ID: 977866424

View in Genome Browser
Species Human (GRCh38)
Location 4:102033800-102033822
Sequence TTGCTACTTATTTGGGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977866424 Original CRISPR TTGCTACTTATTTGGGATAC AGG (reversed) Intronic
900704412 1:4071097-4071119 TTGATAGTTGTTTGGCATACTGG + Intergenic
904404651 1:30278133-30278155 TGGCTCCTTATTTGGGCTGCAGG - Intergenic
904546321 1:31275861-31275883 ATGTTTCATATTTGGGATACAGG - Intronic
904977267 1:34466314-34466336 TTACTACTGTATTGGGATACTGG - Intergenic
905106677 1:35567316-35567338 TGGCTTCTCATTTGGCATACAGG - Intergenic
907884244 1:58578190-58578212 CAGCTACTTACGTGGGATACAGG - Intergenic
908846586 1:68330728-68330750 TTGTTATTTATTTAGGAGACAGG + Intergenic
909144317 1:71910371-71910393 TTGGTACTTATTAGGTATCCAGG - Intronic
909719610 1:78753143-78753165 TTCCTATTTATTTGGAAAACAGG + Intergenic
910773076 1:90849621-90849643 TTGCTCCTTATTTGGTATACTGG - Intergenic
915664672 1:157433710-157433732 TTGCTATTCACTTGGGATAAAGG + Intergenic
917619495 1:176781559-176781581 TTGCTCCCTATTTAGGATATTGG + Intronic
917965225 1:180174527-180174549 TTGCTCCTTACTTGGGAAAAGGG - Intronic
919027411 1:192194537-192194559 TTGCTACTTATTTTGATTTCAGG - Intergenic
1063252443 10:4287969-4287991 TTGCTACGTATGTGGGATCAGGG + Intergenic
1066551182 10:36559239-36559261 TTGCAATTTATTTAGGAGACAGG - Intergenic
1069852256 10:71416783-71416805 GTCCTACCTATTTGGGAGACTGG - Intronic
1071871321 10:89797738-89797760 TTGCCATTTATGTGGGATAAAGG + Intergenic
1072296107 10:94010885-94010907 TTGCTACTTCTTAGAGAGACTGG - Intronic
1073834840 10:107429391-107429413 CTGCTCCTTACTTGGGATTCAGG + Intergenic
1076408880 10:130231810-130231832 TTGCTAGTTGTTTGGGGTAAAGG + Intergenic
1077020620 11:415696-415718 TTGCTCCTTATTTGGAAAAGGGG - Intronic
1085955102 11:81382910-81382932 TTGCTAATAATTTGGGATCAAGG - Intergenic
1086592236 11:88529042-88529064 CTGCTACTTATTTGCAAAACGGG - Intronic
1090021048 11:123128811-123128833 TAGCTACTTATATGGAACACTGG + Intronic
1092006786 12:5076850-5076872 TTGCTGCTTTCTTGGGAGACCGG - Intergenic
1092593838 12:9977579-9977601 TTCCTACTTATTTTGCATGCTGG + Intronic
1093528205 12:20129771-20129793 TTAATACATATTTGGTATACAGG + Intergenic
1095586070 12:43850775-43850797 ATGCTAATTATTTGGGAACCAGG - Intronic
1096028873 12:48393757-48393779 TTGATATTCATTAGGGATACTGG + Intergenic
1098783290 12:74715999-74716021 TTGATACTGTTTTGGGAAACTGG - Intergenic
1101949370 12:109162616-109162638 TATCTTCCTATTTGGGATACAGG - Intronic
1105441861 13:20421891-20421913 TTGCTTATTAATGGGGATACAGG + Intronic
1107217793 13:37942785-37942807 TTGGTACTTAGATGGGAGACTGG - Intergenic
1107335571 13:39351370-39351392 TTGCTATTTATTTGAGATAATGG - Intronic
1108077996 13:46701651-46701673 TTTCTAAAGATTTGGGATACAGG + Intronic
1108785543 13:53896832-53896854 TGGCTACTGATTTGGGGTAAGGG + Intergenic
1109494544 13:63150720-63150742 TTGCTACTTTTTTGTGATACTGG + Intergenic
1109899704 13:68750772-68750794 TAGCTACATACTTGGAATACAGG - Intergenic
1110136426 13:72073120-72073142 TTCCTACTTATTAGAGCTACAGG - Intergenic
1117101143 14:52349396-52349418 ATCCTATTTATTTGGCATACAGG + Intergenic
1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG + Intronic
1131043624 15:89295971-89295993 TTACTACTTTTTTTGGAGACAGG + Intronic
1132670711 16:1101196-1101218 GTGCTCTTTATTTGGGAGACGGG + Intergenic
1137648951 16:50102201-50102223 TTGGTACTTGTTTTGGAGACTGG + Intronic
1137856280 16:51797511-51797533 TTGCTCCTTATTTTGGCTTCAGG + Intergenic
1139379907 16:66524080-66524102 TTGCTTCATATTTGGGTTGCTGG - Intronic
1146107835 17:30058311-30058333 TTACTACTTACTTGGGTGACAGG + Intronic
1146611771 17:34312531-34312553 TTTCTCCTTATTTGGGCTGCTGG - Intergenic
1150040629 17:61856639-61856661 CTGATACTTATGTAGGATACTGG + Intronic
1150549903 17:66200378-66200400 TTGCTAGTTTTTATGGATACTGG - Intergenic
1153475308 18:5492603-5492625 CTGCCAATTATTTGGGTTACTGG + Intronic
1153789923 18:8569195-8569217 TTGGTACTTATTTGGAATGATGG + Intergenic
1155910092 18:31496940-31496962 TTGCCATTTAATTGGGATAAAGG + Intergenic
1157061426 18:44295580-44295602 TTGCTACATATTTGGGGTATTGG - Intergenic
1158253758 18:55521081-55521103 TTGCTACTTACTAGGAATTCTGG + Intronic
1158808300 18:61001403-61001425 TTGCTCTTTAGTTGGGAGACTGG + Intergenic
1165576831 19:36826956-36826978 TTGCCATTTATGTGGGATAAAGG - Intronic
1168019712 19:53600409-53600431 TTGCTATGTATTTTGGATATGGG - Exonic
1168429025 19:56262545-56262567 ATGCCAGTTACTTGGGATACTGG - Intronic
929673497 2:43899765-43899787 TTGCTACTTAAATGTGATTCAGG - Intronic
932845986 2:75136238-75136260 TGGCTACTTCCTTGGGAGACAGG + Intronic
933447155 2:82396038-82396060 TTGCCACTTATATTTGATACAGG - Intergenic
935301980 2:101700365-101700387 TTGGTAGGTATTTGGGATACTGG + Intronic
936176031 2:110220739-110220761 TTGCCATTTATATGGGATAAAGG - Intergenic
937140893 2:119599255-119599277 TTGATACCTAGTTGGGAGACAGG + Intronic
939070709 2:137538064-137538086 TTGCTATTTTTCAGGGATACAGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940723486 2:157307918-157307940 TTGGTACTTATTTTAGACACTGG + Intronic
944379208 2:199087649-199087671 TTGCTACGTAATTAAGATACAGG - Intergenic
946666679 2:222057769-222057791 TTGCTTCCTATCTGGGATGCCGG + Intergenic
946905403 2:224411187-224411209 TTGCTGCTTCTCTGGGTTACTGG - Intergenic
1169519987 20:6360529-6360551 TTGTTATGTATTTTGGATACAGG + Intergenic
1173306100 20:41851706-41851728 TTGCTTCTCATGTGAGATACTGG + Intergenic
1182265529 22:29112007-29112029 TTTCTAGTTTCTTGGGATACAGG - Intronic
1183789038 22:40050127-40050149 CTGCTACTTAGTTACGATACTGG + Intronic
1183942153 22:41301977-41301999 TTGCTCCTTTTTGGGGATCCCGG + Intronic
952094264 3:29929892-29929914 TTGCTATTTATTTTGGAAATGGG - Intronic
952864292 3:37841948-37841970 TTGATATTCATTTGGGATATTGG - Intergenic
957234779 3:77572596-77572618 TTGAGACTTATCTGGGAAACTGG + Intronic
958452051 3:94285483-94285505 TTGTTAATTATTTGGGATGTAGG - Intergenic
958856635 3:99393644-99393666 TTGCTGCTTTTCTGGGATATAGG - Intergenic
962634148 3:137312920-137312942 TTTCTACTTTATTGGGACACAGG + Intergenic
963772383 3:149401133-149401155 TTGCTACTTTTTCTGGATTCTGG - Intergenic
965361729 3:167748908-167748930 TTACCACTAGTTTGGGATACGGG + Intronic
965369811 3:167847825-167847847 TTGCTTGTTTTTTGGGAGACAGG - Intergenic
970460352 4:16268922-16268944 TAACTACTTTTTAGGGATACTGG - Intergenic
971577823 4:28299360-28299382 TTGCTATTTATCAGGGATATTGG + Intergenic
971665401 4:29477576-29477598 TTGGTATTTATTTGGTATATTGG - Intergenic
973217453 4:47686005-47686027 CTGCTACTTGTATGAGATACAGG - Intronic
976679003 4:87734354-87734376 TTGCTAATTATTTGGCATAATGG + Intergenic
977866424 4:102033800-102033822 TTGCTACTTATTTGGGATACAGG - Intronic
980760511 4:137227248-137227270 TTCCTACTCATATGAGATACTGG + Intergenic
981280339 4:142950698-142950720 TTGCTTCTTTTTCTGGATACTGG - Intergenic
989998342 5:50862506-50862528 TTGCCACTTATTTGGAAGCCAGG + Intergenic
993590713 5:89791580-89791602 TTGCTACTTGTTAGTGATATTGG + Intergenic
998959526 5:147470085-147470107 TTGCTCCTGAGTTGGGATAAGGG - Intronic
1000667965 5:164022486-164022508 TTGATAATTATCTGGGATGCAGG + Intergenic
1004677889 6:17862270-17862292 TTGCTACCTAAGTGGGCTACTGG + Intronic
1006198883 6:32268336-32268358 CTCCTACTTATTTGCGATTCAGG - Intergenic
1008240983 6:49111491-49111513 TTGATACTTATTTGGGGATCAGG - Intergenic
1008455350 6:51704657-51704679 TGACTACTAATTTGGGAGACTGG + Intronic
1012353878 6:98288945-98288967 TTCCAACTTATCTGAGATACAGG - Intergenic
1014524656 6:122488339-122488361 TTGCTACGTATTTGGCAAACGGG + Intronic
1018592564 6:165443209-165443231 TAGTTACTTGTTTGGGGTACAGG + Intronic
1026066290 7:67076365-67076387 TTGCTATTTCTTTGTGACACTGG + Intronic
1027870821 7:83705658-83705680 ATGCTACTTATTTGGGATTAAGG - Intergenic
1027931290 7:84538269-84538291 TTCCTACTAATTTAGGATAATGG - Intergenic
1031497747 7:122471724-122471746 TTGAAACTGATTTGGGACACTGG + Intronic
1032340963 7:131072624-131072646 TTTGTACTTATTTGTTATACTGG - Intergenic
1032773910 7:135090425-135090447 TTGCTATTTCCTTGGGACACAGG + Intronic
1034091867 7:148371142-148371164 TTGTTAATTATTTGGGATTTAGG - Intronic
1035321954 7:158035693-158035715 TTGACACTCATGTGGGATACAGG - Intronic
1037402217 8:18504586-18504608 CTGCTTCTCATTTTGGATACTGG + Intergenic
1037533234 8:19800226-19800248 TAATTACTTATTTTGGATACAGG - Intergenic
1039828461 8:41194567-41194589 TTACTATTTATTTTGGAGACAGG - Intergenic
1042638893 8:70910386-70910408 TTTCTACTAATTGGGGATATGGG + Intergenic
1043663626 8:82780083-82780105 TAGCAATTTATATGGGATACAGG + Intergenic
1047197633 8:122735827-122735849 TTGCTCCTTCTTTGGAGTACTGG + Intergenic
1048152402 8:131906530-131906552 TTGTTGCTTATTTGGAATATTGG + Intronic
1050357603 9:4797702-4797724 TTCCTAATCATTAGGGATACAGG - Intronic
1055384037 9:75741822-75741844 TTGCTACCTATTTAGGAAATAGG - Intergenic
1057937217 9:99250676-99250698 TTGCAACATATTTGGCAAACTGG - Intergenic
1058353434 9:104054577-104054599 TTTCTATTTCTTTGGGATAGTGG - Intergenic
1061622028 9:131816862-131816884 TTGCTACTTCTGTTGGATATTGG + Intergenic
1190032152 X:46984342-46984364 AGGCTACTTATTTGGGATATGGG + Intronic
1192004578 X:67196458-67196480 TTGCTATTTATCAGGGATACTGG - Intergenic
1192037761 X:67584116-67584138 TTACTACTTATTGGGGATCCTGG + Intronic
1194887669 X:99337442-99337464 TTTATACTTATCAGGGATACTGG + Intergenic
1197079951 X:122400337-122400359 CTGCTACTCATTTGGAGTACGGG + Intergenic
1197954839 X:131934960-131934982 TTGCTAAATAATTGGAATACAGG + Intergenic
1198005797 X:132491204-132491226 TTGCTAGTTATTTGAGAAAAGGG + Intergenic
1199332523 X:146579459-146579481 TTGCTATTTACATGGGATAAAGG + Intergenic
1199611347 X:149617941-149617963 ATGCTACTTATTTGACATTCTGG + Intronic