ID: 977876310

View in Genome Browser
Species Human (GRCh38)
Location 4:102154696-102154718
Sequence GCCTCATAGTCCATTTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977876310_977876312 -7 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876312 4:102154712-102154734 ATGAGGCAAATTCTCTGTTGAGG No data
977876310_977876313 -6 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876313 4:102154713-102154735 TGAGGCAAATTCTCTGTTGAGGG No data
977876310_977876314 -5 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG No data
977876310_977876317 26 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876317 4:102154745-102154767 CAAGGCATCAAAAGTAAGAAAGG No data
977876310_977876315 8 Left 977876310 4:102154696-102154718 CCCTAGAAAATGGACTATGAGGC No data
Right 977876315 4:102154727-102154749 TGTTGAGGGGTACAATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977876310 Original CRISPR GCCTCATAGTCCATTTTCTA GGG (reversed) Intergenic
No off target data available for this crispr