ID: 977860310

View in Genome Browser
Species Human (GRCh38)
Location 4:101950166-101950188
Sequence AGTTAGCTGAAGGATATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977860306_977860310 5 Left 977860306 4:101950138-101950160 CCTTGCCTCTATATGACCTAATT 0: 1
1: 0
2: 0
3: 8
4: 167
Right 977860310 4:101950166-101950188 AGTTAGCTGAAGGATATGACTGG 0: 1
1: 0
2: 0
3: 6
4: 146
977860307_977860310 0 Left 977860307 4:101950143-101950165 CCTCTATATGACCTAATTGATAA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 977860310 4:101950166-101950188 AGTTAGCTGAAGGATATGACTGG 0: 1
1: 0
2: 0
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977860310 Original CRISPR AGTTAGCTGAAGGATATGAC TGG Intronic
902139842 1:14343828-14343850 AGTTTGCCGAAGGAAATGAAAGG - Intergenic
902255410 1:15186024-15186046 AGGTAGCTGGAGGACAGGACTGG - Intronic
906227437 1:44133399-44133421 AGTTAACTAAAGGATGTGTCAGG + Exonic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
916387480 1:164291355-164291377 AGTTAGGTGAAGTTTATTACTGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921763025 1:218939286-218939308 AGTTAGGTGAAGAAGGTGACTGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
922789328 1:228302210-228302232 AGGTAGCTGAAAGATATTTCAGG - Intronic
1065716973 10:28580435-28580457 AGTTTGCTGAAAGACCTGACAGG - Intronic
1066017319 10:31260777-31260799 AGGTAGGTTAAGGATATGGCAGG + Intergenic
1066508067 10:36066034-36066056 AGGGAGCTGAAGGAGATTACTGG + Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067010143 10:42703560-42703582 AGTTAGGGGAAGGATATCTCAGG + Intergenic
1067313616 10:45140078-45140100 AGTTAGGGGAAGGATATCTCAGG - Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1069353032 10:67552300-67552322 AGTTGGCTCAAGGATTTGGCTGG - Intronic
1075235302 10:120722427-120722449 ACTTAGCTGAAGGCTTTGGCTGG - Intergenic
1079711585 11:23690033-23690055 AGTGAGCTGAAGGTTTTGCCTGG - Intergenic
1081725695 11:45327059-45327081 AGATTGCTGAAGGATATTAAAGG - Intergenic
1084290745 11:68164840-68164862 ACTTAGCTCCAGGATAAGACAGG - Intronic
1086833720 11:91597196-91597218 AGTTGGCTGATTAATATGACTGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088671752 11:112147622-112147644 AGATAGCTGAGGGATTTGTCTGG + Intronic
1092330322 12:7581121-7581143 AGGTAGCTGCAGGATGGGACAGG + Intergenic
1092609780 12:10159975-10159997 AGGTACCTGAAGGGTATGTCTGG + Exonic
1095638725 12:44462069-44462091 AGTAAGATGAAGGAAATGAGGGG + Intergenic
1096207922 12:49738923-49738945 AGTCAGCTTCCGGATATGACTGG - Intronic
1096355706 12:50938816-50938838 AGTTACTCAAAGGATATGACAGG + Intergenic
1097879388 12:64673207-64673229 TGTTAGCTGAAGGAGATGTATGG + Intronic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1107772231 13:43800401-43800423 AGTTGGGAGAATGATATGACTGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1110776902 13:79418369-79418391 AGTTAGATGAAGGATAGGGTTGG - Intergenic
1111452689 13:88439225-88439247 AGTTTGCTTAAGGATATAAGAGG + Intergenic
1112220464 13:97484571-97484593 AGTTAGCTAAATGATAGGCCTGG + Intergenic
1112820198 13:103324902-103324924 AGTTAATTAAAGGTTATGACAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1122096004 14:99373137-99373159 TCTTAGATGAAGGATATGACTGG - Intergenic
1125277579 15:38009631-38009653 AGTTAGCTTAAGCATATAATGGG + Intergenic
1128550758 15:68596616-68596638 AGATAGGTGAAGGATAAGGCTGG + Intronic
1128712933 15:69885515-69885537 GGTTAGTTGAAGGTTATTACAGG + Intergenic
1128784737 15:70386391-70386413 GGTTAGTTGAAGGTTATTACAGG - Intergenic
1131604827 15:93891006-93891028 ATTTAGCAGAAGGATATGAAAGG + Intergenic
1135084379 16:19463312-19463334 ATTGAGCTGAAGGATACGATGGG - Exonic
1138461289 16:57149422-57149444 AGTCAGCTGAAGGATCTGTTAGG + Intergenic
1140901104 16:79368763-79368785 AGTTAGCTGTGGGATATCAGAGG - Intergenic
1152267843 17:79306635-79306657 AGTTGGCAGAAGGATGTGAGAGG + Intronic
1159783719 18:72689795-72689817 AGTCATCTGAAGGCTCTGACTGG - Intergenic
1168377043 19:55888846-55888868 AGTTAGCTGCAGGACAAGAGAGG - Intergenic
925876357 2:8314349-8314371 AGATAGTTGAAGAATAAGACAGG + Intergenic
928403813 2:30998876-30998898 AGTTGGCTGAGGAAAATGACAGG - Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
935019610 2:99216971-99216993 AATTAGCTGAATGTGATGACAGG + Intronic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
939413260 2:141859093-141859115 AGTAAGCTCAAGGTTATGAGAGG - Intronic
944278808 2:197871190-197871212 AGTTAGCTGAGGGATGTGAGGGG + Intronic
945692976 2:213065010-213065032 ATATGGCTGAAGGATATGATGGG - Intronic
1173829928 20:46076296-46076318 AGTTATCTCAAGGCTTTGACTGG + Intronic
1175929857 20:62488673-62488695 AGTTTGCTGAATGAAATGAGAGG + Intergenic
1178704365 21:34861233-34861255 ATCTAGCTGAAGGAGAGGACTGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG + Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
953095629 3:39772473-39772495 GGTTACCTCAAGGATATGAATGG + Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957428821 3:80075228-80075250 AGTTAGCAGAAAGAAAGGACAGG + Intergenic
958498620 3:94876596-94876618 AGTTAGCTGAAGAATATTGGAGG + Intergenic
960607793 3:119525991-119526013 TGATAGCTGAAGAATATGAAGGG + Intronic
961933823 3:130562021-130562043 AGTTAGCTGAAGGTAAAGTCAGG + Intronic
962118412 3:132536223-132536245 AGTTAGCTGGATGATGTGGCAGG + Intronic
963627319 3:147689816-147689838 AGTTAGCTGAAGGTTGAGAGAGG + Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
971136618 4:23875661-23875683 ATTTAGCTGAAGAATATCGCTGG - Intronic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
975890506 4:79021542-79021564 AGTAAGCAGCTGGATATGACGGG + Intergenic
977120120 4:93089668-93089690 AGTTAGCTGTAAGATATCCCGGG - Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977316363 4:95453609-95453631 TGTTTGCTGAAGGAAATGAAGGG - Intronic
977860310 4:101950166-101950188 AGTTAGCTGAAGGATATGACTGG + Intronic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
979410677 4:120375092-120375114 AGTTAGTTGGGGGACATGACGGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980682073 4:136176532-136176554 AGGTAGCTTAATTATATGACAGG - Intergenic
981866505 4:149426586-149426608 AGTTATCTGAAGGATTGAACTGG + Intergenic
982889662 4:160831826-160831848 AATTGGCTGAAGGATGTTACAGG + Intergenic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
987830117 5:23085062-23085084 AGATAGCTTCAGGAAATGACAGG - Intergenic
989465810 5:41753936-41753958 AGCTAGCAGAAGCACATGACGGG + Intronic
989641718 5:43589337-43589359 AGGTAGCTGATAGAGATGACTGG + Intergenic
991212316 5:64119989-64120011 TGGTAGCTGAAGGAGATTACAGG + Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992166544 5:74057555-74057577 AGTTACCTAAGGGATATGTCCGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
999511983 5:152261686-152261708 ATTTAGCTGAAGGATTTTATTGG + Intergenic
1001994467 5:176144652-176144674 ATTTAGCTGAATGAGATGCCTGG + Intergenic
1004603442 6:17172743-17172765 AATTAGCTTAAGCATATGAAGGG - Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009996388 6:70900140-70900162 ATTTAGCTGGAGGTTATCACAGG - Intronic
1013997413 6:116324716-116324738 AGTTAGCTTAAGGAAAGAACAGG + Intronic
1016277175 6:142367689-142367711 TGTTATCTGAATGATATAACCGG - Exonic
1019020694 6:168915232-168915254 AGTTAGGTGCAGAATAAGACAGG + Intergenic
1028611393 7:92715991-92716013 AATTATCTGAAGGTTATGAATGG + Intronic
1030800775 7:113848599-113848621 AGTGAGCTGAAGAATTTGCCAGG - Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032865734 7:135922186-135922208 AGTTAGTTGAAGCAAATGAAAGG - Intergenic
1034518411 7:151600041-151600063 CCTTGGCTCAAGGATATGACTGG + Intronic
1036166012 8:6434335-6434357 AGTGAGATGAAGGATTTGCCTGG - Intronic
1038716972 8:29999957-29999979 AGTTAGCTCCAGGGTATGGCAGG + Intergenic
1038858999 8:31365223-31365245 AAATGGGTGAAGGATATGACCGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1043200168 8:77359094-77359116 AGATTGCTTAAGGAAATGACTGG - Intergenic
1043687684 8:83107915-83107937 AGTTAGGTGAAGGAGCTGGCAGG - Intergenic
1048348401 8:133595698-133595720 AATTAGCCTAAGGATATGACTGG - Intergenic
1048751867 8:137686539-137686561 AGTTAGCTGGAAGAAAAGACAGG + Intergenic
1049950789 9:641735-641757 TGGTAGCTGAAGGTTAAGACAGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1059887701 9:118765180-118765202 AGAAAGCTGAAGGAAATCACGGG - Intergenic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1187448526 X:19377632-19377654 AGAGAGCTGAAGGCTGTGACTGG - Intronic
1188265097 X:28063828-28063850 ATTTTGCTGAAGGAAATGACAGG - Intergenic
1188774484 X:34197271-34197293 AGTTTGCTGATGGATGTGACAGG - Intergenic
1188800485 X:34524098-34524120 AGATAGCTGAAGGATAGGGTCGG + Intergenic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194163223 X:90481804-90481826 AGTTAGATGAACAATAGGACAGG + Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1196234967 X:113268975-113268997 TGTTACCATAAGGATATGACTGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198379385 X:136069802-136069824 AGTTAGATCAATGCTATGACAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200509496 Y:4059530-4059552 AGTTAGATGAACAATAGGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic