ID: 977859713

View in Genome Browser
Species Human (GRCh38)
Location 4:101942060-101942082
Sequence CTGATCTCTCTTTGGTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977859713_977859719 23 Left 977859713 4:101942060-101942082 CCCAAGAACCAAAGAGAGATCAG 0: 1
1: 0
2: 3
3: 27
4: 268
Right 977859719 4:101942106-101942128 GTCAGCAGGACTGAAACATCTGG No data
977859713_977859717 9 Left 977859713 4:101942060-101942082 CCCAAGAACCAAAGAGAGATCAG 0: 1
1: 0
2: 3
3: 27
4: 268
Right 977859717 4:101942092-101942114 ACACTGATGTGCCAGTCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 119
977859713_977859720 24 Left 977859713 4:101942060-101942082 CCCAAGAACCAAAGAGAGATCAG 0: 1
1: 0
2: 3
3: 27
4: 268
Right 977859720 4:101942107-101942129 TCAGCAGGACTGAAACATCTGGG 0: 1
1: 0
2: 2
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977859713 Original CRISPR CTGATCTCTCTTTGGTTCTT GGG (reversed) Intronic
901099704 1:6710143-6710165 CTTCTCTCTCTTTGTTTTTTAGG - Intergenic
901241372 1:7695705-7695727 CTGATCTCTCTTTGGCACCCTGG - Intronic
902299438 1:15491459-15491481 CTGACCTATTTCTGGTTCTTAGG - Intronic
903660073 1:24971604-24971626 ATGATCTTTCTCTGGGTCTTTGG + Intergenic
906766743 1:48440895-48440917 CTGATCTCTCTTTTCCTTTTTGG - Intronic
907584460 1:55604651-55604673 CTGGTGTCTCTTTGTCTCTTTGG - Intergenic
907841076 1:58158188-58158210 CTGAGCTCTGTTTGGGTCTGTGG - Intronic
909816371 1:79999779-79999801 CTGGACTTTCTTTGGTTCATAGG - Intergenic
910214689 1:84831213-84831235 CTGGTCTGTCTTTGGTTTTTTGG + Intronic
911192910 1:94965502-94965524 TTGTTCTCTCTTTAGTGCTTTGG + Intergenic
912821754 1:112873427-112873449 CTGATCTGTCTTTTGTTATAGGG + Intergenic
914844387 1:151273758-151273780 CTGATCTCTCTGGAGTCCTTTGG + Intergenic
915062040 1:153194176-153194198 CTGATCTCTCTTTTTTTTTCAGG - Intergenic
916874667 1:168956319-168956341 CTGGGCTTTCTTTGGTTCATAGG + Intergenic
917620251 1:176788218-176788240 CAGATATCACTTTAGTTCTTGGG + Intronic
918679950 1:187341389-187341411 CTGACTTCTCTTTGGCTCTTGGG + Intergenic
918745964 1:188200125-188200147 CTGATCTCTTTTTGCTCCTCAGG - Intergenic
919301845 1:195780080-195780102 ATGATCAGTCTTTGGTGCTTTGG - Intergenic
919314947 1:195960533-195960555 CTGATCACTTTTGCGTTCTTTGG - Intergenic
919767263 1:201135447-201135469 CTGATCTCTGTTGTCTTCTTGGG - Exonic
920773685 1:208914710-208914732 CTGATCTTTCTTTTTTTATTGGG - Intergenic
922186703 1:223281600-223281622 CTGAACTCTTTTTGGTTGGTAGG - Intronic
923388381 1:233488802-233488824 CTCATATCTGATTGGTTCTTGGG + Intergenic
924411848 1:243814064-243814086 CTGATCTCACTCTGTTGCTTAGG - Intronic
1063227167 10:4026605-4026627 TTGAGCTCTCCTTGGTTATTAGG + Intergenic
1064932163 10:20640135-20640157 CTGCTCTCTTTTTAGTCCTTAGG - Intergenic
1065160188 10:22911640-22911662 CTGATCTCTCTAGGGTTTTCTGG - Intergenic
1066784864 10:38992232-38992254 CTGGTCTTTTTTTGGTTGTTAGG + Intergenic
1067201650 10:44177465-44177487 CTCATCTCTCTTTGGAAGTTTGG - Intergenic
1067959864 10:50836227-50836249 CTTCTCTCTTTTTGGTTTTTGGG + Exonic
1069679080 10:70270887-70270909 CTGATCTCTCTTGGGTACCCTGG - Intronic
1069895872 10:71679700-71679722 AGGATCTCTCTCTGGTTCTTAGG + Intronic
1070679098 10:78436275-78436297 CTGCTCTCTCCTTAGTTCTGAGG + Intergenic
1071092244 10:81932061-81932083 CTGATATCTCTTGGCTTCTGTGG + Intronic
1072455865 10:95575296-95575318 CTGGTCTCTCTGTGGCACTTTGG - Intergenic
1073199688 10:101725208-101725230 CTGACCTTGCTTTGGTGCTTTGG - Intergenic
1074284555 10:112085756-112085778 CTGATCTCTGTTTGTTATTTTGG - Intergenic
1074428765 10:113374980-113375002 CTGATGTCTTTCTGGTTCTGGGG - Intergenic
1074848425 10:117419564-117419586 CTGATCTCTTCTGGGTCCTTTGG - Intergenic
1074925295 10:118062924-118062946 CTTATCTCTGTTTGGTTTTCAGG + Intergenic
1076263442 10:129090487-129090509 CTTTTCTCTCTGTGATTCTTTGG + Intergenic
1077488266 11:2849006-2849028 CTGCTCTCACCTTGGTTCCTGGG + Exonic
1078736410 11:14024716-14024738 CTGTTCTCTCTTAGGTCCATGGG + Intronic
1079537284 11:21529370-21529392 CTTGTTTCTCTTGGGTTCTTAGG - Intronic
1079972386 11:27051691-27051713 GTCTTCTCTCTTTGTTTCTTAGG + Intronic
1080001978 11:27360627-27360649 CTGACCTCTCTTTGGTGCCCTGG - Intronic
1080117543 11:28637669-28637691 CTGCTTTCCCTTTGGTTCTCTGG + Intergenic
1080201963 11:29682425-29682447 CTCAGCTCTTTTTGGCTCTTTGG - Intergenic
1082710309 11:56546999-56547021 CTGTTCTCACTTAGGTCCTTGGG - Intergenic
1084439989 11:69167332-69167354 CTGCTCTCTCTTGGGGTCTGTGG + Intergenic
1085290643 11:75396795-75396817 CTACCATCTCTTTGGTTCTTTGG + Intergenic
1085764743 11:79272997-79273019 CTGGTTTCTCTTTGCTTCTTAGG - Intronic
1085803289 11:79611494-79611516 CTGTTCTCCCTCTGGCTCTTGGG + Intergenic
1087154351 11:94886116-94886138 CACATCTCTCTTTGTTGCTTAGG - Intergenic
1087160285 11:94941926-94941948 CTGATTTATCTTTGATTCTCTGG + Intergenic
1088966564 11:114728106-114728128 CAAATCTCTCTTTGATTATTTGG + Intergenic
1089058292 11:115605848-115605870 CTGATCTGTGTTTGGTGCTGTGG + Intergenic
1089076855 11:115745361-115745383 CTGATCTCTCTATGGGGCTTGGG + Intergenic
1089876650 11:121728473-121728495 TTGATCTGGCTTTGGTTCATAGG - Intergenic
1089917114 11:122168484-122168506 TTGAGCTGTCTTTGGTCCTTGGG + Intergenic
1090403218 11:126462065-126462087 CTGAGCTCTTCTTGGTTCTGGGG + Intronic
1091800526 12:3321839-3321861 CTGATTTCTCTTTGAGACTTGGG + Intergenic
1091931828 12:4402644-4402666 GTGTTCTCTTTTTGGTTCTTAGG - Intergenic
1092990429 12:13892193-13892215 AGGATCTCACCTTGGTTCTTTGG - Intronic
1093580515 12:20780398-20780420 CTGATCTCGCTTTTCTTTTTGGG + Intergenic
1094363252 12:29652658-29652680 CTTATCTTTCTTTGTATCTTTGG - Intronic
1096019757 12:48314003-48314025 CTACTCACTCTTTGGTTCCTGGG + Intergenic
1097350955 12:58548514-58548536 CTGTTCTCCCTTGAGTTCTTGGG + Intronic
1100038776 12:90285168-90285190 TTGATGACTCTTTTGTTCTTTGG - Intergenic
1100810733 12:98335348-98335370 CTGATCTGTCTTTGGTATTATGG - Intergenic
1100818934 12:98413040-98413062 TTGATCTATCTTTGGTTGTGTGG + Intergenic
1101437243 12:104674457-104674479 CTGAACACTTTTTGTTTCTTGGG - Intronic
1102144044 12:110641070-110641092 CTGATCTCTCATTCGTTCTGGGG + Exonic
1103084511 12:118052216-118052238 CTTCCCTCTCTCTGGTTCTTGGG + Intronic
1103323552 12:120105391-120105413 CTGGTCATTCTTTTGTTCTTTGG - Intronic
1103650391 12:122427458-122427480 CTGATCTCTCCTTGGCTCAAAGG + Intergenic
1104767187 12:131337748-131337770 CTGATCTCGCTTTTCTTTTTTGG - Intergenic
1105467913 13:20664338-20664360 CTGTTCTCTTTTTTGTGCTTGGG + Intronic
1105702557 13:22944150-22944172 CTGTTCTCCCTGTGGTTCCTAGG + Intergenic
1105855180 13:24365933-24365955 CTGCTCTCCCTGTGGTTCCTAGG + Intergenic
1107842867 13:44477542-44477564 CTGATCACTCTTTGGATCTCAGG + Intronic
1108320838 13:49288871-49288893 CTTATCTCTATTTTGTTCTTAGG - Intronic
1108404097 13:50082198-50082220 CGGCTCTCCCTTTGCTTCTTCGG + Exonic
1109546222 13:63840517-63840539 CTCATCCCCCCTTGGTTCTTGGG + Intergenic
1109604478 13:64674626-64674648 CTGGTTTCTGTTTGGTCCTTAGG + Intergenic
1109858302 13:68162796-68162818 ATGATCTCTCTTTGATCCTTGGG + Intergenic
1110371265 13:74743235-74743257 CTGTTGTCTTTTTAGTTCTTGGG + Intergenic
1111098746 13:83550991-83551013 CGGATATCTGTTTGCTTCTTTGG + Intergenic
1111726578 13:92017302-92017324 CTGATCCTTTTCTGGTTCTTAGG + Intronic
1113060558 13:106317597-106317619 CTGCTCTCTTTTTGGTTTTGAGG - Intergenic
1113471661 13:110551186-110551208 CTGATCTCTTTTTCTTTCCTTGG - Intronic
1115006534 14:28492210-28492232 CTGGTGTCTCTATAGTTCTTGGG + Intergenic
1119016931 14:71067241-71067263 CTGGACTCTCTTTGGTTGGTAGG + Intronic
1120287363 14:82520846-82520868 CTCATCTTTCTTAGGTTCTTAGG - Intergenic
1123716481 15:23036657-23036679 CTGATCTCTCTTTCCTTAGTAGG + Intronic
1124392575 15:29273017-29273039 CTGATTTCTGTTTAGCTCTTAGG + Intronic
1127787813 15:62371677-62371699 CTGAACCCTCTTGGGTTTTTAGG + Intergenic
1128307472 15:66609122-66609144 CAGCTCTCTCTTTGGTTCCCAGG - Intronic
1129712522 15:77827736-77827758 CTGCTGTCTCTTTGTTTATTTGG + Intergenic
1133818639 16:9216861-9216883 CTGAGTTCTCTTAGGCTCTTAGG + Intergenic
1134306906 16:13041280-13041302 CTGATCTCTCTTTGTGCCTTGGG + Intronic
1134775688 16:16851369-16851391 TTGATCACTCACTGGTTCTTTGG - Intergenic
1135214505 16:20553471-20553493 CTGATCTCTATGTTGTTCTTTGG - Intronic
1139019150 16:62725728-62725750 CTGTTCACTCTTTGGGTCTGTGG + Intergenic
1140018155 16:71208907-71208929 CTGGGCTTTCTTTGGTTCGTAGG - Intronic
1140263898 16:73403920-73403942 ATGCTCTGTCTTTGGATCTTGGG + Intergenic
1140790837 16:78389445-78389467 CTCATCTGTCTGTGGTTGTTTGG + Intronic
1141743975 16:85913642-85913664 CTGGGCTCTCTTTGGTTCTGAGG - Intronic
1142067081 16:88068824-88068846 CTGCTCTCTCTTCCTTTCTTGGG + Intronic
1143062009 17:4209605-4209627 CTGAGCTATCTTTTGTCCTTTGG + Intronic
1144557344 17:16293965-16293987 CTGGTCTCTCATTGGCTTTTGGG + Intronic
1144731462 17:17528684-17528706 CTGACCTCTCATAGGTTCTGGGG - Intronic
1146642210 17:34550059-34550081 CTGAACTCTCTGTGGTTCTTGGG - Intergenic
1147496960 17:40925864-40925886 CTGCTATCTCTTTGTATCTTCGG + Intronic
1150914902 17:69426627-69426649 CTGATCTCTCTCTTATTCATAGG - Intronic
1151011219 17:70499041-70499063 CTAAGCTCTCTTTTGTTCTTTGG - Intergenic
1152683792 17:81683843-81683865 CGGACTTCTCATTGGTTCTTAGG + Exonic
1153704221 18:7728621-7728643 ATGTTCTCCCTTTGGGTCTTGGG + Intronic
1158498433 18:57978234-57978256 CTGATCTCCCTTTTTTCCTTAGG - Intergenic
1158675892 18:59517889-59517911 CAGATCCCTCTTTTGATCTTGGG - Intronic
1163048195 19:14660868-14660890 CTGATCTCTCTTTGGTTGGTTGG + Intronic
1164007054 19:21159796-21159818 CTGTTCTTTTTTTGGTTATTAGG + Intronic
1164071032 19:21768341-21768363 AACATCTCTCTTTGGTTCCTAGG + Intergenic
1164529407 19:29036753-29036775 CTGGTTTCTGTTTGGTTCTTAGG - Intergenic
1166569257 19:43783257-43783279 CGGCTCTTTCTCTGGTTCTTTGG + Intergenic
1167188244 19:47963400-47963422 CTGGTATCACTTTGCTTCTTAGG + Intergenic
925293314 2:2762628-2762650 CTGATCTGCCTTTGGGGCTTTGG - Intergenic
928732653 2:34250401-34250423 CTGACTTCTCTTGGTTTCTTTGG - Intergenic
930467360 2:51771674-51771696 CTGAACTCTTTTTGGTTGGTGGG + Intergenic
932473327 2:71979440-71979462 CTGTTTTCTTTTTTGTTCTTTGG + Intergenic
933584290 2:84162855-84162877 CTGATCTCACTCTAGTTTTTAGG + Intergenic
935411021 2:102762244-102762266 TGGAGCTCTCTTTGGTGCTTTGG + Exonic
936404513 2:112190639-112190661 TTGTTCTATCTTTGGTTCTTGGG + Intergenic
938271791 2:129978947-129978969 CTCATCTCTCTCTGTTTCATTGG - Intergenic
940460102 2:153954097-153954119 CTGATTAATCTTTGGTGCTTTGG + Intronic
940595151 2:155782070-155782092 CTGAGCTCTTTTTGGTTGGTAGG - Intergenic
941772966 2:169363243-169363265 CTGATCTCTCTAGGCTCCTTCGG + Intergenic
942807155 2:179945168-179945190 CTGATTTTTCTTTGATTCTCTGG + Exonic
946022149 2:216648152-216648174 CTGTTTTCTCTCTGGTCCTTGGG + Intronic
947459472 2:230290775-230290797 CTGCCTTCTCTTTGGTTCTTTGG - Intronic
947469766 2:230390237-230390259 CTGCCTTCTCTTTTGTTCTTTGG - Intronic
947891685 2:233627803-233627825 ATGATTTCTTTTTGCTTCTTGGG + Intronic
947896613 2:233680158-233680180 ATGATTTTTCTTTGCTTCTTGGG + Intronic
1169015505 20:2289629-2289651 CTTCTCTCTGTTTGGTTTTTCGG + Intergenic
1170277060 20:14602957-14602979 CTGGTCTCTCTTTGGTACTGAGG - Intronic
1172446943 20:34998167-34998189 CTGCTCTCCCTTTGATTCCTGGG + Intronic
1172713913 20:36949315-36949337 CCAACCTCTGTTTGGTTCTTGGG - Intronic
1173143210 20:40502888-40502910 CTGATGTCTCTTCTGTTCCTGGG - Intergenic
1173418751 20:42881765-42881787 TTGATTTCTCTTTCGTTCTTTGG - Intronic
1173801785 20:45898722-45898744 CTGAGCTCTGTTGGGTTCCTGGG - Exonic
1174529767 20:51202161-51202183 CTGGACTCTCTTTGGTATTTGGG + Intergenic
1174972246 20:55288828-55288850 CTGATCTCAGTCTGGTTATTAGG - Intergenic
1175035113 20:55992974-55992996 CTGCTCTCCCTATGATTCTTAGG - Intergenic
1175726411 20:61321554-61321576 CTCATCTCCCTTGGGTACTTGGG + Intronic
1177172883 21:17673095-17673117 CTGAACTCTCTTTGTGTGTTTGG + Intergenic
1178259198 21:31083279-31083301 CTGCTCACTCTTTGGGTCTTTGG - Intergenic
1179264474 21:39790734-39790756 CTCATTTCTGTTTGGTTCTGTGG + Intronic
1179836193 21:44035207-44035229 GTGAGCTCTCTTTGGCTCTCTGG + Intronic
1182860562 22:33555992-33556014 CTAATCTCTCTCTGGATCTCAGG + Intronic
951355695 3:21664316-21664338 CTCATATTTCTTTGTTTCTTTGG - Intronic
951786820 3:26429810-26429832 CAGATGTTTCTTTGATTCTTAGG + Intergenic
954036195 3:47852531-47852553 CTCATCTTTTTTTGGTTCTTTGG - Exonic
954786953 3:53100750-53100772 CTGATTTCTCTTTGTCTCTGAGG + Intronic
955732076 3:61997640-61997662 CTGTTGTCTGTTTAGTTCTTGGG + Intronic
956287354 3:67625031-67625053 TTGATGTTTCTTAGGTTCTTCGG - Intronic
959954849 3:112224856-112224878 ATGAGCTCTCTTGGGTTCTTTGG - Intronic
961156043 3:124680642-124680664 ATGATCTCTCTTGGGTTTTGTGG - Intronic
961208246 3:125104606-125104628 CTTATCTCTCCTTCTTTCTTAGG + Intronic
961874956 3:130015303-130015325 ATAATCTCTTTTTTGTTCTTAGG + Intergenic
962049245 3:131795478-131795500 CTGGTTTCTGTTTGGTCCTTAGG - Intronic
963841575 3:150113023-150113045 ATGACCTCTCTGTGCTTCTTGGG - Intergenic
964530765 3:157665344-157665366 CTGAGCTCTTTTTTTTTCTTTGG + Intronic
967583668 3:191188329-191188351 CTGATCTCGCTTTTCTTTTTGGG - Intergenic
967786498 3:193502663-193502685 CTGACCTCTCTTAACTTCTTGGG - Intronic
967899484 3:194434893-194434915 AGGATCTCTCTTTGTTGCTTAGG - Intronic
969558380 4:7929410-7929432 CTGAATTCTCTTTGTTTTTTAGG - Intronic
970837080 4:20422328-20422350 CTCATCTGTCTTTGGCTATTTGG + Intronic
971907633 4:32748109-32748131 CTGTTCTCACTTAGGTTCGTGGG - Intergenic
974331012 4:60479263-60479285 CTGATCTCTATGTAGTTTTTAGG + Intergenic
974332324 4:60496814-60496836 CTGTTTTCTCTCTGATTCTTAGG - Intergenic
976246086 4:83007563-83007585 CTGATTTCTCTGTGGTTTTACGG + Intronic
977667474 4:99657451-99657473 ATGCTCTCTCTTTGCCTCTTGGG - Intergenic
977687579 4:99866212-99866234 CAGACATCTCTTTGATTCTTGGG - Intronic
977859713 4:101942060-101942082 CTGATCTCTCTTTGGTTCTTGGG - Intronic
978997163 4:115170850-115170872 ATGATTTCTCTTTGATTCCTTGG + Intergenic
979235552 4:118396431-118396453 CTGACCTGTTTCTGGTTCTTAGG + Intergenic
980144468 4:128964419-128964441 CTGTTCTCCCTTGTGTTCTTGGG - Intronic
980731695 4:136832346-136832368 CTGTTCTCACTTAGGTTCATGGG + Intergenic
982100276 4:151960474-151960496 CTCATCTCTTTTTGGTTTTGTGG + Intergenic
982291387 4:153786348-153786370 CTCAAGTATCTTTGGTTCTTTGG - Intronic
983135584 4:164075686-164075708 CTGAGCTCTATTTGGTCTTTAGG + Intronic
983506247 4:168556808-168556830 CCGATGTCTCTTTGCCTCTTAGG + Intronic
987416552 5:17668450-17668472 CTGATCTCTCTGTTGTCCTTCGG - Intergenic
988616889 5:32783396-32783418 ATGTTATCTCTTTGGTTCTGAGG - Intronic
989344984 5:40419830-40419852 CTGGACTTTTTTTGGTTCTTAGG + Intergenic
989498532 5:42138319-42138341 CTGTTCTCACTTAGGTCCTTGGG + Intergenic
989762957 5:45042120-45042142 CTTGTCTCTCTTTCCTTCTTTGG + Intergenic
991372243 5:65931249-65931271 ATGAGCTGTTTTTGGTTCTTTGG + Intronic
991403932 5:66283462-66283484 CTTTTCACTCTTTGGCTCTTTGG + Intergenic
991603318 5:68375141-68375163 CTTGTCTCTCTCTGGTTATTTGG + Intergenic
992290274 5:75272567-75272589 TTGATCTCTCTTTGTTGCCTTGG + Intergenic
996316431 5:122165637-122165659 CTGAGTTCTCTTTGACTCTTAGG + Intronic
997107335 5:131035190-131035212 CTGATTTCTTTTTGGTTCACTGG - Intergenic
997225542 5:132206863-132206885 CTGATTTCTCTTTGGTTGCCTGG - Intronic
997818705 5:137043623-137043645 CTGATTCCTCTGTGGATCTTGGG + Intronic
999081771 5:148851114-148851136 CTCATATATCTTTGGATCTTGGG - Intergenic
999645951 5:153717329-153717351 CTCATTTCTCTTTGCTTCTGTGG - Intronic
1001044064 5:168357928-168357950 CTGCTATTTCTTTGGTTTTTAGG - Intronic
1003729381 6:8804081-8804103 CTGAACCCTCATGGGTTCTTCGG + Intergenic
1004974145 6:20946250-20946272 CTGACCTCTTTGTGGTTCCTTGG + Intronic
1005018768 6:21398254-21398276 CTGAACTGCCTTTGGTTATTAGG + Intergenic
1006069629 6:31488774-31488796 CTGACCTATCTTTGGGTTTTAGG - Intergenic
1008520157 6:52355545-52355567 CAGATCTCTTTTTACTTCTTTGG - Intergenic
1009668297 6:66711025-66711047 CTGATCTTTTTTTGGTTGGTAGG + Intergenic
1012037957 6:94166531-94166553 CATATGTCTCTTTGGTACTTTGG - Intergenic
1012389471 6:98720953-98720975 CTGAGTTCCCTTTGCTTCTTGGG + Intergenic
1014424966 6:121292948-121292970 CTGCTCTCTCTCTGTTGCTTTGG - Intronic
1014695743 6:124619161-124619183 ATTATGTCTCTTTGATTCTTAGG - Intronic
1016275996 6:142353148-142353170 CTGTTTCCTCTTTGATTCTTTGG - Intronic
1017306223 6:152921750-152921772 CTGATCTCCTGTTGGTTTTTAGG + Intergenic
1017524614 6:155231638-155231660 CTGAACTCTATTTAGTGCTTGGG - Intronic
1017726511 6:157279851-157279873 CTGATGTATCTTTGATTCTCTGG + Intergenic
1021846548 7:24768496-24768518 CTAAGCTCTCTTTAGTCCTTGGG + Intergenic
1023077920 7:36501862-36501884 CTGATCTCACTTTTCTTTTTGGG + Intergenic
1024209810 7:47193463-47193485 CTGCTGTATCTTAGGTTCTTTGG - Intergenic
1024799214 7:53057078-53057100 GTGTACTCTCTTTTGTTCTTTGG - Intergenic
1025783178 7:64619892-64619914 CTTTTCTCTCCTTGGTTCCTGGG - Intergenic
1026001985 7:66566982-66567004 CTGCTCTCACTTTGCTCCTTTGG - Intergenic
1028175825 7:87657332-87657354 CTGTTCTTTCTCTGGTCCTTTGG - Intronic
1028360945 7:89965528-89965550 CTAAGCTCTCTTTGGTTGTCAGG + Intergenic
1029607532 7:101608258-101608280 CTGATTTCTCTCTGGCTTTTGGG + Intergenic
1030505481 7:110416828-110416850 CTTATCTTTCTTTGCCTCTTTGG + Intergenic
1031803836 7:126282699-126282721 CAGATCACTATTTGATTCTTAGG + Intergenic
1032102380 7:128992923-128992945 CTCATCTCTCTTTAGCTCTATGG - Intronic
1032696477 7:134341031-134341053 CAGAGCTTTCTTTGGTTCTTAGG + Intergenic
1033064145 7:138136748-138136770 GTCATCTCTCTTTTGTTCTTAGG + Intergenic
1033971210 7:147041937-147041959 CAGATCTCTATTGGGTTCTCTGG - Intronic
1034186560 7:149182313-149182335 TTGAACTCTCTTTTATTCTTGGG - Intronic
1035303188 7:157911056-157911078 ATCATCTCTCTTTTCTTCTTTGG + Intronic
1035587903 8:789945-789967 CTGATCTCTGTTTTGTCCTGTGG + Intergenic
1036061830 8:5331418-5331440 CTAATATATCTGTGGTTCTTTGG + Intergenic
1038956817 8:32476902-32476924 CAGATCTATCTTTTGTTATTTGG + Intronic
1040077518 8:43252802-43252824 CTTAACTCTCGTTGTTTCTTGGG - Intergenic
1040094616 8:43431811-43431833 GTTTTCTCTCTTTGGTTCCTGGG - Intergenic
1041068322 8:54102863-54102885 CTGCTCACTCTTTGGGTCTGTGG + Intergenic
1041528891 8:58840147-58840169 CTTATCTCTTTTCGGTGCTTAGG - Intronic
1042529504 8:69800580-69800602 CTGTTCTCCCTTTGATTCATTGG + Intronic
1043148638 8:76684595-76684617 CTGACCTTTCTTTGTTCCTTGGG - Intronic
1043276838 8:78408098-78408120 CTGTACTCTCTAAGGTTCTTAGG + Intergenic
1043282173 8:78481693-78481715 TTGATCTTTTTTTTGTTCTTGGG - Intergenic
1044141928 8:88666368-88666390 CTTTTCTCTATTTTGTTCTTTGG - Intergenic
1044590086 8:93905844-93905866 CTGATCTCACTCTGTTTCTGAGG - Intronic
1045158721 8:99511362-99511384 CTTTTCTCTTTTTGGGTCTTTGG - Exonic
1045174537 8:99707651-99707673 ATGATTTCTTTTAGGTTCTTAGG + Intronic
1046316066 8:112503272-112503294 CTGCTCTCACTATGTTTCTTAGG + Intronic
1046345633 8:112922806-112922828 ATAATCTCTCTTTGGTTATACGG - Intronic
1046494211 8:114993250-114993272 CTCACCTATCTTTGCTTCTTGGG - Intergenic
1046760751 8:118017601-118017623 CTGATATCTGTTTTGTTCATTGG - Intronic
1048827065 8:138438626-138438648 CTGATCCCTCTCTTGTTCCTTGG - Intronic
1048842609 8:138578849-138578871 CTCACCTGCCTTTGGTTCTTGGG - Intergenic
1049738586 8:144223081-144223103 CTGATCTCCCATTTGTTCTCTGG + Intronic
1050400225 9:5245453-5245475 TTGATCTATCTTGGGTTCTCTGG - Intergenic
1050598858 9:7230777-7230799 CTGAGCTCTCCATGGTTCCTGGG + Intergenic
1051920862 9:22261746-22261768 CTGGTCTCTCTTTTGTTCCATGG + Intergenic
1052026723 9:23581860-23581882 CTGGTGTCTCCTTGGGTCTTAGG - Intergenic
1053234171 9:36437507-36437529 CTGATCTGACTTTTCTTCTTCGG - Intronic
1054826049 9:69574522-69574544 CTGATCTCTTTTTGGAACTCTGG + Intronic
1055570047 9:77607638-77607660 CTGCTCTGTATTTGTTTCTTAGG + Intronic
1056364974 9:85895225-85895247 TAGATTTCTCTTTTGTTCTTGGG + Intergenic
1057065579 9:92047131-92047153 CTGAAATCTCTTTGATTCCTTGG + Intronic
1059473538 9:114525465-114525487 CTGCTCTCTTTTTGGGTATTAGG - Intergenic
1059608234 9:115860006-115860028 CTGAGCTCTTTTTGGTTGGTAGG - Intergenic
1059739303 9:117134118-117134140 TTGATCTTCCTTTGTTTCTTTGG - Intronic
1060014315 9:120073382-120073404 CTGGGCTCTCTCTGGTTCCTGGG - Intergenic
1185895574 X:3855518-3855540 CAGATCTATTTTTAGTTCTTTGG + Intergenic
1185900693 X:3893942-3893964 CAGATCTATTTTTAGTTCTTTGG + Intergenic
1185905809 X:3932381-3932403 CAGATCTATTTTTAGTTCTTTGG + Intergenic
1186858662 X:13649576-13649598 CTAATACCTCTTTTGTTCTTTGG - Intergenic
1187100373 X:16185455-16185477 CTGGTCTTTCTTTTGGTCTTTGG - Intergenic
1188760554 X:34023732-34023754 TTAATCTCACTTTTGTTCTTAGG - Intergenic
1191153570 X:57246237-57246259 CTGGACTCTTTTTGGTTGTTAGG - Intergenic
1191925811 X:66308440-66308462 CTGGGCTCTTTTTGGTTCATAGG + Intergenic
1192874000 X:75209861-75209883 CTGGTCTCTTTTTAGTTTTTGGG + Intergenic
1193094127 X:77528059-77528081 CTGATATCTCTGTGGTTTCTGGG + Intronic
1193334957 X:80277254-80277276 CTGAGCTTTCTTTGGTTGGTAGG - Intergenic
1193923030 X:87452719-87452741 CAGATCTCAATTTTGTTCTTTGG - Intergenic
1196070216 X:111512565-111512587 CTGATCTCTGTTTGGTTCTCAGG - Intergenic
1198057120 X:133006355-133006377 CTGATTTCTCTTTGGTAATCAGG - Intergenic
1199037530 X:143070575-143070597 CTAATTTTTCTTTGGTTCTGTGG - Intergenic
1199789998 X:151144196-151144218 CTTATCTTTTTCTGGTTCTTAGG - Intergenic
1200298637 X:154949406-154949428 CTGTTCTGTATTTGGTTCTGAGG + Intronic
1200457927 Y:3415606-3415628 CTGTTCTCACTTAGGTTCGTAGG - Intergenic
1200913195 Y:8549063-8549085 CTGACCTCTCCTAGGATCTTGGG - Intergenic
1200930791 Y:8695219-8695241 CTGCTCTCTCTTGGGATCATGGG + Intergenic
1200964422 Y:9023351-9023373 CTGACCTCTCTTAGGATCATGGG + Intergenic
1201381122 Y:13380316-13380338 AGCATCTCTCTTTGGTTCTTAGG - Intronic
1202146651 Y:21805858-21805880 CTGATCTCTCTTTTCCTTTTGGG + Intergenic
1202177848 Y:22114055-22114077 CTGTCCTCTCTTAGGATCTTGGG + Intergenic
1202213513 Y:22472340-22472362 CTGTCCTCTCTTAGGATCTTGGG - Intergenic