ID: 977859716

View in Genome Browser
Species Human (GRCh38)
Location 4:101942068-101942090
Sequence CATTCTTCCTGATCTCTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977859716_977859719 15 Left 977859716 4:101942068-101942090 CCAAAGAGAGATCAGGAAGAATG 0: 1
1: 0
2: 5
3: 38
4: 296
Right 977859719 4:101942106-101942128 GTCAGCAGGACTGAAACATCTGG No data
977859716_977859717 1 Left 977859716 4:101942068-101942090 CCAAAGAGAGATCAGGAAGAATG 0: 1
1: 0
2: 5
3: 38
4: 296
Right 977859717 4:101942092-101942114 ACACTGATGTGCCAGTCAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 119
977859716_977859720 16 Left 977859716 4:101942068-101942090 CCAAAGAGAGATCAGGAAGAATG 0: 1
1: 0
2: 5
3: 38
4: 296
Right 977859720 4:101942107-101942129 TCAGCAGGACTGAAACATCTGGG 0: 1
1: 0
2: 2
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977859716 Original CRISPR CATTCTTCCTGATCTCTCTT TGG (reversed) Intronic
900643735 1:3699329-3699351 CAAACTCCCTGATCTCTCGTGGG - Intronic
901071385 1:6520702-6520724 CATTCTTTCTGGACTGTCTTTGG - Intergenic
901546429 1:9961315-9961337 CCTTCTTCCATCTCTCTCTTGGG + Intronic
905613912 1:39380616-39380638 CACTGTTCCTGGCCTCTCTTTGG - Intronic
906137385 1:43508853-43508875 CACTCTTCCAGGTCTCTCTTGGG + Intergenic
906850395 1:49242949-49242971 CATTCTTCTTCACCTCTCATAGG - Intronic
907184502 1:52599608-52599630 CCTTCTTCCCCATCTCTTTTGGG - Intergenic
907361872 1:53923457-53923479 CTTTCCACCTCATCTCTCTTTGG + Intronic
909496354 1:76283135-76283157 CATTGTTCCGGAGCACTCTTGGG - Intronic
909840675 1:80318913-80318935 TATTCTTCCTGTCCACTCTTGGG - Intergenic
909954704 1:81764605-81764627 CATTCCTCCTAGTCTCTCCTAGG - Intronic
910281481 1:85506262-85506284 CATTCTTCCTTCTCTCTCCATGG - Intronic
911075631 1:93871407-93871429 AAATCTTCCTTACCTCTCTTAGG - Intronic
913480480 1:119284052-119284074 CATTCTACCTGATCTTCTTTGGG - Intergenic
914257892 1:145975427-145975449 CATTCCAACTGACCTCTCTTGGG - Exonic
914721545 1:150293507-150293529 GATGCTTCCTGTTTTCTCTTTGG - Intergenic
915738959 1:158103532-158103554 CATCTTTCCTGATGTCTCTAAGG - Intergenic
916218724 1:162421812-162421834 CATTCTTCCATTTCTCTGTTAGG + Intergenic
917129004 1:171721229-171721251 CTTTGTTCCTGATCTCCTTTAGG - Intronic
917327556 1:173848864-173848886 CATTTTTTCTAGTCTCTCTTTGG + Intronic
917601010 1:176573789-176573811 GATTCTTCCTGATCCCTAGTAGG + Intronic
917845440 1:179016243-179016265 CATTCTTTATGGTCTCTCCTTGG + Intergenic
918291147 1:183109235-183109257 AATTCTGCCTGATTTCTCATTGG - Intronic
918426262 1:184413115-184413137 TATTCTTCCTGATATCTCTTTGG + Intronic
919273269 1:195378765-195378787 ATTTCTTCCTGCTCTCTATTTGG - Intergenic
921258612 1:213365326-213365348 CCTTCTACCTGAGCTTTCTTTGG + Intergenic
921410958 1:214836026-214836048 GATTCTTCCAGACCTCCCTTTGG + Intergenic
921479798 1:215650804-215650826 CAGTCTTGTTGATTTCTCTTTGG - Intronic
921694533 1:218192351-218192373 TTTTCTTCCTGGTCTCTCCTGGG - Intergenic
1063558761 10:7106965-7106987 CATTCTATCTGAGCTCCCTTTGG + Intergenic
1064969523 10:21050138-21050160 CATTCTTTATAATCTATCTTTGG + Intronic
1065591619 10:27268207-27268229 CATTCTTCCTGATCTTCCCAAGG + Intergenic
1065659394 10:27989988-27990010 CATTCTTCCTGATCTTCCCAAGG - Intronic
1065787939 10:29233833-29233855 CCTGCTTCCTGCTCTCTCTCTGG - Intergenic
1067406149 10:46025234-46025256 CATTCTTCCTCTCCTGTCTTTGG - Intronic
1068131199 10:52897441-52897463 TTTCCTTCCTGATCTCTCTTTGG + Intergenic
1068276192 10:54800706-54800728 CATTCTTCCTGATTACTGTCTGG - Intronic
1068472848 10:57487097-57487119 ACTTCTTCCTGATTTATCTTGGG + Intergenic
1069679083 10:70270895-70270917 TATACACCCTGATCTCTCTTGGG - Intronic
1069680569 10:70282420-70282442 CAATCTTCCAGATTCCTCTTGGG + Intronic
1071144999 10:82558300-82558322 CATTCTTCCTTATCTCTACAAGG + Intronic
1071162194 10:82760406-82760428 CATTGTTCATGTTTTCTCTTTGG - Intronic
1071240910 10:83703629-83703651 CATCCTTCCTGATATGACTTAGG - Intergenic
1072404255 10:95135070-95135092 CATTCTATCTTATCTCTCCTTGG + Intergenic
1073185702 10:101613944-101613966 CCTTCTGCCTGATCCCTCTCAGG - Intronic
1073615900 10:104994921-104994943 CATTTCTCTTGATTTCTCTTGGG + Intronic
1073818242 10:107231354-107231376 CTTTCTTCCTGATTTCTCCTGGG + Intergenic
1073842778 10:107517080-107517102 CATTCTTCCCTATCCCTCCTGGG + Intergenic
1074288045 10:112116683-112116705 CCTTCTCCCTGAGCTGTCTTTGG - Intergenic
1074687490 10:115973910-115973932 CATACGTCCTCATTTCTCTTGGG + Intergenic
1075095499 10:119468394-119468416 CCCTCTTTCTCATCTCTCTTGGG + Intergenic
1076128357 10:127993733-127993755 CTTTCTTCGTGTTCTCTCTCTGG + Intronic
1078030830 11:7749444-7749466 CCTTCTTCCTCCTTTCTCTTGGG - Intergenic
1078414158 11:11151437-11151459 CATTCTTCTTGTTTTCTCTAAGG + Intergenic
1078734351 11:14006459-14006481 CAGCCTTCCTGATCTCTCACTGG - Intronic
1078863510 11:15275467-15275489 CAAACTCCCTGACCTCTCTTTGG + Intergenic
1079175375 11:18135428-18135450 CATCCATCATGAGCTCTCTTAGG - Intronic
1080145282 11:28975770-28975792 CAATATTCCTGATATCTCTGAGG + Intergenic
1081904348 11:46657780-46657802 CCTTCTTTCTGCTCCCTCTTAGG + Intronic
1084276036 11:68051425-68051447 CAGTCTTCCTGATCCCTCCCAGG + Intergenic
1084906843 11:72355010-72355032 CAGTTTGCCTGATCTGTCTTAGG + Intronic
1085132680 11:74054929-74054951 CATACTTCCTCCTCTGTCTTAGG - Intronic
1085483480 11:76842059-76842081 CATTTTTCCAGATCTCTCCAGGG + Intergenic
1086182784 11:83974766-83974788 GATTCTACCTAATCTGTCTTGGG - Intronic
1086492455 11:87369259-87369281 CATTCTGCCAGATCTCCCTGGGG - Intergenic
1087091377 11:94276969-94276991 TATTCTTCCTGATATCTCCTTGG - Intergenic
1087285707 11:96262940-96262962 TGTTTTTCTTGATCTCTCTTTGG + Intronic
1087393852 11:97571753-97571775 CACTCCTCCTGTTTTCTCTTGGG + Intergenic
1087911981 11:103764551-103764573 CATTCTTCCTTATCTAACTAGGG + Intergenic
1087943699 11:104132431-104132453 AATTCTTAATGACCTCTCTTTGG + Intronic
1089258296 11:117205712-117205734 CCTCCATCCTCATCTCTCTTGGG - Exonic
1090491869 11:127170928-127170950 CAGTCTTCATGAACTCTTTTAGG + Intergenic
1090568114 11:128018212-128018234 CCTTCTTCATCTTCTCTCTTTGG - Intergenic
1090643593 11:128749499-128749521 CCTGCTTCTTGTTCTCTCTTGGG - Intronic
1091020234 11:132092909-132092931 CAAGCTGCCTGATCTCTCATTGG + Intronic
1091968468 12:4765285-4765307 CATTCTTCCTGCTGTCCCTCGGG + Intronic
1093582940 12:20805137-20805159 CATCTTTCAAGATCTCTCTTTGG - Intergenic
1093936115 12:25002531-25002553 CATTCTTTCTGATCTCTCCTAGG - Intergenic
1095223083 12:39641988-39642010 AATTCTTTCTGATCTTTCTTTGG + Intronic
1095939409 12:47716339-47716361 CTGTCTTCATGATCTCTCTGAGG + Exonic
1098188803 12:67926276-67926298 AATTCTTCCTCCACTCTCTTGGG - Intergenic
1098583480 12:72129768-72129790 CAATCTTACTGACCTCTCTTGGG - Intronic
1100478409 12:94955088-94955110 AATACTTCCTCATGTCTCTTTGG + Intronic
1100704560 12:97186264-97186286 GATTCTTCTTGGTCTCTCTGTGG + Intergenic
1101804052 12:108048052-108048074 CCTTCCTCCTGATTTCCCTTTGG - Intergenic
1102022414 12:109693028-109693050 CACCCTTCCTCATCTCCCTTGGG + Intergenic
1103556266 12:121768565-121768587 CATCCCTCCAGAACTCTCTTGGG - Intronic
1104308391 12:127631489-127631511 CATTCTTCCAGGTTTCTCTGTGG + Intergenic
1105320941 13:19321379-19321401 CACTCTTCCTGCTCTGTCCTAGG + Intergenic
1105665437 13:22551126-22551148 CATTCTTCCAGATATCTACTCGG - Intergenic
1105974105 13:25458124-25458146 CATTCCTTCTAATCTTTCTTGGG - Intronic
1107404806 13:40102490-40102512 CTTTCTTCTTGATCCCTCTGAGG - Intergenic
1107675864 13:42796292-42796314 CATTATTCCTGCTGTCTCTCAGG - Intergenic
1108269060 13:48740846-48740868 CATTCTCCTTAATCTCTCTTAGG - Intergenic
1108964485 13:56279830-56279852 AATTCTTCCTGATTTCTCTCAGG - Intergenic
1109243108 13:59916227-59916249 CAATCTTCCTGAGCTCTTTTCGG - Exonic
1109720892 13:66275404-66275426 CATTTTTCCTAGTCTCTTTTTGG + Intergenic
1112100052 13:96178643-96178665 CTTTCTACCTGAGATCTCTTAGG + Intronic
1112660391 13:101501232-101501254 CATATTTCCTGATCTATCTTTGG + Intronic
1112719461 13:102226677-102226699 CATTGTACCTGATCTCTTTAGGG + Intronic
1113241478 13:108343009-108343031 CATTTTTCCTTTTCTCTCCTAGG - Intergenic
1114625099 14:24123738-24123760 CTTTCTTCCTGAGGTCTCTAGGG + Exonic
1115341749 14:32300216-32300238 CATTCTTCCTTGGCTCCCTTTGG + Intergenic
1116146502 14:41077978-41078000 TATTCTTACTCATATCTCTTTGG - Intergenic
1116582184 14:46655929-46655951 CATTCTTCTTCTTCTTTCTTTGG + Intergenic
1117194972 14:53330750-53330772 CCATCTTTCTGTTCTCTCTTTGG + Intergenic
1117643830 14:57829642-57829664 CATTCTTCTTGGCCTTTCTTCGG - Intronic
1120071760 14:80111362-80111384 TATTCTTCCTGTTCTCACTTAGG - Intergenic
1120402548 14:84050072-84050094 CATTCTTCCCCTTTTCTCTTTGG - Intergenic
1120572357 14:86136689-86136711 AATTCTTCCCCATCTCTTTTTGG - Intergenic
1121359352 14:93242402-93242424 TCTTCTACCGGATCTCTCTTCGG + Exonic
1122239143 14:100350471-100350493 CATTCCTCGTGCTGTCTCTTTGG - Intronic
1122981513 14:105194281-105194303 CTTGCCTCCTGGTCTCTCTTGGG + Intergenic
1123064306 14:105608728-105608750 CATTCTTCCTGATTTCCATGTGG + Intergenic
1123073607 14:105654366-105654388 CATTCTTCCTGATTTCCATGTGG + Intergenic
1123093542 14:105753137-105753159 CATTCTTCCTGATTTCCATGTGG + Intergenic
1124701138 15:31913240-31913262 GATTCTTCCTTTTCTCTCATGGG + Intergenic
1125067658 15:35509794-35509816 CCTTCTTACTTATCTTTCTTTGG + Intronic
1125857034 15:42960513-42960535 CAGTGTTCCTGATTTCTGTTAGG - Intronic
1126102202 15:45125610-45125632 CATGCTTCTTGACCTCTCTGTGG + Intronic
1126179359 15:45769593-45769615 CATCCTTCCAGATGTCTCTATGG + Intergenic
1126437569 15:48651474-48651496 CATTCTTCCTCATCATTCTCTGG + Intergenic
1126579172 15:50227460-50227482 CATTATTACTGGTCACTCTTAGG + Intronic
1128514675 15:68334916-68334938 CATTCCTCCTCCTGTCTCTTGGG - Intronic
1128905781 15:71466548-71466570 CATTCTTCCTCATCCCTCTAGGG + Intronic
1130020220 15:80224018-80224040 CATTTTTGCTGTTTTCTCTTGGG + Intergenic
1130118938 15:81030060-81030082 TGTTCTTCCTGAGCTCTGTTTGG - Intronic
1130159541 15:81385050-81385072 CATCCTTCCTGGTGTCTCTGTGG + Intergenic
1130449413 15:84035752-84035774 CATGCTCCCTGTTCTCCCTTTGG - Intronic
1130565833 15:84994252-84994274 CATACTTCCTTATCTCTTTGAGG + Intronic
1132393844 15:101458090-101458112 CATTCGTCCTGCTCTCTCAGAGG + Intronic
1133498314 16:6341186-6341208 CATTCCTTCTGAACTCTCTATGG + Intronic
1133835834 16:9366496-9366518 AACTCTTCCTTCTCTCTCTTTGG - Intergenic
1135501281 16:22998172-22998194 CTTTGTTCCTGTTCTCTCTAGGG + Intergenic
1135995226 16:27242933-27242955 AGTTCTTCCTGATCCCTGTTGGG + Intronic
1137485374 16:48886035-48886057 GTTTCCTCCTGATCTCTCTTGGG + Intergenic
1138958356 16:61999438-61999460 CATTCTTCGTGCTCTCTGTGTGG - Intronic
1139220663 16:65178352-65178374 CATTCCTGCTGATCTCATTTTGG - Intergenic
1139697333 16:68684561-68684583 CCTTCTTCCTCTTCTCTCCTAGG + Exonic
1140299307 16:73740486-73740508 AATTGTTCCACATCTCTCTTTGG + Intergenic
1144341233 17:14312048-14312070 CTTACTTCCTTAGCTCTCTTTGG - Intronic
1144397047 17:14854574-14854596 CTTTCTTCCTGTGCTGTCTTGGG - Intergenic
1147473839 17:40690619-40690641 CATTCTTCTTTAACTCTCTTGGG - Intergenic
1148798426 17:50208707-50208729 CAGCCTTCCTTATCTCTCATTGG - Intergenic
1148986654 17:51628397-51628419 AATTTGTCCAGATCTCTCTTGGG + Intergenic
1149621364 17:58047719-58047741 CATTCTTCCTGCCCCCTATTAGG + Intergenic
1150242010 17:63641975-63641997 CATTCTTCTTGTCCTCTCTGAGG - Intronic
1150720409 17:67609648-67609670 GATTCTTCCTGCTCTCTCTTGGG - Intronic
1150896342 17:69214797-69214819 TATTTTTCCTGATCCCTCTGGGG - Exonic
1151022865 17:70639552-70639574 CATTCATCATCATCTCTCCTTGG - Intergenic
1155264439 18:24077183-24077205 CATTCCTGCTGCTCTCTCCTGGG + Intronic
1155971242 18:32085756-32085778 CTTCCTTCCTGATCTCTCATTGG + Intergenic
1156203945 18:34865554-34865576 AATTCTTGTTGATCTATCTTGGG + Intronic
1156698131 18:39792602-39792624 ATTTCCTCCTGATCTGTCTTTGG - Intergenic
1156802613 18:41136091-41136113 CCTTCTTCCCTGTCTCTCTTAGG - Intergenic
1157597812 18:48874637-48874659 CTTCCTTCCTGGTCTCTCTCAGG - Intergenic
1157895738 18:51465162-51465184 CTTTGTTCCTGCTCTCTCCTTGG - Intergenic
1158890847 18:61870604-61870626 CATTCTTCCTCTTCTTTTTTTGG + Intronic
1159722926 18:71915729-71915751 CAATCTTCCTCTTCTCTCTTTGG + Intergenic
1160498514 18:79389481-79389503 CATTCTATCTGCTCTCTGTTCGG - Intergenic
1160899231 19:1418916-1418938 AATTCTTACTAATCTATCTTAGG + Intronic
1165332009 19:35145243-35145265 CCTCCTTCCTGATATCTCTTTGG + Intronic
1168644492 19:58051411-58051433 GATTCTTCCTGCTCTCACGTTGG - Intronic
927260940 2:21089432-21089454 CAATCTTCCAGTTCTCCCTTCGG + Intergenic
928278516 2:29922908-29922930 CTTTCTTCCTGCTCTATGTTTGG + Intergenic
930268323 2:49226265-49226287 CATTGTTCCTGTTATCTTTTAGG - Intergenic
930351174 2:50256752-50256774 CATTTTTGCTCATCTCTCATTGG - Intronic
931175742 2:59852707-59852729 CCTTCAGCCTTATCTCTCTTTGG + Intergenic
931511340 2:62998965-62998987 CATTCATCCTTTTCTCTTTTGGG + Intronic
933017821 2:77152223-77152245 CATTCTCTCTGCCCTCTCTTGGG - Intronic
933126632 2:78616741-78616763 CACTTTTCCTAATGTCTCTTAGG + Intergenic
933467786 2:82677369-82677391 CATTTCTCCTGATTGCTCTTGGG + Intergenic
935409777 2:102749098-102749120 TATTCTTACTTATCTCACTTTGG + Intronic
937727402 2:125183642-125183664 CATTCTTCCAAATCGCTCCTTGG + Intergenic
937851592 2:126641184-126641206 CATTTTTTCTGTTCTCTCTTTGG + Intergenic
939544243 2:143533372-143533394 CATCCTTCCTTCTCTTTCTTTGG + Intronic
939748811 2:146014769-146014791 ATTTCTTCCTGATCTTTTTTCGG + Intergenic
940161357 2:150717257-150717279 AATTTTTCCTGATTTCTCCTAGG + Intergenic
940705931 2:157105060-157105082 CATTCCTCTTGTTCCCTCTTAGG - Intergenic
941039892 2:160609439-160609461 CTTTCTTCCTCATATCTCGTAGG + Intergenic
941598913 2:167514423-167514445 TATTCTTCCTGTTCTCTTGTAGG - Intergenic
942054732 2:172172090-172172112 CTATCTTCCTCATCTGTCTTAGG - Intergenic
943826474 2:192400201-192400223 CATTCTTCCTTCTTTCTTTTGGG - Intergenic
944052139 2:195481989-195482011 TATTCTTACTGATATCTTTTTGG - Intergenic
944915636 2:204357705-204357727 TTTTCTTCCTAAGCTCTCTTTGG + Intergenic
945306574 2:208265081-208265103 CTTTCTCCCTCATCTCTCTGAGG - Intronic
945352873 2:208802613-208802635 CTTCCTTCCTGAGCTCTTTTAGG - Intronic
945934683 2:215891301-215891323 CAATCTTCATGATTTCTCTGTGG + Intergenic
946347556 2:219123426-219123448 CATTCTTTCTGATGTTTCCTGGG - Intronic
947072613 2:226307657-226307679 GAGTCTTCCTGATCTCTTTTTGG + Intergenic
948311287 2:236988828-236988850 CACTTTTCCTCACCTCTCTTTGG + Intergenic
1171041020 20:21763657-21763679 CTTCCTTCTTGCTCTCTCTTGGG + Intergenic
1172502777 20:35438685-35438707 CATTCTTCAGCATCTCTCCTCGG - Intronic
1172694167 20:36810226-36810248 CATTCTGCCTGATTTGTATTTGG - Intronic
1173215027 20:41073113-41073135 CCTTTTCCCTGATCTCTGTTTGG + Intronic
1175295572 20:57906635-57906657 CTTTCCACCTGAGCTCTCTTGGG - Intergenic
1176036481 20:63040919-63040941 CTTTCTTCCTGAACTCATTTTGG + Intergenic
1177332840 21:19683980-19684002 CTTTCTTCCTGCTCGCTCTGAGG - Intergenic
1177884906 21:26735493-26735515 CATGCTTCCTCATTTCTGTTTGG + Intergenic
1179021971 21:37648718-37648740 CCTTCTTCCTGCTATTTCTTGGG + Intronic
1179126143 21:38592317-38592339 CAGGCTTCTTGGTCTCTCTTTGG - Intronic
1181762273 22:25066858-25066880 CTTGCTTCCTCATCACTCTTGGG - Intronic
949104915 3:192474-192496 CATTTTTCCTCATGTCTCTTTGG + Intergenic
950134199 3:10569178-10569200 CATTTTTCCCTATTTCTCTTGGG - Intronic
952415003 3:33082177-33082199 CACTCTCCCTTATCACTCTTAGG + Intronic
952779553 3:37082136-37082158 CATTTTTTCTTATCTGTCTTTGG - Intronic
952797108 3:37249589-37249611 TATTCTTCCTGTTTTGTCTTTGG + Intronic
953197840 3:40750775-40750797 CCTACTTCCTGATCTCCCTGAGG - Intergenic
955436960 3:58911169-58911191 CATTCTTCTTTACTTCTCTTGGG - Intronic
955559150 3:60170000-60170022 CATTCCTCCTGATTTTCCTTTGG + Intronic
955640096 3:61073186-61073208 CATCCATCCTGATCTATCTAGGG - Intronic
955784360 3:62521277-62521299 CAGGGTTCCTGATTTCTCTTAGG + Intronic
956986654 3:74709058-74709080 CTTCCTTCCTGATCTCACTATGG + Intergenic
957200008 3:77121494-77121516 CAATCTTACTGACCTCTCTTGGG + Intronic
957369309 3:79271556-79271578 CTTTCTTCCTGCTCTTTTTTTGG + Intronic
958570324 3:95873643-95873665 ATTTCCTCCTGATCTCTCTCTGG - Intergenic
959446868 3:106451058-106451080 CATTCTTCCTGCTGTCTGTGAGG - Intergenic
959755614 3:109894338-109894360 AATTTTTCATGATGTCTCTTAGG + Intergenic
960026319 3:113014829-113014851 CTTTCTCCCTTCTCTCTCTTGGG + Intronic
960641361 3:119826872-119826894 CATTGCTCATGCTCTCTCTTGGG - Intronic
962444957 3:135455875-135455897 CCATCTTCTTGTTCTCTCTTGGG - Intergenic
962745368 3:138394137-138394159 CAGTCTTCCTGCTCCCTCCTGGG + Intronic
963136355 3:141908903-141908925 CATTCTTCCTGCTCTGACTGGGG + Intronic
963932991 3:151023637-151023659 CACTCTTCCTCATCTCTTCTAGG + Intergenic
964184049 3:153921198-153921220 CATTTGTCCTGATCTCTCTTAGG - Intergenic
965165435 3:165189996-165190018 CTGTCTTCCTGATTTCTCGTAGG + Exonic
966210874 3:177452255-177452277 TTTTCTTCCTGATCTATTTTTGG - Intergenic
966387278 3:179412724-179412746 CATCCTTATTGTTCTCTCTTTGG + Intronic
966504309 3:180681865-180681887 CATTCATCCAGATCTAGCTTTGG + Intronic
967960252 3:194914770-194914792 GATTCTTCCAGATCTTTCTAAGG + Intergenic
967994901 3:195159120-195159142 CATTCTTCCTCATGATTCTTAGG - Intronic
969522842 4:7688848-7688870 CATTCCTCCTGATCTCTCTCTGG - Intronic
970770358 4:19605480-19605502 CACTTTTGCTGACCTCTCTTAGG + Intergenic
971237415 4:24855196-24855218 TATTATTCCTGATCTCTCCTAGG - Intronic
973176452 4:47212187-47212209 TATTTTTCCAGATCTCTCCTTGG - Intronic
973816265 4:54622329-54622351 CTCTCTTCCTGATCTCTCATGGG + Intergenic
974094893 4:57351848-57351870 CATACTTCCTACTCTCCCTTTGG - Intergenic
975097457 4:70474002-70474024 CATTCTTTCTGATGTCTCCTGGG - Exonic
977859716 4:101942068-101942090 CATTCTTCCTGATCTCTCTTTGG - Intronic
977941117 4:102860593-102860615 CATTCCTCTTGTTCTGTCTTGGG + Intronic
978119917 4:105066025-105066047 CATCCTTCCTATTCTTTCTTTGG + Intergenic
979797615 4:124866555-124866577 CAGTGTTCAGGATCTCTCTTTGG - Intergenic
980284391 4:130763406-130763428 CATTCTTTCTAATCTCTCCCCGG + Intergenic
980752108 4:137104328-137104350 CATTCTACCTTATGTCTCTATGG - Intergenic
981277001 4:142912250-142912272 CCTGCTTCCTGATCTTCCTTGGG + Intergenic
982037371 4:151359085-151359107 CATTGTTCCATATCTTTCTTTGG - Intergenic
982937414 4:161499564-161499586 CATTCTTCATGAGGTCTCATTGG - Intronic
983565949 4:169152216-169152238 GATTCTTTCAGACCTCTCTTTGG - Intronic
983630568 4:169845249-169845271 CTTTCTTCCTGGTTTCACTTGGG + Intergenic
983772835 4:171571972-171571994 CCTTCTTCTTGACCTCTCTATGG + Intergenic
984087765 4:175333330-175333352 CATTCTTGTTCATCTCTCTCAGG + Intergenic
986758025 5:10855884-10855906 CCTTGTTCCTGAGCTCTCTGTGG + Intergenic
987325553 5:16808987-16809009 TTTTCTTCCTTGTCTCTCTTTGG - Intronic
989950405 5:50291288-50291310 CATTCTCCCTGCTCTATCTATGG - Intergenic
990267519 5:54093436-54093458 CATTCTCCCTGCACTCACTTTGG + Intronic
991030241 5:62074900-62074922 CAGTTTTCCTGGTTTCTCTTGGG + Intergenic
991221878 5:64226809-64226831 CATTCTTCCTGATTTCCATGTGG - Intronic
991647781 5:68818646-68818668 CTTGCTTCCTCCTCTCTCTTAGG + Intergenic
992322096 5:75623491-75623513 CATTGTTCATCATTTCTCTTTGG + Intronic
994077245 5:95667356-95667378 CTTTCTTCCTCCTTTCTCTTCGG + Intronic
995054368 5:107743064-107743086 CATTCTTTCTGTCCTCTCTACGG - Intergenic
995127117 5:108589196-108589218 ACTTCTGCCTGGTCTCTCTTAGG - Intergenic
996840371 5:127841782-127841804 CATGCTTACTGATCACTCGTTGG - Intergenic
997845761 5:137284511-137284533 CTTCCTTCCAGATGTCTCTTAGG - Intronic
998176053 5:139902789-139902811 CATTCTTTCAGATCTCAGTTTGG + Intronic
998274773 5:140742134-140742156 CATTCTGCCTCATCTTTCTTAGG - Intergenic
998664527 5:144281425-144281447 CTTTCTTCCAGATTTTTCTTTGG + Intronic
998904097 5:146885415-146885437 GATTCTTACTTGTCTCTCTTAGG + Intronic
999670199 5:153952974-153952996 CTTTCTTCCTGTTCTCTTCTTGG + Intergenic
999882643 5:155883517-155883539 CATTCTTCCATCTCTCTCTTGGG - Intronic
1001299351 5:170522780-170522802 GATTCTCCCTGATCTCTGTAAGG + Intronic
1002008707 5:176258829-176258851 CATTTATCCTGAACTGTCTTTGG + Intronic
1002218015 5:177653423-177653445 CATTTATCCTGAGCTGTCTTTGG - Intergenic
1002842270 6:916297-916319 CATTGTTGCTGCTCACTCTTTGG + Intergenic
1003059901 6:2854672-2854694 CACTTTTACTGTTCTCTCTTAGG + Intergenic
1004648535 6:17586203-17586225 CATCCTTCCTGATTTCTTTGTGG + Intergenic
1005105640 6:22221658-22221680 CATTTTTCCTTCTCTTTCTTCGG - Intergenic
1005664496 6:28037787-28037809 AGTTTTTCCTTATCTCTCTTTGG + Intergenic
1006054427 6:31372487-31372509 CCTTCTTCCTTCTCTCTTTTGGG - Intergenic
1007023730 6:38548404-38548426 ATTTCTTCCTGTTCTCTTTTCGG + Intronic
1007880142 6:45155649-45155671 CATCCTTCATGCTCTCTTTTAGG - Intronic
1008302134 6:49854206-49854228 CATTCTTTCTAATCTTTCTAAGG + Intronic
1008306250 6:49904261-49904283 AATTCTTCATCATCTCTCATGGG - Intergenic
1008379937 6:50830069-50830091 CACTTTTCCTGTTTTCTCTTGGG + Intronic
1009039748 6:58162095-58162117 CATTCTTCCTCATCCCTCCCAGG + Intergenic
1009215643 6:60916941-60916963 CATTCTTCCTCATCCCTCCCAGG + Intergenic
1009835286 6:68992566-68992588 CATTCCTTTTCATCTCTCTTTGG - Intronic
1010090969 6:71981406-71981428 CATTCTTCTTGCTCAATCTTGGG + Intronic
1010374978 6:75157514-75157536 CTTTGTTCCTTATCTCTCTTAGG - Intronic
1011451391 6:87496159-87496181 CATTCTTTCTGACCTCTGTTTGG - Intronic
1011927633 6:92667400-92667422 CATTTTTCCTCATCCCTCTAGGG + Intergenic
1012239072 6:96851546-96851568 CCTTATTCCTGTTCTCACTTTGG + Intergenic
1013195651 6:107843347-107843369 CAATGTTTCTGATCACTCTTTGG - Intergenic
1014477488 6:121891285-121891307 CTTTCTTCCTTATTTCTCTCTGG + Intergenic
1018320156 6:162600076-162600098 CATTCATCTTGATCTGTGTTGGG - Intronic
1018797895 6:167201420-167201442 CATTCTTCCAGGTCTTTGTTAGG + Intergenic
1019325254 7:435022-435044 CATTCTTCCCCGGCTCTCTTCGG - Intergenic
1020409672 7:7877105-7877127 CATTCATCCAAATCTCTGTTAGG - Intronic
1023141390 7:37105829-37105851 CATTCTGCCTTCTCTCTCTATGG - Intronic
1023712408 7:43009013-43009035 AATTCTCCCTGATTTCTCATGGG + Intergenic
1026255682 7:68709188-68709210 CATTCCTCCTGATCTCTCAATGG - Intergenic
1027221755 7:76218517-76218539 CAGTCTTCCTGCTCTCTGTCAGG - Intronic
1028275160 7:88846625-88846647 CATTCTTCCTGTTCCTTCCTGGG - Intronic
1029607530 7:101608250-101608272 CATTCTTGCTGATTTCTCTCTGG + Intergenic
1031117844 7:117687624-117687646 CATTATTCCTATTCTCTCCTGGG + Intronic
1032282577 7:130516419-130516441 CATTTTTCCAGATTTCCCTTTGG - Intronic
1032612333 7:133428446-133428468 GCTTCTTCCTGATCACTCTAAGG - Intronic
1037181864 8:16016901-16016923 CATTCTTCATTATCTCTCTGAGG - Intergenic
1037334758 8:17781325-17781347 CATTCTTACTAATAACTCTTTGG - Intronic
1037961237 8:23099859-23099881 CATTCCTCTTGCTCTCTCTCAGG - Intronic
1037970441 8:23167998-23168020 CATTCCTCTTGCTCTCTCTCAGG + Intergenic
1038150414 8:24938391-24938413 TATTATTCCTGCTCTTTCTTTGG - Intergenic
1040030182 8:42816720-42816742 CATTTGTCTAGATCTCTCTTAGG + Intergenic
1043225672 8:77727089-77727111 AGTTCTTCCTGTTTTCTCTTTGG - Intergenic
1044818582 8:96139126-96139148 CATTATTATTTATCTCTCTTAGG - Intergenic
1045590365 8:103587384-103587406 TTTTCTTCCTGATGTGTCTTTGG - Intronic
1045611110 8:103843265-103843287 CATTGTTCTTGATTTCTTTTTGG + Intronic
1046840331 8:118849277-118849299 CCTTCTTCCTGTGCTGTCTTTGG + Intergenic
1047028931 8:120854712-120854734 CTTTCTTCCTGATCTTTACTAGG - Intergenic
1047692367 8:127368880-127368902 GATTCTTCCTGATCACTGTTTGG - Intergenic
1050734989 9:8752008-8752030 GCTTCTTCCTGATGTTTCTTGGG - Intronic
1054737487 9:68770170-68770192 CTTTCTTTCTGCTCACTCTTAGG + Intronic
1058012936 9:99998467-99998489 CACTCTTCCTGGTCTCTCCACGG + Intronic
1058049429 9:100391869-100391891 AATTCTTTCTGGTTTCTCTTGGG + Intergenic
1059542146 9:115141762-115141784 CATTTTTCCTGAGCTCCCTTTGG - Intergenic
1061726432 9:132584504-132584526 CATACTTCCTGGTCCCTATTTGG + Intronic
1186626488 X:11298910-11298932 CATGCTTCCTGATCTGACTCTGG + Exonic
1187483855 X:19683595-19683617 CTTTCTTGCTGATCTCTCTAGGG - Intronic
1187958919 X:24549162-24549184 GATTCTGCCTGGTCCCTCTTCGG - Intergenic
1189327831 X:40123667-40123689 CACACTTTCTGATTTCTCTTGGG + Intronic
1190845251 X:54184726-54184748 CATTCATCCCGATCACTCTTGGG - Intergenic
1191029468 X:55952433-55952455 CATTCTTTCTGATGGCTCTAGGG + Intergenic
1192113693 X:68390943-68390965 CATTCTTCCTGAAAGCTCTAGGG + Intronic
1193084911 X:77440283-77440305 CATCCTTCTTGATCTCTCCCAGG + Intergenic
1193735918 X:85156175-85156197 CATTCTTATTGCTTTCTCTTGGG + Intergenic
1195941216 X:110169434-110169456 CATTCATCCTGTTCTCTTTTTGG + Intronic
1198488657 X:137115206-137115228 CATTCCTACTGATGTCACTTGGG + Intergenic
1199210366 X:145202071-145202093 TATTCTTCTTGTTCTCTCTTGGG + Intergenic
1199731935 X:150642585-150642607 CAGTCTTCCTGTGCTCTGTTTGG + Intronic
1201406653 Y:13656948-13656970 AAATCTTGCTGATCTCTCTTTGG - Intergenic