ID: 977859809

View in Genome Browser
Species Human (GRCh38)
Location 4:101943366-101943388
Sequence CCATTAGATGACTGCTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977859804_977859809 27 Left 977859804 4:101943316-101943338 CCTAGCCACAGGATGGAGAACGT 0: 1
1: 2
2: 0
3: 16
4: 144
Right 977859809 4:101943366-101943388 CCATTAGATGACTGCTTCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 125
977859805_977859809 22 Left 977859805 4:101943321-101943343 CCACAGGATGGAGAACGTTGTCA 0: 1
1: 0
2: 2
3: 8
4: 113
Right 977859809 4:101943366-101943388 CCATTAGATGACTGCTTCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977859809 Original CRISPR CCATTAGATGACTGCTTCTG AGG Intronic
900170701 1:1267295-1267317 CCATGAGGTGAATGCTTATGAGG + Intronic
901737957 1:11324198-11324220 CCATTAGATGTCTGTGACTGAGG + Intergenic
902997102 1:20234729-20234751 TCATTCCATGAATGCTTCTGTGG - Intergenic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
904347310 1:29881556-29881578 GCATTGGAGGAATGCTTCTGTGG + Intergenic
905394758 1:37660090-37660112 CCTGGAGATGACTGTTTCTGGGG - Intergenic
908606347 1:65801053-65801075 AGATTAGATGAAAGCTTCTGGGG + Intronic
908617603 1:65939636-65939658 CACTTAGATGACTGCCTTTGTGG - Intronic
910087330 1:83419118-83419140 CCTTTTGATGACTGCCTGTGTGG + Intergenic
910944206 1:92571146-92571168 CCATTAAGTCATTGCTTCTGTGG + Intronic
913202039 1:116502738-116502760 CCAGTAGAAGCCTGCTCCTGAGG - Intergenic
924445850 1:244129766-244129788 CCATTATATGCCTGCCTCTTGGG + Intergenic
1066653178 10:37678846-37678868 CCATTAAATTCCTGCTTCTAAGG + Intergenic
1066946964 10:42069164-42069186 CCATTAGATGATTCCATTTGTGG - Intergenic
1066949063 10:42096012-42096034 CCATTAGATGATTGCATTCGTGG - Intergenic
1067037534 10:42931387-42931409 CCATTAAATTCCTGCTTCTAAGG + Intergenic
1067231981 10:44418399-44418421 CCTTAAGGTGTCTGCTTCTGGGG - Intergenic
1069774871 10:70920487-70920509 CCATTTGTTGAGTCCTTCTGAGG - Intergenic
1072905848 10:99452955-99452977 CCATCTGATACCTGCTTCTGGGG - Intergenic
1073848029 10:107581833-107581855 ACATTAGAGGACTGAGTCTGGGG - Intergenic
1073995773 10:109313960-109313982 GGATAGGATGACTGCTTCTGTGG - Intergenic
1074940431 10:118231397-118231419 TCTTTAGATGACTGCATATGCGG + Intergenic
1076100446 10:127773701-127773723 CGATTAGATGACACCTGCTGTGG + Intergenic
1078451927 11:11446935-11446957 CAATTAGATAAGTGTTTCTGGGG - Intronic
1079288788 11:19166886-19166908 ACATTAGATCACTTATTCTGCGG + Intronic
1079603013 11:22333546-22333568 CCTTAAGGTGACTGTTTCTGAGG - Intergenic
1079831161 11:25269868-25269890 CCATTATGTGACTGGCTCTGGGG + Intergenic
1080936542 11:36869697-36869719 CCATTAGAATAGTGCTTTTGAGG - Intergenic
1083055665 11:59816682-59816704 CCTTTAGATTAGTGATTCTGGGG + Intergenic
1086184157 11:83993567-83993589 CCACAAGTTGACTGCTTATGGGG + Intronic
1088129583 11:106471600-106471622 CCTTTAGATAACTGCCCCTGAGG - Intergenic
1088185209 11:107159230-107159252 CCATGAGATGACTGGTCATGAGG + Intergenic
1089031522 11:115334647-115334669 CCAGTGGATGTCTGATTCTGAGG - Intronic
1090119890 11:124015153-124015175 CCATGAGATTTCAGCTTCTGGGG + Intergenic
1091691745 12:2601847-2601869 CCTGCAGATGACTGCTTATGGGG + Exonic
1098713441 12:73798418-73798440 CCATTAGATTTCTGTATCTGAGG - Intergenic
1099025352 12:77458760-77458782 CAGTTAAATGACTGCTTCTATGG - Intergenic
1102063765 12:109955467-109955489 ATATTAGATCAGTGCTTCTGGGG + Intronic
1103406857 12:120681842-120681864 CCCTTAGTTGAATTCTTCTGAGG + Intergenic
1105950105 13:25222803-25222825 CCATTTGTTGACTTCGTCTGTGG - Intergenic
1106634836 13:31517251-31517273 CCTTCAGATGACTGCTTCCCTGG + Intergenic
1107459263 13:40585637-40585659 TCATGAGATGAAAGCTTCTGCGG + Intronic
1110179052 13:72593430-72593452 CCATTAGGTCACAGCTTCTACGG - Intergenic
1119523328 14:75302361-75302383 CAAAAAGATGACTTCTTCTGAGG + Intergenic
1120538878 14:85731390-85731412 AAAGTAGATGATTGCTTCTGTGG + Intergenic
1121797279 14:96745718-96745740 CCATTTAATGACTGGCTCTGGGG - Intergenic
1124610029 15:31201785-31201807 CCAAGAGCTGACTGCCTCTGGGG + Intergenic
1124743776 15:32320950-32320972 CCATTAGTTCACAGTTTCTGTGG - Intergenic
1130069017 15:80630862-80630884 CCATTAAATTACAACTTCTGGGG - Intergenic
1133997388 16:10758837-10758859 CCACTAGGTGACTGCTACAGAGG - Intronic
1136652456 16:31684475-31684497 CCTTTAGATGAGTGATTTTGGGG + Intergenic
1137654309 16:50147024-50147046 CTATTAGATGCCAGATTCTGGGG - Intergenic
1137907805 16:52342055-52342077 CCACAATATGTCTGCTTCTGGGG - Intergenic
1139341923 16:66273063-66273085 CCTTTAGGGGACTGATTCTGGGG - Intergenic
1149359839 17:55883596-55883618 ACCTTAGATGACGGCTTCAGTGG - Intergenic
1154503882 18:15014386-15014408 GCATAAGATGACTGCATTTGAGG - Intergenic
1157716250 18:49889511-49889533 CCAGTAGTTGACTGATTCAGAGG - Intronic
1159012863 18:63074768-63074790 CCTTTGGATTTCTGCTTCTGAGG + Intergenic
1162871320 19:13589031-13589053 CCACTTGCTGACTGATTCTGGGG - Intronic
926510104 2:13765506-13765528 CCTTTAAATGATTGCTTCTCTGG - Intergenic
928449033 2:31361855-31361877 CCATGATAGAACTGCTTCTGTGG - Intronic
932020534 2:68081127-68081149 CTATTAGATGACTGCAGCTATGG - Intronic
934721776 2:96583194-96583216 CCATTATCTGTCTGATTCTGTGG + Intergenic
938503066 2:131844566-131844588 GCATAAGATGACTGCATTTGAGG - Intergenic
945218854 2:207464167-207464189 CATTTTGATGACTGCATCTGAGG - Intergenic
948159211 2:235810466-235810488 CCATTACAAGACTCCTGCTGGGG - Intronic
1173404355 20:42752132-42752154 CGATTTGATGACTGTCTCTGTGG - Intronic
1174018173 20:47506114-47506136 CCATTTTATGAGTGCTTCTTGGG + Intronic
1175554329 20:59837249-59837271 CCATTAGAAGACACTTTCTGTGG - Intronic
1176264737 20:64203247-64203269 CAATTAGGTGACAGCTGCTGTGG - Intronic
1178896760 21:36565165-36565187 CCATGAGGTGAATGATTCTGAGG - Intronic
949609533 3:5690022-5690044 CCACAAGATTACTGTTTCTGTGG + Intergenic
950763805 3:15258330-15258352 CCATTTGCTGAGTGCTTCTTGGG + Intronic
950871593 3:16234404-16234426 TCAATTGAGGACTGCTTCTGGGG - Intergenic
952717075 3:36490633-36490655 GCAGTAGATGGCTGCTCCTGTGG + Intronic
953698772 3:45180170-45180192 CCTTTAGATGACTGCATCCCTGG - Intergenic
954226895 3:49187961-49187983 CCCTTACATGTCTGTTTCTGAGG + Intronic
955209072 3:56924332-56924354 CTATTAGATGAAAGCTGCTGAGG + Intronic
956854578 3:73263264-73263286 CCATTAGTTGACTGGCACTGTGG + Intergenic
957730874 3:84133650-84133672 ACATCAGATGTCTGCTTCTCAGG - Intergenic
958576330 3:95953418-95953440 CCATTTGATGACTGATTTGGTGG - Intergenic
960744915 3:120876687-120876709 CAATTAGATCGCTGCTTCTAAGG + Intergenic
964616561 3:158672675-158672697 CCCTGGGCTGACTGCTTCTGAGG + Exonic
966083194 3:176031425-176031447 ACATGAGATGAGTGCTTCAGGGG + Intergenic
968424827 4:516367-516389 ACTTTAGATAACTGCATCTGAGG - Intronic
969868040 4:10087895-10087917 CCATTTGCTTTCTGCTTCTGGGG - Exonic
972325173 4:38008308-38008330 CCATTCGATTACTTCTTTTGTGG + Intronic
972951512 4:44329922-44329944 CCAGTAGATGGAAGCTTCTGTGG - Intronic
972990904 4:44821703-44821725 CCATCAAGTGACTGTTTCTGTGG + Intergenic
977859809 4:101943366-101943388 CCATTAGATGACTGCTTCTGAGG + Intronic
978738978 4:112116177-112116199 CAATTTGATGACTGCTTATGTGG - Intergenic
980889759 4:138801862-138801884 TAATTAGAGTACTGCTTCTGTGG + Intergenic
981659110 4:147145659-147145681 CCATTACTTGTCTGCATCTGAGG - Intergenic
983926562 4:173409249-173409271 ACATTAGATGGGAGCTTCTGTGG + Intergenic
985174249 4:187184722-187184744 CCATTAAATGACAGTCTCTGGGG + Intergenic
985650734 5:1106033-1106055 CCATCAGCTGAGTGTTTCTGAGG - Intronic
990212066 5:53491523-53491545 CGATTTGATGACTTCTCCTGGGG - Intergenic
991366646 5:65875317-65875339 CTATTAACTGACTGCATCTGAGG + Intergenic
992371895 5:76152112-76152134 ACAATAGATGAGTGCTTCTGAGG + Intronic
995453881 5:112331846-112331868 CCACAAGGTGCCTGCTTCTGAGG + Intronic
996551057 5:124730893-124730915 CCACTCTATGAATGCTTCTGAGG - Intronic
997515660 5:134487552-134487574 CCTTCAGATGACAGCTTCTTTGG - Intergenic
998655989 5:144180339-144180361 GGATTAAATGAGTGCTTCTGTGG - Intronic
999616827 5:153433660-153433682 CCATTAGAGGACTTAATCTGGGG - Intergenic
1007599547 6:43073279-43073301 CCAAGAGTTCACTGCTTCTGCGG - Exonic
1008442680 6:51550585-51550607 CCTTTTGATAAATGCTTCTGGGG + Intergenic
1014033808 6:116741650-116741672 CCATCAGCTGACTGCTTTTTTGG - Intronic
1017169754 6:151445724-151445746 ACATTAGATGACCGATTCTTCGG + Exonic
1022120886 7:27306979-27307001 CCATTATAAGGCAGCTTCTGAGG - Intergenic
1027304210 7:76875602-76875624 CCTTTTGATGACTGCCTGTGTGG + Intergenic
1029842161 7:103376493-103376515 CCATTAGATAATTGCTACTGTGG + Intronic
1033220129 7:139522303-139522325 CCCTTAGAAGGCTGCTGCTGTGG + Intergenic
1034891018 7:154839397-154839419 CCAGTAGAGGACTGAGTCTGTGG + Intronic
1038118721 8:24587595-24587617 CTATTCGATGACTTTTTCTGGGG - Intergenic
1038491457 8:27974984-27975006 TCATGAGATGACTGGATCTGGGG + Intronic
1041501007 8:58538719-58538741 CCATCACGTGAGTGCTTCTGAGG + Intergenic
1045092584 8:98761851-98761873 CCATTTGAACACTGTTTCTGAGG - Intronic
1047538602 8:125742723-125742745 TCACTAGATGACTGCCTCTGGGG - Intergenic
1047794386 8:128239334-128239356 GCATAAGATGAATGCTTCTTGGG + Intergenic
1048557852 8:135498268-135498290 CACTTAGAAGACTGCTGCTGAGG - Intronic
1059178278 9:112187874-112187896 TCATAAGATGACTGCAGCTGCGG + Intergenic
1060522399 9:124301164-124301186 CCATCAGACAAGTGCTTCTGGGG - Intronic
1060877596 9:127094408-127094430 CCACTGGATTACTGTTTCTGGGG + Intronic
1186281440 X:7997444-7997466 CCATTAGATGCCTGCTTCTCAGG - Intergenic
1187450943 X:19395633-19395655 CCATTAGGTGGCTGCTGTTGTGG - Intronic
1187579857 X:20596101-20596123 GGAGTAGGTGACTGCTTCTGGGG + Intergenic
1187589087 X:20696003-20696025 CCATTATTTGCCTGGTTCTGAGG - Intergenic
1193526013 X:82590465-82590487 ACATTATATGTGTGCTTCTGAGG - Intergenic
1193763838 X:85500893-85500915 ACATTAAACAACTGCTTCTGGGG - Intergenic
1196365819 X:114922444-114922466 CCAAAAGAGGACTGCATCTGAGG + Intergenic
1201370721 Y:13260793-13260815 CTATTATATAACTGCTTGTGAGG - Intronic