ID: 977867620

View in Genome Browser
Species Human (GRCh38)
Location 4:102048748-102048770
Sequence AAGTGCACTAAGTTTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977867617_977867620 11 Left 977867617 4:102048714-102048736 CCAACTGTTTTCCCATTGAAAGT 0: 1
1: 0
2: 3
3: 59
4: 295
Right 977867620 4:102048748-102048770 AAGTGCACTAAGTTTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 90
977867618_977867620 0 Left 977867618 4:102048725-102048747 CCCATTGAAAGTATAAGCATTTC 0: 1
1: 0
2: 1
3: 24
4: 200
Right 977867620 4:102048748-102048770 AAGTGCACTAAGTTTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 90
977867619_977867620 -1 Left 977867619 4:102048726-102048748 CCATTGAAAGTATAAGCATTTCA 0: 1
1: 0
2: 1
3: 27
4: 308
Right 977867620 4:102048748-102048770 AAGTGCACTAAGTTTAAGACTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977867620 Original CRISPR AAGTGCACTAAGTTTAAGAC TGG Intronic
900797573 1:4718343-4718365 AAATGCAATAAGTTGAAGCCAGG - Intronic
906838374 1:49108875-49108897 AAGTGCACTAAACTGCAGACAGG + Intronic
907193874 1:52670606-52670628 AAGATCATTAAATTTAAGACAGG + Intergenic
911499780 1:98670964-98670986 GAGTACACTAAGTTTAAATCTGG - Intronic
913256048 1:116954534-116954556 AAGTTAACTAAGTTTCAGAGGGG + Intronic
923013816 1:230110140-230110162 AGGAGCACTAAGTTTAAGGAAGG - Intronic
923133724 1:231099310-231099332 AAGTGCACTGAGTCTGAGAAAGG + Intergenic
923377838 1:233382702-233382724 TAAGGCACTTAGTTTAAGACAGG - Exonic
923983911 1:239357832-239357854 AAGGGCACAGAGTTTAAGACAGG - Intergenic
1065127590 10:22588725-22588747 AAGGGCACTAAGTAGAAGTCAGG - Intronic
1069700649 10:70422441-70422463 AAATGCACTAAGTAAAAGAATGG - Exonic
1070342297 10:75508993-75509015 AAGTGCACTATATTAAAGGCAGG + Intronic
1073615772 10:104993216-104993238 AAATGCACTAAGTGGAAGAGGGG + Intronic
1081943406 11:46965022-46965044 GAGTGCACAAATTTTAAGACTGG + Intronic
1083036107 11:59639032-59639054 AACTGCAGTAAGTTTGAAACAGG - Exonic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1087502104 11:98970867-98970889 TAGTTCACTCAGTTTCAGACAGG + Intergenic
1091495227 12:966594-966616 AAGTGCACTGACTGTAAGTCAGG - Intronic
1093850959 12:24037653-24037675 AATAGAAATAAGTTTAAGACTGG - Intergenic
1107170703 13:37339740-37339762 AAGGGCACAAAATTTTAGACAGG - Intergenic
1108494785 13:51014310-51014332 AAGTCCACTAAAATTTAGACGGG + Intergenic
1108741527 13:53343603-53343625 AAGGGCCCTAGGTTTAAGTCAGG - Intergenic
1110047269 13:70845790-70845812 AAGTGCACAAAATGTCAGACAGG - Intergenic
1116593481 14:46810062-46810084 AAATGCATGAAATTTAAGACTGG + Intergenic
1118355437 14:65009781-65009803 AAGAGCATTGAGTTTAAGGCTGG - Intronic
1125132367 15:36298425-36298447 AAATGCACTAATTTTGAGAAGGG + Intergenic
1130201592 15:81834019-81834041 ATGTGCTTTAAGTTTAATACAGG + Intergenic
1137785111 16:51132132-51132154 AAGAGCCCAAACTTTAAGACTGG + Intergenic
1140845503 16:78883219-78883241 AAGTTCACAAAGCTTAAGAGGGG - Intronic
1143073828 17:4322118-4322140 AAATGCACAAAGTTAAAAACTGG + Intronic
1147433554 17:40390919-40390941 AATTGAATTAAGTTTAAGGCTGG - Intronic
1150287841 17:63963940-63963962 ACCTGCACTAAGTTTGACACAGG - Intronic
1155860695 18:30894489-30894511 AAGTTGAATAAGTTTAACACTGG - Intergenic
1156372340 18:36482671-36482693 AATTACACAAAGTATAAGACAGG - Intronic
1156675509 18:39522877-39522899 AAGCTGACTGAGTTTAAGACTGG - Intergenic
1156956386 18:42969862-42969884 AAGTGCACAAATTTTGATACTGG - Intronic
1161741595 19:6024271-6024293 ATGTGCTCTGAGTTTAAGACTGG + Intronic
1162269576 19:9603378-9603400 AAATGCACTAAGTATAATAGAGG + Intergenic
1168677767 19:58291363-58291385 AAGAGCACTGAGGTTGAGACAGG - Intronic
926347088 2:11957136-11957158 AAGTGCATGAACTTGAAGACAGG - Intergenic
928835830 2:35543515-35543537 AAGAGTACTAAGCTTAAGTCTGG + Intergenic
932025309 2:68126227-68126249 AAGTGCTGTAAGTTAAAGAATGG + Intronic
939796734 2:146654909-146654931 GAGGGCACTGAGTTTTAGACTGG + Intergenic
941728569 2:168890423-168890445 AAGTGCACTAGGTTTGAAATCGG - Exonic
944329749 2:198451711-198451733 AAGTAGACTGAGATTAAGACAGG - Intronic
946105400 2:217365054-217365076 AAGTGCACTGAGTTTCACTCAGG - Intronic
1172395502 20:34601178-34601200 AAGTGCTCTCAGTGTTAGACTGG + Intronic
1177562741 21:22777999-22778021 AAATGCATGATGTTTAAGACAGG + Intergenic
1178850555 21:36209011-36209033 AGGTGCACCAAGCTTAAGTCTGG + Intronic
1179006156 21:37517203-37517225 AAGTGCATTAAGTTTGGGTCAGG + Intronic
1182920666 22:34076165-34076187 AAGTGCAATTAATTTAAGAAGGG - Intergenic
949201527 3:1386035-1386057 AAGAGCATAATGTTTAAGACTGG + Intronic
949408996 3:3743423-3743445 TAGTCCACTAAGTTTTAGAGCGG + Intronic
957366116 3:79226111-79226133 AAGTGCATGAAGATTAAGAGTGG - Intronic
977867620 4:102048748-102048770 AAGTGCACTAAGTTTAAGACTGG + Intronic
978982603 4:114967579-114967601 AAGTGGGGGAAGTTTAAGACAGG + Intronic
980460116 4:133099285-133099307 ATGGGCACTAAGCTTAATACTGG - Intergenic
982810018 4:159813530-159813552 AAGAGCACTGAGTTTTAGAAAGG - Intergenic
983223272 4:165063245-165063267 AATTTCACTGAGTTTTAGACGGG - Intergenic
986151769 5:5136577-5136599 GAGTGGACCGAGTTTAAGACTGG - Intergenic
987266672 5:16262991-16263013 AAGTGCACCAAGATTGAGAATGG - Intergenic
987919530 5:24261201-24261223 TAGTGCAATAAATTCAAGACTGG + Intergenic
989014220 5:36910523-36910545 AAGTGAACTAGGATAAAGACAGG - Intronic
995374733 5:111461422-111461444 AATTGCACCAAGTTTTAAACAGG + Intronic
996468826 5:123835552-123835574 CAGGGCACTAAGTTCACGACAGG - Intergenic
997617995 5:135265707-135265729 AAGTGCTCTAAGATCAAGCCAGG - Intronic
1000128140 5:158267841-158267863 AACTGCATTAAGGTTAAGAGAGG - Intergenic
1004234573 6:13862686-13862708 AAGTGCACTAACTCTGACACAGG + Intergenic
1005234971 6:23749689-23749711 AAGGGTACAAAGTTTAAGTCAGG - Intergenic
1008645687 6:53511929-53511951 AAAAGCACTAAGTTCATGACAGG - Intronic
1009038421 6:58146671-58146693 AAGTGCAGTAACTGTAAGATGGG - Intergenic
1009214210 6:60900324-60900346 AAGTGCAGTAACTGTAAGATGGG - Intergenic
1009322300 6:62307276-62307298 AAGTACACTAACTTTAGGGCCGG - Intergenic
1009559729 6:65223461-65223483 AATAGCACTAAGTTAGAGACTGG - Intronic
1010532618 6:76987815-76987837 TAGTGCTCTAAGTCTGAGACTGG - Intergenic
1010702952 6:79074167-79074189 AAGTGGAATAATTTTAAGAAAGG + Intronic
1011310083 6:85971998-85972020 AAATGCAAGAAGTTTAATACAGG - Intergenic
1012345306 6:98178780-98178802 AAATGCACTAAGTAAAAGAATGG + Intergenic
1012710981 6:102604131-102604153 AAGAGCAGGAAGTATAAGACAGG - Intergenic
1019752145 7:2737588-2737610 AAGTGCAGAAACTGTAAGACAGG - Intronic
1029928941 7:104350351-104350373 AAATCCGCTAGGTTTAAGACTGG - Intronic
1030025407 7:105319477-105319499 AAGTGCATTAAATTTAAGAGTGG - Intronic
1030118548 7:106083317-106083339 AAGTGTAGTAAGTTTGAGAGTGG - Intergenic
1032175968 7:129626121-129626143 AATTGCCTTAATTTTAAGACAGG + Intronic
1032345769 7:131115054-131115076 AACTGCAGTGAGTTCAAGACAGG + Intronic
1032947957 7:136872953-136872975 AAGTGGGAAAAGTTTAAGACAGG - Intronic
1046863376 8:119119136-119119158 GAGTGCACTAATGTTAAGCCTGG - Intergenic
1191715595 X:64191653-64191675 AAGGGCTCAAAGTTTAAGAAGGG + Exonic
1194124703 X:90001503-90001525 AAGGGTACAAAGTTTTAGACAGG + Intergenic
1194332026 X:92594998-92595020 AAGTGTACTTAATTTATGACAGG + Intronic
1194473898 X:94335197-94335219 AAATGCATTAAGTTTTATACGGG + Intergenic
1197598620 X:128499126-128499148 AAATCAACTAAGTTTAAAACAGG - Intergenic
1198518534 X:137430428-137430450 AACAGCACTAAGTTTACGAGCGG + Intergenic
1200409776 Y:2849726-2849748 AGGTTCACTAAGGGTAAGACTGG - Intronic
1200640732 Y:5714053-5714075 AAGTGTACTTAATTTATGACAGG + Intronic