164070723 GAGGAAAATGACAATGGACGTGG - Intergenic
1018850580 6:167587683-167587705 GAGGAGAAAGACAAGGGGAGGGG + Intergenic
1019254269 7:39384-39406 GAGGAGATAGACGATGCAGGAGG + Intergenic
1019535294 7:1526173-1526195 GAGGAGAAAGGAGAGGGAGGAGG + Intergenic
1020934226 7:14440126-14440148 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1021421269 7:20447861-20447883 GAGGAGACAGAAGAAGGAGGAGG + Intergenic
1022960730 7:35423908-35423930 GAGGAGAAAGCCCATGTGGCTGG - Intergenic
1023316921 7:38947608-38947630 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1023478060 7:40602419-40602441 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1023710105 7:42982970-42982992 GAGCAGCAGTACCATGGAGGTGG + Intergenic
1023727788 7:43162429-43162451 GAGGAGGCAGACCATGGAGATGG - Intronic
1023764574 7:43498533-43498555 GAGGAGAAAGCCCAGGGCTGGGG + Intronic
1023986893 7:45102080-45102102 AAGGAGAAAGAAGAGGGAGGTGG + Intronic
1024032261 7:45471431-45471453 GAGGAGAAACAAGAAGGAGGAGG + Intergenic
1024720911 7:52136865-52136887 GAGGAGGAAGAAGAAGGAGGAGG + Intergenic
1024720932 7:52136969-52136991 GAGGAGGAAGAAGAAGGAGGAGG + Intergenic
1024720955 7:52137079-52137101 GAGGAGAAGGAGGAGGGAGGAGG + Intergenic
1025057867 7:55779673-55779695 GAGGAGGAAGAAGAAGGAGGAGG - Intergenic
1026566890 7:71496595-71496617 GAGGAGAGAGACCATGAGGGAGG + Intronic
1026849703 7:73717187-73717209 AAGGAGAAAGAAGAGGGAGGAGG + Intronic
1027121404 7:75524842-75524864 GAGGAGAAGGAAGAAGGAGGGGG - Intergenic
1027189897 7:75990419-75990441 GAGGGGAAAGACCCAGGAGAAGG - Intronic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1029276712 7:99409420-99409442 GAGGAGAAAGAGGACGTAGGAGG - Intronic
1029381693 7:100219561-100219583 GAGGAGAAAGCCCCTGGGAGTGG - Intronic
1029401858 7:100352009-100352031 GAGGAGAAAGCCCCTGGGAGTGG - Intronic
1029516175 7:101024715-101024737 GAGGAGACAGAGCAGGGAGGAGG - Intronic
1029575667 7:101401781-101401803 GAGGAGGAAGACCCTGGAGAGGG + Intronic
1029914074 7:104188875-104188897 CAGGAGAGAGAGCATGAAGGGGG - Intronic
1031670310 7:124534989-124535011 GAGCAGAAAGACCATTTTGGAGG + Intergenic
1031854615 7:126907248-126907270 GAGGAGTAAGAGAAAGGAGGAGG + Intronic
1031854633 7:126907305-126907327 GAGGAGGAAGAGGAAGGAGGGGG + Intronic
1031858673 7:126953174-126953196 GAAGAGAAAGACCAGGTTGGGGG + Intronic
1032466799 7:132151263-132151285 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
1032466804 7:132151285-132151307 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
1032466812 7:132151320-132151342 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
1032466817 7:132151342-132151364 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
1032466844 7:132151440-132151462 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
1032466854 7:132151481-132151503 GAGGAGGAAGAAGAAGGAGGAGG + Intronic
1032523588 7:132563286-132563308 GAGGAGGAAGAGAAAGGAGGAGG - Intronic
1032523808 7:132564203-132564225 GAGGAGAAAGGAGAAGGAGGAGG - Intronic
1032558747 7:132865501-132865523 CAGGAAAGGGACCATGGAGGTGG + Intronic
1032819244 7:135509739-135509761 GAGGAAGAAGACCAAGGAGGAGG + Intronic
1033023829 7:137753966-137753988 GAGGAGGAGGAGCGTGGAGGGGG + Intronic
1033133341 7:138764222-138764244 GAGGGGAAAGGAGATGGAGGAGG + Intronic
1033553227 7:142466343-142466365 GAGGAGAAAAGCCAGGAAGGCGG - Intergenic
1034099656 7:148439823-148439845 GAAGAGAAAGAATATGTAGGAGG - Intergenic
1034252423 7:149703036-149703058 GAGGAGAGAGAGCTAGGAGGAGG + Intergenic
1034712250 7:153203913-153203935 TAGTAGAAAGACGATGGATGTGG - Intergenic
1034945489 7:155259163-155259185 GAGGAGGAAGAAGAAGGAGGAGG - Intergenic
1034949934 7:155290315-155290337 GGGGAGAAGGACCTAGGAGGAGG - Intergenic
1035153885 7:156896631-156896653 GGGGAGAAAGAGCAAGAAGGAGG + Intergenic
1035341489 7:158165412-158165434 GAGGAGAAGGACGGCGGAGGAGG - Intronic
1035419702 7:158717339-158717361 GAGGAGAAGGAAGAAGGAGGAGG - Intergenic
1035762773 8:2081476-2081498 GAGCAGACAGATCAGGGAGGAGG + Intronic
1035835081 8:2741456-2741478 GAGGAGGAAGTCCATTCAGGTGG - Intergenic
1036811291 8:11868730-11868752 GAGGAGAAGGACCTTGGGGGCGG + Intronic
1037322346 8:17656075-17656097 GAGGAGAAAGAAGAGGGAAGAGG + Intronic
1037568087 8:20134696-20134718 GAGGAGGAAGAAGAAGGAGGAGG + Intergenic
1037701775 8:21281961-21281983 GAGGAGAAACACCTGTGAGGGGG - Intergenic
1037934486 8:22906068-22906090 AAGGAGAAATGCTATGGAGGTGG + Intronic
1038284967 8:26198497-26198519 GAGGAGGAAGAAGAAGGAGGAGG - Intergenic
1038468217 8:27786315-27786337 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1038840612 8:31181207-31181229 GAGTAGAAAGAGCAGGGAGGAGG + Intergenic
1039148444 8:34476877-34476899 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1039371442 8:36987860-36987882 GAGGAGAGAGAGAATGGAGCAGG - Intergenic
1039444926 8:37623367-37623389 GAGGAGAATGATCATGTATGGGG - Intergenic
1040923439 8:52650314-52650336 GAAGAGAGAGACTCTGGAGGTGG + Intronic
1041255816 8:55978922-55978944 GAGGAGAAAGAAAAAGGAAGAGG - Intronic
1041279222 8:56194777-56194799 TAGGAGAAAGAGAATGGAGATGG + Intronic
1041411412 8:57560521-57560543 AAGGAGAAAGAGAAGGGAGGAGG - Intergenic
1042019789 8:64359521-64359543 GAAAAGAAAGACCACTGAGGAGG + Intergenic
1042157871 8:65864673-65864695 GAGAAGGAAGAACATGGAAGTGG - Intergenic
1044204395 8:89475350-89475372 GATGAGAAAGACAAAGGAGCAGG - Intergenic
1044972133 8:97630081-97630103 GAAGAGAAAGAAGAAGGAGGAGG + Intergenic
1045167449 8:99622711-99622733 TATGAGAAAGACTATGGATGCGG - Intronic
1045193671 8:99908304-99908326 GAGGAGAAGGAGCAGGGAAGAGG + Intergenic
1045395660 8:101758307-101758329 CAGGAGACAGCCTATGGAGGGGG - Intronic
1046681716 8:117177941-117177963 GAGGAGAAAGGAAAAGGAGGAGG - Intergenic
1048225563 8:132581983-132582005 GAGGAGAAAGTGAATGGAGGGGG - Intronic
1048240678 8:132738697-132738719 GAGGGGAAAGAGCAGGGATGTGG - Intronic
1048265662 8:132983453-132983475 GAGGAGAAAGAAGATGAATGAGG - Intronic
1048677969 8:136806011-136806033 GAGGAGAAAGTCCATTCAGGTGG + Intergenic
1048789456 8:138086096-138086118 AAGGTGACAGAGCATGGAGGAGG - Intergenic
1048789513 8:138086556-138086578 CAGGTGACAGAGCATGGAGGAGG - Intergenic
1049104309 8:140601914-140601936 AAGGGGAAAGACCGTGGAGGAGG - Intronic
1049138071 8:140923882-140923904 GAGCAGAGAGACCAGGTAGGAGG - Intronic
1049250564 8:141586690-141586712 GAGGAGGAAGTCCATGAAGATGG + Intergenic
1049410382 8:142471368-142471390 GGGGAGAAAGGACATGGAGCTGG + Intronic
1049566503 8:143341848-143341870 GAGGAGAAAGAGGAAGGAGGAGG - Intronic
1050304437 9:4294031-4294053 GAGGGAAAAGACCATCGAGCTGG - Intronic
1050475926 9:6041035-6041057 AAGGAGAAAGAGGAAGGAGGAGG - Intergenic
1051262574 9:15279212-15279234 GTGGAGCAAGATCATGCAGGAGG - Intronic
1052020923 9:23524489-23524511 GAGGAGAAAGACCAGGGCATGGG - Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052283880 9:26762651-26762673 GGGGAGAATGACCTTGAAGGAGG - Intergenic
1052507527 9:29375146-29375168 GAGCAGAGAGAGCATGGAAGAGG + Intergenic
1052640904 9:31165100-31165122 GAGGAGCAGAACCCTGGAGGTGG + Intergenic
1052698410 9:31908589-31908611 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1052738437 9:32369654-32369676 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1053441623 9:38120964-38120986 GAGGAGAAGGAGGAGGGAGGAGG + Intergenic
1054465367 9:65490253-65490275 GAGGAGGAAGTCCATTCAGGTGG + Intergenic
1055913032 9:81373274-81373296 GAGGAGGAAGAGCAGGTAGGGGG + Intergenic
1056389006 9:86123196-86123218 TAAGAGAAAGATCTTGGAGGTGG - Intergenic
1056439306 9:86604364-86604386 CAGGAGCAAGACCATGGGGATGG + Intergenic
1056933885 9:90900789-90900811 CAGGAGACAGAGCATGGAGCAGG - Intergenic
1057157236 9:92853746-92853768 GAGGAGAAAGACCCCTGTGGGGG + Intronic
1057925128 9:99139818-99139840 GAGGAGAAAAAAGATGAAGGGGG - Intronic
1058107423 9:100988564-100988586 GAGGAGGGAGACTAGGGAGGAGG + Intergenic
1058555600 9:106163483-106163505 GAAGAGAAAGACCATAGAGGTGG + Intergenic
1059072429 9:111152837-111152859 GAGGAGGAAGAGGAAGGAGGAGG + Intergenic
1059161587 9:112040023-112040045 GAGAAGAAAAACCATGGAGGAGG - Intergenic
1059403656 9:114086557-114086579 GAGAAGAAAGACCTTGTGGGAGG + Intronic
1059437235 9:114284187-114284209 GAGGATAAAGAGCATGCACGAGG + Intronic
1059551064 9:115229577-115229599 GAGGAGAAAGAGCAGGGAGGAGG + Intronic
1060051689 9:120382815-120382837 AAGGAGAAAGCCCTGGGAGGAGG - Intergenic
1060750703 9:126166524-126166546 GTGGAGAAAGTCCAAGGACGTGG + Intergenic
1060991276 9:127850549-127850571 GAGGAAAAAGAGCCTGGAGCAGG - Intronic
1061169889 9:128946521-128946543 GAGGTGGAAGAAGATGGAGGAGG + Exonic
1061366901 9:130176941-130176963 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
1061538776 9:131266145-131266167 GAGGGGTAAGGCCATGGTGGAGG - Intronic
1062049147 9:134438217-134438239 GTGGGGAAAGACTATGGAGAAGG - Intronic
1062049294 9:134438770-134438792 GAGGAAAAAGCCCAGGGACGGGG + Intronic
1062080853 9:134622624-134622646 GAAGAGAAAGAGGAGGGAGGAGG - Intergenic
1062080884 9:134622723-134622745 GAAGAGAAAGAGGAGGGAGGAGG - Intergenic
1062080915 9:134622824-134622846 GAAGAGAAAGAGGAGGGAGGAGG - Intergenic
1062158930 9:135069246-135069268 GGGGAGACAGAGCAGGGAGGGGG + Intergenic
1062322100 9:135995104-135995126 GTGGAGACAGACGGTGGAGGGGG - Intergenic
1062468340 9:136691334-136691356 GAGGAGACGGCCCAGGGAGGAGG + Intergenic
1062746133 9:138213157-138213179 GAGGAGATAGACGATGCAGGAGG - Intergenic
1185499241 X:584705-584727 GAGGAGGAAGAGCCTGGAGGAGG + Intergenic
1185603648 X:1355128-1355150 GAGGAGAATGGGCAGGGAGGAGG + Intronic
1185688325 X:1948435-1948457 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185688603 X:2133957-2133979 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185814490 X:3142390-3142412 GAGGAGGAAGAAGAAGGAGGAGG + Intergenic
1185872182 X:3673515-3673537 GGAGAGAAAGACCAGGTAGGAGG + Intronic
1185916210 X:4038251-4038273 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1186077601 X:5897980-5898002 GAGGAAAAAGGGAATGGAGGAGG - Intronic
1186268009 X:7852459-7852481 GAGGAGGAAGAAGATGAAGGAGG + Intergenic
1186334341 X:8570498-8570520 GCGGAGAAAGACTACGGATGGGG - Exonic
1186343725 X:8669453-8669475 TAGGGGAAATACCAGGGAGGAGG + Intronic
1186415153 X:9376878-9376900 GAGGATGAAGACCGAGGAGGTGG - Intergenic
1187025784 X:15434100-15434122 GAGGAGAAAGAAGGAGGAGGAGG + Intronic
1187025790 X:15434123-15434145 GAGGAGAAAGAAGGAGGAGGAGG + Intronic
1187025800 X:15434188-15434210 AAGGAGAAAGAAGAAGGAGGAGG + Intronic
1187025808 X:15434246-15434268 AAGGAGAAAGAAGAAGGAGGAGG + Intronic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187631269 X:21175318-21175340 AGGGAGAAAGAGTATGGAGGGGG + Intergenic
1188659451 X:32740480-32740502 GAGGAGAAAGAACAGAGAGAAGG + Intronic
1188741226 X:33784842-33784864 GAAGAAAAAGACAAAGGAGGAGG - Intergenic
1190408808 X:50114387-50114409 GAGGAGAAAGTCCATTCAGATGG + Intergenic
1190705340 X:53022532-53022554 GAGGTGAAAGTTCATGGCGGGGG + Intergenic
1191108380 X:56786597-56786619 GAGGAGAAAGAAGAAGGAGGAGG - Intergenic
1192191877 X:68996012-68996034 GAGAAGAGAGACAAGGGAGGAGG + Intergenic
1192670038 X:73130378-73130400 GAGGACAAGGCCCATGGAGGAGG - Intergenic
1192699464 X:73452411-73452433 AAGGAGGAAGATCCTGGAGGAGG + Intronic
1193077984 X:77375423-77375445 GTAGAGAAAGACCATCGTGGGGG - Intergenic
1193334445 X:80272412-80272434 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1193404058 X:81080965-81080987 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1193709701 X:84863851-84863873 GAGGAGGAAGTCCATTGAGATGG + Intergenic
1194402467 X:93455849-93455871 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1195012476 X:100746578-100746600 AAAGAGAAACACCGTGGAGGAGG - Intergenic
1195256457 X:103095718-103095740 GAGGAGAAAGTCCATTCAGATGG - Intergenic
1195669520 X:107457876-107457898 GAAGAGAAAGAGCAGGGAGGGGG - Intergenic
1196184754 X:112734158-112734180 GAGGAGAAAGAAAGAGGAGGAGG - Intergenic
1196769801 X:119282114-119282136 GAGAAGAAAGAAAATGGAGAGGG - Intergenic
1196882761 X:120213618-120213640 GTGGAGACAAACCTTGGAGGTGG + Intergenic
1198102881 X:133437124-133437146 GGGGAGAAGGTCCAAGGAGGCGG + Intergenic
1198533493 X:137566475-137566497 GGGAAGAAAGAGCAGGGAGGGGG - Exonic
1200934232 Y:8724278-8724300 GAAGAAGAACACCATGGAGGTGG - Intergenic
1201412744 Y:13716987-13717009 AAGGAGAAAGAGAATGGAGGAGG + Intergenic
1201463660 Y:14256147-14256169 CTGGAGAATGACCAGGGAGGTGG - Intergenic
1201637614 Y:16142770-16142792 GAGGAGGAAGAACATAAAGGCGG - Intergenic
1201891604 Y:18948794-18948816 CAGGAGAAAGTCCATTCAGGTGG - Intergenic
1201928434 Y:19315284-19315306 GAGGAGAAAGAAAGAGGAGGAGG - Intergenic