ID: 977859719

View in Genome Browser
Species Human (GRCh38)
Location 4:101942106-101942128
Sequence GTCAGCAGGACTGAAACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977859714_977859719 22 Left 977859714 4:101942061-101942083 CCAAGAACCAAAGAGAGATCAGG 0: 1
1: 0
2: 1
3: 17
4: 240
Right 977859719 4:101942106-101942128 GTCAGCAGGACTGAAACATCTGG No data
977859713_977859719 23 Left 977859713 4:101942060-101942082 CCCAAGAACCAAAGAGAGATCAG 0: 1
1: 0
2: 3
3: 27
4: 268
Right 977859719 4:101942106-101942128 GTCAGCAGGACTGAAACATCTGG No data
977859716_977859719 15 Left 977859716 4:101942068-101942090 CCAAAGAGAGATCAGGAAGAATG 0: 1
1: 0
2: 5
3: 38
4: 296
Right 977859719 4:101942106-101942128 GTCAGCAGGACTGAAACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977859719 Original CRISPR GTCAGCAGGACTGAAACATC TGG Intronic
No off target data available for this crispr