ID: 977864357

View in Genome Browser
Species Human (GRCh38)
Location 4:102005859-102005881
Sequence CAGGAATTAAACTTGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977864355_977864357 -10 Left 977864355 4:102005846-102005868 CCAATTGCACTGTCAGGAATTAA 0: 1
1: 0
2: 2
3: 8
4: 146
Right 977864357 4:102005859-102005881 CAGGAATTAAACTTGGCTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977864357 Original CRISPR CAGGAATTAAACTTGGCTGC TGG Intronic
902077516 1:13799675-13799697 CATGCATTTAACTTGGCTGCTGG - Intronic
907565426 1:55429580-55429602 CAGGAATTGACCTTGGCTTTTGG - Intergenic
907982022 1:59492519-59492541 CAGAAATAAAGCCTGGCTGCTGG + Intronic
909585719 1:77285361-77285383 CTGCAATTGAACTTGGCTGATGG + Intronic
912750572 1:112283821-112283843 TAGGAATCAAACTTGGCTTTGGG - Intergenic
919068476 1:192723862-192723884 CAGGATTTGAACTGGGCAGCCGG - Intergenic
919593240 1:199530047-199530069 CATTAATTAAACTTGTCTGATGG - Intergenic
919965178 1:202515969-202515991 CTTGAATTAAACTTGGTTTCAGG - Intronic
920263597 1:204706240-204706262 TTGGAATCAAAATTGGCTGCAGG + Intergenic
922883077 1:228997215-228997237 CAGGAGTTAAACCAGGCTTCTGG + Intergenic
923991369 1:239440507-239440529 CAGGTAGGAAACTAGGCTGCTGG + Intronic
924684141 1:246269867-246269889 CAGGAATAATACTTGACCGCTGG - Intronic
1063341143 10:5264086-5264108 CAGGAATCAAACTTGACTTATGG - Intergenic
1063368694 10:5507355-5507377 CAGGCATCAAGCTTAGCTGCAGG + Intergenic
1067901803 10:50249497-50249519 CAGAAATGAAATTTGACTGCTGG - Intergenic
1073517055 10:104086021-104086043 CAGGAATCAAACTTTACTGGAGG + Intergenic
1073629058 10:105129852-105129874 TAGGAATTCATCTTGGCTGAGGG + Intronic
1074849407 10:117427130-117427152 AAGGTTTTAAACATGGCTGCAGG + Intergenic
1075884751 10:125889233-125889255 CAGAAATTAATCTTGGCTTTAGG - Intronic
1076509331 10:131000880-131000902 CAAGAGTTGAACTTGGCTGGGGG + Intergenic
1077974659 11:7235185-7235207 TATGAATTAAACTTGGGTGGGGG + Intergenic
1078808061 11:14726350-14726372 CAGGCATTATTCTTGGCTGTTGG - Intronic
1079412525 11:20202416-20202438 CAGTAAACAAACTTGGCTGCAGG + Intergenic
1085815976 11:79737872-79737894 CAGGAACCAAGCATGGCTGCAGG + Intergenic
1087047426 11:93853810-93853832 AAGGAATCAAACTTGACTGATGG - Intergenic
1092390865 12:8077415-8077437 CATGAATAAAACTTGGCCCCAGG - Intergenic
1092779656 12:11973741-11973763 CAGAAATTAAACTTGGCCATGGG + Intergenic
1094470409 12:30796717-30796739 CAGAAATTAAATTTGGGGGCCGG - Intergenic
1095632609 12:44396156-44396178 CAGTAGTTCAACATGGCTGCAGG - Intergenic
1098493900 12:71112666-71112688 GAGAAATTAAAGCTGGCTGCAGG - Intronic
1099496313 12:83351205-83351227 CAGGAAATAAAATTGTTTGCTGG + Intergenic
1102296550 12:111741350-111741372 CAGGGAGAAAACTTGGCAGCCGG - Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105248192 13:18671738-18671760 CAGAAATCAGACTTGGGTGCCGG + Intergenic
1111282966 13:86051331-86051353 CTGGATATAAACTCGGCTGCTGG + Intergenic
1113875189 13:113589830-113589852 CAGGCAGGAAACTTGGCCGCAGG - Intronic
1115555595 14:34542878-34542900 CAGGATTTAACTTTGGCTACAGG + Intergenic
1115558313 14:34560215-34560237 CAGGATTTAACTTTGGCTACAGG - Intergenic
1117086101 14:52203006-52203028 CAGCTATCTAACTTGGCTGCTGG + Intergenic
1119697411 14:76724589-76724611 CAAGAATTAAGCTATGCTGCTGG - Intergenic
1120031797 14:79650057-79650079 CAGGAATTGAACTTGGTTGGAGG + Intronic
1121268790 14:92623849-92623871 CAGGAAGTAAACTTGGCATCTGG + Intronic
1123514217 15:21020163-21020185 TAGGAATTAAACCTAGCGGCAGG - Intergenic
1125171865 15:36774221-36774243 CAGGATTTAAACTTAGATGAAGG + Intronic
1132958330 16:2608485-2608507 CAGAAATTAAGTGTGGCTGCGGG - Intergenic
1132970942 16:2688581-2688603 CAGAAATTAAGTGTGGCTGCGGG - Intronic
1137780473 16:51094104-51094126 CAGGAATTGGCCTTGACTGCAGG - Intergenic
1138453731 16:57108792-57108814 CAGTAATTAACCTTGACTGGAGG + Intronic
1144189473 17:12831247-12831269 CAGCAGTGAGACTTGGCTGCCGG + Intronic
1147774884 17:42893671-42893693 CAGGAGTTAAACTTTGTTGATGG - Intergenic
1148852021 17:50560166-50560188 CTGGAGTTGAGCTTGGCTGCGGG - Intergenic
1154440662 18:14387385-14387407 CAGAAATCAGACTTGGGTGCCGG - Intergenic
1158925276 18:62251405-62251427 AAGGAATTAAAGGTGGCTTCTGG - Intronic
1161701961 19:5800588-5800610 CAAGACTCAGACTTGGCTGCTGG - Intergenic
1164436910 19:28238241-28238263 CAGGAAGGAAACATGGCTGCTGG + Intergenic
1164685792 19:30165749-30165771 CAGGAATTCTACTTGGATCCAGG + Intergenic
1164887690 19:31796677-31796699 TAGGAATTAAAATAGGCAGCTGG + Intergenic
1168138352 19:54366977-54366999 GAGGAATTCAAGTAGGCTGCTGG + Intronic
924980946 2:221148-221170 CAGGAATGAAGCTTGTCTCCAGG + Intronic
925078464 2:1040198-1040220 CAGGAATTTATCCTGCCTGCAGG - Intronic
925902742 2:8520068-8520090 CAGGCTTTAAACTGGGCTTCTGG - Intergenic
926250136 2:11150738-11150760 CAGGAATTAAAATGGGAGGCAGG - Intergenic
927735028 2:25512689-25512711 CAGGATTTAAACTGGACTCCAGG + Intronic
929096143 2:38264930-38264952 CAGGAATTAAATTACTCTGCAGG - Intergenic
929311039 2:40425602-40425624 CAGTACTTAAACATGGCTGATGG - Intronic
930673550 2:54176749-54176771 CAGGAATTGACCTTGGCCTCAGG + Intronic
932983741 2:76700882-76700904 CAGGACATATATTTGGCTGCTGG + Intergenic
934125474 2:88884738-88884760 CAGGACTTTAACTTGGCTTTAGG + Intergenic
935091484 2:99898917-99898939 CAGGAAGGAGACTGGGCTGCTGG - Intronic
938416459 2:131106777-131106799 CAGGAATCAAACTGTGTTGCAGG + Intronic
942420731 2:175804922-175804944 CATGAAATATACTTGGCTCCTGG + Intergenic
943179999 2:184529433-184529455 CAGGAATGAAGCATGGCTTCAGG - Intergenic
944116447 2:196192112-196192134 CAGGAATTTAATTTGGGGGCAGG + Intergenic
1169163159 20:3399883-3399905 CAGGAACTAAGTTTGGCAGCTGG - Intronic
1169225358 20:3853188-3853210 CAGAAATTAAAGATGGCGGCCGG + Intronic
1170815204 20:19708217-19708239 CAGGTACTAAATTTGGCTGAGGG - Intronic
1171104592 20:22420680-22420702 CAGATATTAACCTTGGCTACAGG + Intergenic
1171893206 20:30735909-30735931 CTGTCATTTAACTTGGCTGCAGG + Intergenic
1174733052 20:52937131-52937153 CATGAATTTAACTTTGCCGCCGG + Intergenic
1174807611 20:53618009-53618031 CCAGAATTAAACCGGGCTGCAGG + Intergenic
1178287889 21:31340659-31340681 CAAGAATTTAACTTGGAAGCTGG - Intronic
1179201716 21:39229542-39229564 TATTAATTAAACTTGTCTGCGGG - Intronic
1179389183 21:40971797-40971819 CAGGATTCAAACTTGGCGTCTGG + Intergenic
1183736081 22:39645712-39645734 CTGGGAGTGAACTTGGCTGCCGG - Intronic
1184043964 22:41960598-41960620 GACAAATCAAACTTGGCTGCAGG - Intergenic
949709711 3:6860502-6860524 CAGGAGCTGAGCTTGGCTGCAGG - Intronic
950410173 3:12830990-12831012 CAACAACTAAACATGGCTGCAGG - Intronic
955238609 3:57161337-57161359 CAAGAATTATCCTTGGCTGTGGG - Intronic
956346781 3:68288011-68288033 CAGGAATTTACCATGGCTCCTGG - Intronic
958672235 3:97219770-97219792 GAGAAATTAAAGCTGGCTGCAGG - Intronic
959076921 3:101759081-101759103 CAGGCATTAAACTTGGCAGTTGG + Intronic
959136379 3:102427146-102427168 CACGAAATAAAATAGGCTGCTGG - Intronic
959741426 3:109724840-109724862 CAGGAATGAAGCTGGGCTTCAGG + Intergenic
960046114 3:113200178-113200200 CAGAAATTAAAATTGAGTGCAGG - Intergenic
961961909 3:130864451-130864473 AAGAAATTCAAGTTGGCTGCAGG + Intronic
966325660 3:178750852-178750874 CAGGAAGTTAATTTGCCTGCTGG - Intronic
970865192 4:20750323-20750345 CAGGCAGTAAAGTTGGCTGATGG + Intronic
973245443 4:48005751-48005773 AAGGAATCAAACTTGGCTTATGG - Intronic
974529273 4:63086073-63086095 CAGGAATGAATCTTGGCAGTCGG + Intergenic
975462179 4:74666375-74666397 CAGAATGTAAACATGGCTGCTGG + Intergenic
977864357 4:102005859-102005881 CAGGAATTAAACTTGGCTGCTGG + Intronic
978729101 4:112003947-112003969 CAGGAATTAAACCTCACTGCTGG - Intergenic
980716326 4:136635045-136635067 CAAGAATTATATTTGGATGCTGG - Intergenic
981292734 4:143095482-143095504 AAGGAATTAAACTTGACTTATGG + Intergenic
981483435 4:145260400-145260422 GAGGAATTCAAGTAGGCTGCAGG - Intergenic
981555695 4:145991096-145991118 AAGGAATTAAAACTGGCTGAAGG + Intergenic
981861894 4:149365466-149365488 CAGGAATTAAAGTTTTCTTCTGG - Intergenic
985583548 5:713592-713614 AAGGAATTATGCTTGGCTCCTGG + Intronic
985597060 5:797889-797911 AAGGAATTATGCTTGGCTCCTGG + Intronic
987637195 5:20559040-20559062 TAGGAATTAATCTAGTCTGCCGG - Intronic
987670611 5:21002503-21002525 CAGGAATTCCAATTGGTTGCTGG + Intergenic
997629217 5:135354052-135354074 CAGGCATTGCACTTGTCTGCAGG - Intronic
1000606149 5:163329857-163329879 CAGGATTTAGACTAGGCTGGAGG + Intergenic
1001271618 5:170316638-170316660 CAGGAAATAAACTGGTGTGCAGG - Intergenic
1002561526 5:180085300-180085322 CAGGTATCAAAATTGGCTGAAGG - Intergenic
1008364669 6:50663523-50663545 AAGAAAATAAACTTGGCTACAGG - Intergenic
1008728158 6:54446455-54446477 CAGCAAATAGACTTGACTGCTGG + Intergenic
1010575917 6:77531060-77531082 TTGGAAATACACTTGGCTGCTGG - Intergenic
1011477630 6:87763603-87763625 GAGGAATTAAAATTGGTTACCGG + Intergenic
1014082626 6:117305149-117305171 CAGGTATTATTCTTGGCTTCAGG + Intronic
1017766886 6:157614165-157614187 CAGGACTTGAACTTGGGTCCTGG - Intronic
1023490141 7:40730992-40731014 AAGGAATTTAACTTGACTGAAGG + Intronic
1023634931 7:42200119-42200141 CAGAAATAAGACTTGGCAGCAGG + Intronic
1033959709 7:146899447-146899469 CAGGAATGAATCTTGGCTTCTGG - Intronic
1039071324 8:33651789-33651811 GAGAAATTCAACCTGGCTGCAGG + Intergenic
1043255769 8:78135046-78135068 CAGCAATAAATGTTGGCTGCTGG + Intergenic
1043466590 8:80514067-80514089 GAGAAATTACACTAGGCTGCAGG - Intronic
1043685300 8:83077376-83077398 CAGGAATTATTCTTGGCTCTTGG + Intergenic
1045183386 8:99811202-99811224 CAGGAAGAAAACTTAGCTGGTGG - Intronic
1045525014 8:102934033-102934055 CAGGAATTGCCCTTGGCTGAAGG - Intronic
1046617781 8:116496474-116496496 CAGAATTTGAACTTGGCTCCTGG + Intergenic
1048002321 8:130388905-130388927 CAGAAGTGGAACTTGGCTGCAGG - Intronic
1051403279 9:16706776-16706798 AAGGAATTATACTTGACTGGGGG + Intronic
1053075729 9:35132813-35132835 AAGGAATTAAACTTGACTTATGG + Intergenic
1055125439 9:72714288-72714310 CAGGACTTAAACTTAGCTCTGGG - Intronic
1187031050 X:15488672-15488694 CAGTAATTAAACCAGGCTGATGG + Intronic
1187678629 X:21743525-21743547 CAGTACTTAAATTTGGCTGAAGG + Intronic
1187679885 X:21757210-21757232 CAGGAATTATTTTTAGCTGCAGG - Intronic
1190509938 X:51164545-51164567 CAGGAATGGACCTTTGCTGCGGG + Intergenic
1193338297 X:80316563-80316585 AAGGAATTAAACTTGACTGAAGG + Intergenic
1195591745 X:106636883-106636905 CAGGAATTAAAGTTGACTGAAGG - Intronic
1196322145 X:114353985-114354007 CAGGAATGAAACTTGCTTACAGG - Intergenic
1199443377 X:147894564-147894586 CAGCAATTTAACTTGGGGGCAGG + Intergenic
1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG + Intergenic
1202300806 Y:23411795-23411817 CTTGAATTAAACTTGGTTTCAGG - Intergenic
1202570005 Y:26258803-26258825 CTTGAATTAAACTTGGTTTCAGG + Intergenic