ID: 977875021

View in Genome Browser
Species Human (GRCh38)
Location 4:102139511-102139533
Sequence TGCTGTGGGTTGCACCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977875018_977875021 0 Left 977875018 4:102139488-102139510 CCATGTGACTCTGCAATTTAGAC No data
Right 977875021 4:102139511-102139533 TGCTGTGGGTTGCACCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977875021 Original CRISPR TGCTGTGGGTTGCACCACTC TGG Intergenic
No off target data available for this crispr