ID: 977868324

View in Genome Browser
Species Human (GRCh38)
Location 4:102058164-102058186
Sequence TTATTTACTAGGAGACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977868324 Original CRISPR TTATTTACTAGGAGACTGGC TGG (reversed) Intronic
902276621 1:15344674-15344696 TGATTTACTAGTAAACTGGGTGG + Intronic
903198080 1:21708585-21708607 TTATTTAATAGAAAACAGGCCGG + Intronic
907868745 1:58423909-58423931 GTATTTATTAGGAGCCTTGCAGG - Intronic
922035952 1:221848317-221848339 TTAATTACTAGGTGGCTTGCTGG - Intergenic
924902208 1:248412766-248412788 TTAGTTCCTAGGAGAGTGGGTGG + Intergenic
1066683248 10:37955977-37955999 TTAATTAACAAGAGACTGGCTGG - Intronic
1068626557 10:59255167-59255189 TTATATACTAGGTTACTGACAGG + Intronic
1070705442 10:78634492-78634514 TAATTTACTTGGAGTCTGTCTGG + Intergenic
1072989295 10:100175612-100175634 TGATTTGGTAGGAGACTGACAGG - Intronic
1073472715 10:103733065-103733087 TGATTTACTCTGAGAATGGCGGG - Intronic
1073629362 10:105132920-105132942 TTCTTTACTAGCAAACTTGCTGG - Intronic
1079923627 11:26464105-26464127 TTATTTACTAACACACTGGTGGG - Intronic
1079991020 11:27247096-27247118 TTATTTATGAGGATACTGGAAGG + Intergenic
1080197546 11:29630066-29630088 TTTTTTCCTAGGAGAAAGGCAGG + Intergenic
1087733162 11:101801184-101801206 TTATTTACTGGCACACAGGCTGG + Intronic
1088764664 11:112963250-112963272 TTATTTCCTCGGAAACTGCCGGG - Intronic
1091214572 11:133892879-133892901 TGATTGACTGGGTGACTGGCTGG + Intergenic
1093066295 12:14661870-14661892 TTATTTACTAGAACACTAGTGGG + Intronic
1094056319 12:26272897-26272919 TCATTTACCTGGAGCCTGGCTGG - Intronic
1095142922 12:38688801-38688823 TAATGGACTTGGAGACTGGCGGG + Intronic
1095171668 12:39043199-39043221 TTATTTCCTAGGAAACTCCCAGG + Intergenic
1096789740 12:54037288-54037310 ATATGTTCTAGGAGGCTGGCTGG - Intronic
1097789216 12:63796405-63796427 ATATTTACTAGGAGATTCTCTGG + Intronic
1099316815 12:81094263-81094285 TTATTTTTTTGGAGAATGGCTGG - Intronic
1099778402 12:87163750-87163772 CTACTTCCTAGGAGACTGACAGG + Intergenic
1101123575 12:101608642-101608664 TTATTTGCTAAGAAACTGGTGGG + Intronic
1104488256 12:129170790-129170812 TTTTTTACTTGGAGTCTCGCTGG - Intronic
1106435298 13:29718235-29718257 TTTATTACTAGGAGATAGGCTGG - Intergenic
1114325018 14:21580191-21580213 TTGTTTCCTAGGAGACTCTCTGG + Intergenic
1116069490 14:40025838-40025860 TTCTTTACTAGGAGAGGGCCTGG + Intergenic
1116638957 14:47436462-47436484 TCATAAACTAGGAGAATGGCAGG + Intronic
1118986518 14:70760368-70760390 ACATTTACTAGGAGGATGGCTGG + Intronic
1119026515 14:71157087-71157109 TGGTTTTCTTGGAGACTGGCTGG + Intergenic
1122251147 14:100440757-100440779 TTATTTACGAAGGGACAGGCCGG + Intronic
1126125249 15:45289756-45289778 TTCTTTACTAGGAGACAGTGTGG + Intergenic
1126306603 15:47265787-47265809 TTACTTATTTAGAGACTGGCTGG + Intronic
1126540070 15:49812853-49812875 ATATTTTCTAATAGACTGGCAGG - Intergenic
1129139157 15:73581517-73581539 CTATTTATTAGGATACTGGAGGG - Intronic
1129560300 15:76559406-76559428 TTATTTACAAGGCGACAGGAAGG - Intronic
1139613842 16:68077220-68077242 TTATTTATTTTGAGACAGGCTGG - Intronic
1139648534 16:68349466-68349488 TTATTTAAAAAAAGACTGGCAGG - Intronic
1144132314 17:12258469-12258491 TTAGTTTCTAGGAGCCAGGCAGG - Intergenic
1145178133 17:20719757-20719779 TTTTTTACTAGGCCACTGCCAGG + Intergenic
1146806523 17:35869155-35869177 TTATTCACTGGGAAAATGGCAGG + Intergenic
1149241894 17:54660779-54660801 TTATTTACCAGGAGTCTTTCAGG + Intergenic
1149278207 17:55069452-55069474 TTATTTATTAGAAGACAGCCTGG + Intronic
1150081516 17:62243884-62243906 TTTTTTACTAGGACACTGCCAGG - Intergenic
1151825161 17:76519898-76519920 TTATTTAAAAAGAGACTGGCCGG + Intergenic
1152335976 17:79700466-79700488 TTTTTCAGGAGGAGACTGGCTGG - Intergenic
1153813662 18:8774898-8774920 TGATTTGCTAGGAGGATGGCAGG + Intronic
1156608748 18:38700957-38700979 TTATTGACTTGTAGACTAGCTGG - Intergenic
1158507835 18:58062354-58062376 CTATTTTCTAGCAGACTGGAAGG - Intronic
1165540386 19:36488542-36488564 TTATTTACCAGCAGAATTGCCGG - Intronic
1166837291 19:45675189-45675211 TTTGTTACTAGGAGACAGGGTGG + Intronic
1202706521 1_KI270713v1_random:28481-28503 TTATTTTCTAGGAGGCTCGAAGG + Intergenic
926316630 2:11715001-11715023 TTATTTCCAAGGGGATTGGCAGG + Intronic
926744741 2:16141698-16141720 ATATTTCATAGCAGACTGGCTGG + Intergenic
930408359 2:50991441-50991463 TTATATACTAGAAAGCTGGCTGG - Intronic
932707536 2:74038314-74038336 TTTGTTACTAGGAGACTGAGAGG - Intronic
932945738 2:76228249-76228271 TTATGAGATAGGAGACTGGCAGG + Intergenic
934066104 2:88343551-88343573 TCATTTACTGGGAGCCTGTCTGG - Intergenic
936340003 2:111622875-111622897 ATATTTACTAATAGACTGGGTGG - Intergenic
938915530 2:135935248-135935270 TTCCTAACCAGGAGACTGGCAGG - Intronic
939068120 2:137508349-137508371 TTATTTAGCAGAAGCCTGGCAGG - Intronic
940357422 2:152759736-152759758 TTTTTTTCTAGGAAACTGACTGG + Exonic
943458688 2:188141711-188141733 TTTTTTACCAGTACACTGGCAGG + Intergenic
948065253 2:235073978-235074000 ACATTTACTGGGTGACTGGCTGG + Intergenic
1169457377 20:5763810-5763832 TTATAGACAAGGAAACTGGCCGG + Intronic
1169554022 20:6730848-6730870 TTGCTTACTGGGTGACTGGCAGG - Intergenic
1172751456 20:37254043-37254065 TTAAGAACTAGGAGAGTGGCTGG - Intronic
1173828129 20:46060321-46060343 TCATCTCCTAAGAGACTGGCAGG + Intergenic
1175631086 20:60536979-60537001 CTATCAATTAGGAGACTGGCTGG + Intergenic
1182661692 22:31929594-31929616 TTATTTTTTATGAGTCTGGCTGG + Intergenic
949861630 3:8510315-8510337 CTCTTAACAAGGAGACTGGCTGG - Intronic
949896161 3:8768739-8768761 ATGTTTACTAGGAGAGGGGCTGG - Intronic
954618825 3:51984287-51984309 CTATTTACTTGGGGAATGGCTGG - Intronic
955887407 3:63615270-63615292 TTGTTTTCAAGGAGACCGGCTGG + Exonic
956617465 3:71187029-71187051 TTATTTACTAGGTGGCAGGCTGG + Intronic
959595799 3:108127299-108127321 CCATTCACTGGGAGACTGGCTGG - Intergenic
961188780 3:124939823-124939845 TGATTTAGGAGGAGACTGGGGGG + Intronic
965834435 3:172836136-172836158 TCAGTTTCTAGGAGACTGACTGG - Intergenic
966641821 3:182200080-182200102 TATTTTACTAGGAGACATGCTGG - Intergenic
966942967 3:184758506-184758528 TCATCTACTGGGACACTGGCAGG - Intergenic
967061122 3:185873690-185873712 TTATATGGTAGGGGACTGGCTGG - Intergenic
967201087 3:187073179-187073201 GTATTTACTGGGATAGTGGCTGG + Intronic
967925467 3:194642236-194642258 TTATTTCCTAGGAGAATGTGAGG - Exonic
973890343 4:55361895-55361917 TTGTTTACTGTGAGACTGACTGG + Intronic
974732138 4:65881076-65881098 GTATTTCCTAGGAGTCTGACTGG - Intergenic
975432863 4:74315473-74315495 TTATTCAGTAGGAGACTTCCAGG - Intergenic
977868324 4:102058164-102058186 TTATTTACTAGGAGACTGGCTGG - Intronic
980002207 4:127503028-127503050 TTATTTACTTGGATTCTTGCAGG + Intergenic
982209926 4:153026222-153026244 TTATTTTTTAAGAGACAGGCTGG + Intergenic
983672749 4:170257260-170257282 TTGCTTAATACGAGACTGGCTGG + Intergenic
983758025 4:171365965-171365987 TAATTTTCAAGGAGACTGACAGG + Intergenic
986444829 5:7812116-7812138 TTAACTACTATGACACTGGCAGG - Intronic
986580850 5:9264402-9264424 TTATTTACTTGGAGCCTAGATGG - Intronic
988894052 5:35652693-35652715 TTATTCACTAGGAGATCAGCTGG + Intronic
989301558 5:39900796-39900818 TTATTTACTAATATACTGGCAGG - Intergenic
990787037 5:59433324-59433346 TTATTTACCAAAAGCCTGGCAGG + Intronic
992433460 5:76732194-76732216 TTTCTTACTAGGAGAGTGGGTGG - Intronic
993866934 5:93206869-93206891 TTCTTTACAAAGAGACTGGGTGG - Intergenic
996980218 5:129482746-129482768 GTAATAACTAGGAGAATGGCAGG - Intronic
1003480241 6:6524569-6524591 TTATTTATTTAGAGACAGGCAGG - Intergenic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1013314504 6:108928557-108928579 TTATTTCCTAGCAAACTGGAAGG - Intronic
1015655908 6:135518921-135518943 GTATTTACAAGGAGACTTGAAGG - Intergenic
1016407239 6:143743401-143743423 TTCTTTAGTAGGGGAGTGGCTGG + Intronic
1019891532 7:3951050-3951072 ATATTTACTAGGAGTCTCACAGG - Intronic
1019984356 7:4644506-4644528 TTATTTACTGGGAAAATGGTGGG - Intergenic
1020735377 7:11942411-11942433 TTGTTAACAAGGAGACTGACAGG + Intergenic
1021740262 7:23679913-23679935 TAATTTACAAGAAGACTCGCCGG + Intergenic
1021814308 7:24432763-24432785 TAATTTACAAGAAGACTCGCGGG + Intergenic
1024111530 7:46152237-46152259 TTGTTTACATGGAGACTGGTGGG - Intergenic
1026266378 7:68799207-68799229 TTATTTATTTAGAGACAGGCTGG + Intergenic
1029566880 7:101344644-101344666 TTATTTATTTGGAGATTGGGGGG + Intergenic
1029686872 7:102154589-102154611 TTATTTATTTGGAGACAAGCTGG - Intronic
1037115825 8:15225713-15225735 TGACTTGCTTGGAGACTGGCTGG + Intronic
1046446692 8:114330077-114330099 TTGTTTACTAAAAGACTTGCAGG - Intergenic
1051989930 9:23140365-23140387 ATATTCACTAGGAAACTGGGAGG + Intergenic
1052572775 9:30249165-30249187 TTGTTTACTATGATACTGACAGG + Intergenic
1061420919 9:130472463-130472485 TCAGTTCCTAGGACACTGGCTGG + Intronic
1061716299 9:132520613-132520635 TTATTTATTTAGAAACTGGCTGG - Intronic
1185516212 X:701038-701060 TTATTTACAAAGAGAATGGAAGG - Intergenic
1188838510 X:34987493-34987515 ATATTTACAAGGAGACTCACAGG + Intergenic
1189142027 X:38617111-38617133 TTATCTACAAAGAGCCTGGCTGG + Intronic
1189433640 X:40971841-40971863 TTATTTGCTTAGTGACTGGCTGG + Intergenic
1193172589 X:78353532-78353554 TCATTTAGTTGGAGACTGGGTGG + Intergenic
1195283715 X:103361808-103361830 CTTTTTACTAGGAAACTGACAGG + Intergenic
1195770539 X:108346478-108346500 TTATTTATTGGTAGACTGTCAGG - Intronic