ID: 977876306

View in Genome Browser
Species Human (GRCh38)
Location 4:102154663-102154685
Sequence ATGTCAGTATCATTTTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977876306_977876313 27 Left 977876306 4:102154663-102154685 CCTCTGTAAAATGATACTGACAT No data
Right 977876313 4:102154713-102154735 TGAGGCAAATTCTCTGTTGAGGG No data
977876306_977876312 26 Left 977876306 4:102154663-102154685 CCTCTGTAAAATGATACTGACAT No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data
977876306_977876308 0 Left 977876306 4:102154663-102154685 CCTCTGTAAAATGATACTGACAT No data
Right 977876308 4:102154686-102154708 TTGTCAGGTTCCCTAGAAAATGG No data
977876306_977876314 28 Left 977876306 4:102154663-102154685 CCTCTGTAAAATGATACTGACAT No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data
977876306_977876309 9 Left 977876306 4:102154663-102154685 CCTCTGTAAAATGATACTGACAT No data
Right 977876309 4:102154695-102154717 TCCCTAGAAAATGGACTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977876306 Original CRISPR ATGTCAGTATCATTTTACAG AGG (reversed) Intergenic
No off target data available for this crispr